Database ADAbase
Version 1.3
File adapub.html
Date 08-Aug-2014
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/ADAbase/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF10.html
Gene ADA
Disease Adenosine Deaminase Deficiency
OMIM 608958
Sequence IDRefSeq:D0001; IDRefSeq:C0001; UniProt:P00813
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry;
//
ID Q3X(1a),Q3X(1a); standard; MUTATION;
Accession A0052
Systematic name Allele 1 and 2: g.4037C>T, c.102C>T, p.Q3X
Original code FadMo
Description Allele 1 and 2; nonsense mutation in the exon 1
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8589684
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S.,
RefAuthors Loubser, M., Meydan, N., Roifman, C., Howell, P. L.,
RefAuthors Bowen, T., Weinberg, K. I., Schroeder, M. L., Herschfield,
RefAuthors M. S.
RefTitle Three new adenosine deaminase mutations that define a
RefTitle splicing enhancer and cause severe and partial phenotypes:
RefTitle implications for evolution of a CpG hotspot and expression
RefTitle of a transduced ADA cDNA
RefLoc Hum. Mol. Genet. 4:2081-2087 (1995)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 4037
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 102
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 4037
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 102
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Diarrhea;
Sex XX
Ethnic origin Negroid; Canada
Relative ADA; A0053 father
ADA activity nd
dAXP 403 nmol/ml
//
ID Q3X(1b),R142Q(1); standard; MUTATION;
Accession A0053
Systematic name Allele 1: g.4037C>T, c.102C>T, p.Q3X
Systematic name Allele 2: g.29885G>A, c.520G>A, p.R142Q
Original code Mo I-2
Description Allele 1; nonsense mutation in the exon 1
Description Allele 2; missense mutation in the exon 5
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8589684
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S.,
RefAuthors Loubser, M., Meydan, N., Roifman, C., Howell, P. L.,
RefAuthors Bowen, T., Weinberg, K. I., Schroeder, M. L., Herschfield,
RefAuthors M. S.
RefTitle Three new adenosine deaminase mutations that define a
RefTitle splicing enhancer and cause severe and partial phenotypes:
RefTitle implications for evolution of a CpG hotspot and expression
RefTitle of a transduced ADA cDNA
RefLoc Hum. Mol. Genet. 4:2081-2087 (1995)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 4037
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 102
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29885
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 520
Feature /codon: cga -> caa; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 142
Feature /change: R -> Q
Diagnosis Partial ADA deficiency
Symptoms Failure to thrive; Diarrhea;
Sex XY
Ethnic origin Negroid; Canada
Relative ADA; A0052 daughter
ADA activity <50%
dAXP 3 nmol/ml
//
ID Q3X(2),Q3X(2); standard; MUTATION;
Accession A0068
Systematic name Allele 1 and 2: g.1135C>T, c.7C>T, r.7c>u, p.Gln3X
Original code F1
Description Allele 1 and 2: A point mutation in the exon 1 leading to a
Description premature stop codon
Date 16-Mar-2007 (Rel. 1, Created)
Date 16-Mar-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17181544
RefAuthors Sanchez, J. J., Monaghan, G., Borsting, C., Norbury, G.,
RefAuthors Morling, N., Gaspar, H. B.
RefTitle Carrier frequency of a nonsense mutation in the adenosine
RefTitle deaminase (ADA) gene implies a high incidence of ADA-
RefTitle deficient severe combined immunodeficiency (SCID) in
RefTitle somalia and a single, common haplotype indicates common
RefTitle ancestry.
RefLoc Ann Hum Genet (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms recurrent severe infections, severe lymphopenia
Sex XY
Ethnic origin Negroid; Hawiye clan of Somalia
Family history Inherited
Protein ADA activity:absent
Metabolites deoxy AXP:elevated
Comment Patient also has a -> g mutation, leading to
Comment amino acid substitution K80R, which is known
Comment as a functional polymorphism
//
ID Q3X(3),Q3X(3); standard; MUTATION;
Accession A0069
Systematic name Allele 1 and 2: g.1135C>T, c.7C>T, r.7c>u, p.Gln3X
Original code F2
Description Allele 1 and 2: A point mutation in the exon 1 leading to a
Description premature stop codon
Date 16-Mar-2007 (Rel. 1, Created)
Date 16-Mar-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17181544
RefAuthors Sanchez, J. J., Monaghan, G., Borsting, C., Norbury, G.,
RefAuthors Morling, N., Gaspar, H. B.
RefTitle Carrier frequency of a nonsense mutation in the adenosine
RefTitle deaminase (ADA) gene implies a high incidence of ADA-
RefTitle deficient severe combined immunodeficiency (SCID) in
RefTitle somalia and a single, common haplotype indicates common
RefTitle ancestry.
RefLoc Ann Hum Genet (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms recurrent severe infections, severe lymphopenia
Sex XX
Ethnic origin Negroid; Hawiye clan of Somalia
Family history Inherited
Protein ADA activity:absent
Metabolites deoxy AXP:elevated
Comment Patient also has a -> g mutation, leading to
Comment amino acid substitution K80R, which is known
Comment as a functional polymorphism
//
ID Q3X(4),Q3X(4); standard; MUTATION;
Accession A0070
Systematic name Allele 1 and 2: g.1135C>T, c.7C>T, r.7c>u, p.Gln3X
Original code F3
Description Allele 1 and 2: A point mutation in the exon 1 leading to a
Description premature stop codon
Date 16-Mar-2007 (Rel. 1, Created)
Date 16-Mar-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17181544
RefAuthors Sanchez, J. J., Monaghan, G., Borsting, C., Norbury, G.,
RefAuthors Morling, N., Gaspar, H. B.
RefTitle Carrier frequency of a nonsense mutation in the adenosine
RefTitle deaminase (ADA) gene implies a high incidence of ADA-
RefTitle deficient severe combined immunodeficiency (SCID) in
RefTitle somalia and a single, common haplotype indicates common
RefTitle ancestry.
RefLoc Ann Hum Genet (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms recurrent severe infections, severe lymphopenia
Sex XY
Ethnic origin Negroid; Hawiye clan of Somalia
Family history Inherited
Protein ADA activity:absent
Metabolites deoxy AXP:elevated
Comment Patient also has a -> g mutation, leading to
Comment amino acid substitution K80R, which is known
Comment as a functional polymorphism
//
ID Q3X(5a),Q3X(5a); standard; MUTATION;
Accession A0071
Systematic name Allele 1 and 2: g.1135C>T, c.7C>T, r.7c>u, p.Gln3X
Original code F4a
Description Allele 1 and 2: A point mutation in the exon 1 leading to a
Description premature stop codon
Date 16-Mar-2007 (Rel. 1, Created)
Date 16-Mar-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17181544
RefAuthors Sanchez, J. J., Monaghan, G., Borsting, C., Norbury, G.,
RefAuthors Morling, N., Gaspar, H. B.
RefTitle Carrier frequency of a nonsense mutation in the adenosine
RefTitle deaminase (ADA) gene implies a high incidence of ADA-
RefTitle deficient severe combined immunodeficiency (SCID) in
RefTitle somalia and a single, common haplotype indicates common
RefTitle ancestry.
RefLoc Ann Hum Genet (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms recurrent severe infections, severe lymphopenia
Sex XX
Ethnic origin Negroid; Hawiye clan of Somalia
Family history Inherited
Relative ADAbase; A0072 brother
Protein ADA activity:absent
Metabolites deoxy AXP:elevated
Comment Patient also has a -> g mutation, leading to
Comment amino acid substitution K80R, which is known
Comment as a functional polymorphism
//
ID Q3X(5b),Q3X(5b); standard; MUTATION;
Accession A0072
Systematic name Allele 1 and 2: g.1135C>T, c.7C>T, r.7c>u, p.Gln3X
Original code F4b
Description Allele 1 and 2: A point mutation in the exon 1 leading to a
Description premature stop codon
Date 16-Mar-2007 (Rel. 1, Created)
Date 16-Mar-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17181544
RefAuthors Sanchez, J. J., Monaghan, G., Borsting, C., Norbury, G.,
RefAuthors Morling, N., Gaspar, H. B.
RefTitle Carrier frequency of a nonsense mutation in the adenosine
RefTitle deaminase (ADA) gene implies a high incidence of ADA-
RefTitle deficient severe combined immunodeficiency (SCID) in
RefTitle somalia and a single, common haplotype indicates common
RefTitle ancestry.
RefLoc Ann Hum Genet (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 1135
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 135
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 3
Feature /change: Q -> X
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms recurrent severe infections, severe lymphopenia
Sex XY
Ethnic origin Negroid; Hawiye clan of Somalia
Family history Inherited
Relative ADAbase; A0071 sister
Protein ADA activity:absent
Metabolites deoxy AXP:elevated
Comment Patient also has a -> g mutation, leading to
Comment amino acid substitution K80R, which is known
Comment as a functional polymorphism
//
ID H15D(1),L107P(4); standard; MUTATION;
Accession A0037
Systematic name Allele 1: g.19239C>G, c.138C>G, p.H15D
Systematic name Allele 2: g.29009T>C, c.415T>C, p.L107P
Original code AF
Description Allele 1; missense mutation in the exon 2
Description Allele 2; missense mutation in the exon 4
Date 28-Jul-2000 (Rel. 1, Created)
Date 28-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7599635
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Debre,
RefAuthors M., Fischer, A., Perignon, J. L., Hilman, B., ElDahr, J.,
RefAuthors Dreyfus, D. H., Gelfand, E. W., Howell, P. L., Hershfield,
RefAuthors M. S.
RefTitle Four new adenosine deaminase mutations, altering a
RefTitle zinc-binding histidine, two conserved alanines, and a 5'
RefTitle splice site
RefLoc Hum. Mutat. 5:243-250 (1995)
DB CrossRef OMIM; 608958.0013
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 19239
Feature /change: c -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 138
Feature /codon: cat -> gat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 15
Feature /change: H -> D
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29009
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 415
Feature /codon: ctg -> ccg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 107
Feature /change: L -> P
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Pneumocystis carinii pneumonia;
Symptoms Diarrhea; Marked lymphopenia;
Age 5 months
Sex XY
Ethnic origin Caucasoid; France
ADA activity 1%
dAXP 188 nmol/ml
//
ID G20R(1),G20R(1); standard; MUTATION;
Accession A0010
Systematic name Allele 1 and 2: g.19254G>A, c.153G>A, p.G20R
Original code WG548
Description Allele 1 and 2; missense mutation in the exon 2
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8299233
RefAuthors Yang, D. R., Huie, M. L., Hirschhorn, R.
RefTitle Homozygosity for a missense mutation (G20R) associated
RefTitle with neonatal onset adenosine deaminase-deficient severe
RefTitle combined immunodeficiency (ADA-SCID)
RefLoc Clin. Immunol. Immunopathol. 70:171-175 (1994)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 19254
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 153
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 20
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 19254
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 153
Feature /codon: gga -> aga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 20
Feature /change: G -> R
mRNA level normal
Protein level absent
Diagnosis Severe combined immunodeficiency
Age 2 weeks
Sex XX
Deceased yes; at 2 months
//
ID G74C(1),G216R(4); standard; MUTATION;
Accession A0001
Systematic name Allele 1: g.28909G>T, c.315G>T, p.G74C
Systematic name Allele 2: g.32464G>A, c.741G>A, p.G216R
Original code CY
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 7
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28909
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 315
Feature /codon: ggc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 74
Feature /change: G -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
Diagnosis Delayed onset combined immunodeficiency
Age 2.9 y
Sex XY
Ethnic origin US
dAXP n.d.
//
ID G74D(1),G239S(1); standard; MUTATION;
Accession A0065
Systematic name Allele 1: g.28910G>A, c.221G>A, r.221g>a, p.Gly74Asp
Systematic name Allele 2: g.32609G>A, c.715G>A, r.715g>a, p.Gly239Ser
Original code F2
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 22-Feb-2005 (Rel. 1, Created)
Date 22-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11160213
RefAuthors Ariga, T., Oda, N., Sanstisteban, I., Arredondo-Vega, F.
RefAuthors X., Shioda, M., Ueno, H., Terada, K., Kobayashi, K.,
RefAuthors Hershfield, M. S., Sakiyama, Y.
RefTitle Molecular basis for paradoxical carriers of adenosine
RefTitle deaminase (ADA) deficiency that show extremely low levels
RefTitle of ADA activity in peripheral blood cells without
RefTitle immunodeficiency.
RefLoc J Immunol 166:1698-1702 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28910
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 316
Feature /codon: ggc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 74
Feature /change: G -> D
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32609
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 810
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 239
Feature /change: G -> S
Diagnosis Partial ADA deficiency
Sex XX
Ethnic origin Mongoloid; Japan
//
ID G74V(1),A329V(3); standard; MUTATION;
Accession A0048
Systematic name Allele 1: g.28910G>T, c.316G>T, p.G74V
Systematic name Allele 2: g.35110C>T, c.1081C>T, p.A329V
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 11
Date 02-Aug-2000 (Rel. 1, Created)
Date 02-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8614422
RefLoc Bollinger, M. E., Arredondo-Vega, F. X., Santisteban, I.,
RefLoc Schwarz, K., Hershfield, M. S., Lederman, H. M.
RefTitle Brief report: hepatic dysfunction as a complication of
RefTitle adenosine deaminase deficiency
RefLoc N. Engl. J. Med. 334:1367-1371 (1996)
DB CrossRef OMIM; 608958.0006
DB CrossRef OMIM; 608958.0025
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28910
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 316
Feature /codon: ggc -> gtc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 74
Feature /change: G -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
Diagnosis Severe combined immunodeficiency
Age 7 weeks
dAXP 709 nmol/ml
IgA 0.19
IgG 2.40
IgM 0.15
//
ID R76W(1),R76W(1); standard; MUTATION;
Accession A0012
Systematic name Allele 1 and 2: g.28915C>T, c.321C>T, p.R76W
Original code 6200
Description Allele 1 and 2; missense mutation in the exon 4
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
DB CrossRef Coriell Cell Repository; GM06200
DB CrossRef OMIM; 608958.0010
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28915
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 321
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 76
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28915
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 321
Feature /codon: cgg -> tgg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 76
Feature /change: R -> W
Diagnosis Partial ADA deficiency
ADA activity 33%
//
ID R76W(2),P274L(1); standard; MUTATION;
Accession A0013
Systematic name Allele 1: g.28915C>T, c.321C>T, p.R76W
Systematic name Allele 2: g.32891C>T, c.916C>T, p.P274L
Original code 5816
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 9
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
DB CrossRef Coriell Cell Repository; GM05816
DB CrossRef OMIM; 608958.0010
DB CrossRef OMIM; 608958.0012
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28915
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 321
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 76
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32891
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 916
Feature /codon: ccg -> ctg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 274
Feature /change: P -> L
Diagnosis Partial ADA deficiency
ADA activity 28%
//
ID R76W(3),L107P(5); standard; MUTATION;
Accession A0014
Systematic name Allele 1: g.28915C>T, c.321C>T, p.R76W
Systematic name Allele 2: g.29009T>C, c.415T>C, p.L107P
Original code 7103
Description Allele 1 and 2; missense mutation in the exon 4
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
RefNumber [2]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef Coriell Cell Repository; GM07103
DB CrossRef OMIM; 608958.0010
DB CrossRef OMIM; 608958.0013
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28915
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 321
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 76
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29009
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 415
Feature /codon: ctg -> ccg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 107
Feature /change: L -> P
Diagnosis Partial ADA deficiency
ADA activity 16%
//
ID A83D(1),Intron 5(1); standard; MUTATION;
Accession A0039
Systematic name Allele 1: g.28937C>A, c.343C>A, p.A83D
Systematic name Allele 2: g.IVS5+1G>A, c.EX5del, p.E121fsX131
Original code KG
Description Allele 1; missense mutation in the exon 4
Description Allele 2; point mutation at intron 5 leading to
Description frameshift deletion and premature termination
Date 28-Jul-2000 (Rel. 1, Created)
Date 28-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7599635
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Debre,
RefAuthors M., Fischer, A., Perignon, J. L., Hilman, B., ElDahr, J.,
RefAuthors Dreyfus, D. H., Gelfand, E. W., Howell, P. L., Hershfield,
RefAuthors M. S.
RefTitle Four new adenosine deaminase mutations, altering a
RefTitle zinc-binding histidine, two conserved alanines, and a 5'
RefTitle splice site
RefLoc Hum. Mutat. 5:243-250 (1995)
DB CrossRef OMIM; 608958.0026
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28937
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 343
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 83
Feature /change: A -> D
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29939
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 458..573
Feature /change: - aggggacctc accccagacg aggtggtggc cctagtgggc
Feature /change: cagggcctgc aggaggggga gcgagacttc ggggtcaagg
Feature /change: cccggtccat cctgtgctgc atgcgccacc agccca
Feature /note: deletion of exon 5
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 121..160
Feature /change: EGDLTPDEVV ALVGQGLQEG ERDFGVKARS ILCCMRHQPN
Feature /change: -> ELVPQGGGAV X
Diagnosis Severe combined immunodeficiency
Symptoms Pneumonia; Marked lymphopenia;
Age 7 months
Sex XY
ADA activity <1%
dAXP 825 nmol/ml
//
ID Y97C/L106V(1),Deletion(4); standard; MUTATION;
Accession A0057
Systematic name Allele 1: g.28979A>G, c.385A>G, p.Y97C
Systematic name Allele 1: g.29005C>G, c.411C>G, p.L106V
Systematic name Allele 2: g.2430_5678del
Description Allele 1; two missense mutations in the exon 4
Description Allele 2; 3.2 kb deletion spanning the promoter
Description and the first exon
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9361033
RefAuthors Jiang, C., Hong, R., Horowitz, S. D., Kong, X.,
RefAuthors Hirschhorn, R.
RefTitle An adenosine deaminase (ADA) allele contains two newly
RefTitle identified deleterious mutations (Y97C and L106V) that
RefTitle interact to abolish enzyme activity
RefLoc Hum. Mol. Genet. 6:2271-2278 (1997)
DB CrossRef OMIM; 608958.0008
DB CrossRef OMIM; 608958.0029
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28979
Feature /change: a -> g
Feature /genomic_region: exon; 4
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29005
Feature /change: c -> g
Feature /genomic_region: exon; 4
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 385
Feature /codon: tat -> tgt; 2
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 411
Feature /codon: ctg -> gtg; 1
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 97
Feature /change: Y -> C
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 106
Feature /change: L -> V
FeatureHeader allele; 2
Feature dna; 7
Feature /rnalink: 8
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 2430..5678
Feature /genomic_region: promoter and exon; 1
Feature /note: 26 bp segment 2430..2456 and 5679..5705
Feature /note: containing the junction point
Feature rna; 8
Feature /dnalink: 7
Feature /aalink: 9
Feature /name: no transcript
Feature aa; 9
Feature /rnalink: 8
Feature /name: no translation
Diagnosis Delayed onset combined immunodeficiency
Symptoms Pneumocystis pneumonia;
Age 7 months
Sex XX
ADA activity <1%
dAXP 687 nmol/ml
IgA 0.45
IgG 4.14
IgM 0.2
//
ID R101W(1),R211H(2); standard; MUTATION;
Accession A0019
Systematic name Allele 1: g.28990C>T, c.396C>T, p.R101W
Systematic name Allele 2: g.32450G>A, c.727G>A, p.R211H
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 7
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 3182793
RefAuthors Akeson, A. L., Wiginton, D. A., Dusing, M. R., States, J.
RefAuthors C., Hutton, J. J.
RefTitle Mutant human adenosine deaminase alleles and their
RefTitle expression by transfection into fibroblasts
RefLoc J. Biol. Chem. 263:16291-16296 (1988)
RefNumber [2]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef Coriell Cell Repository; GM02606
DB CrossRef OMIM; 608958.0002
DB CrossRef OMIM; 608958.0004
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28990
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 396
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 101
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32450
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 727
Feature /codon: cgt -> cat; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 211
Feature /change: R -> H
Diagnosis Severe combined immunodeficiency
//
ID R101L(1),S291L(2); standard; MUTATION;
Accession A0043
Systematic name Allele 1: g.28991G>T, c.397G>T, p.R101L
Systematic name Allele 2: g.34380C>T, c.967C>T, p.S291L
Original code CC
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 10
Date 01-Aug-2000 (Rel. 1, Created)
Date 01-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
DB CrossRef OMIM; 608958.0019
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28991
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 397
Feature /codon: cgg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 101
Feature /change: R -> L
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34380
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 967
Feature /codon: tcg -> ttg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 291
Feature /change: S -> L
Diagnosis Late onset combined immunodeficiency
Symptoms Eosinophilia
Age 5.6 yr
Sex XX
Ethnic origin Caucasoid
dAXP 204 nmol/ml
//
ID R101Q(1),A215T(2); standard; MUTATION;
Accession A0009
Systematic name Allele 1: g.28991G>A, c.397G>A, p.R101Q
Systematic name Allele 2: g.32461G>A, c.738G>A, p.A215T
Original code 2
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 7
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9108404
RefAuthors Ozsahin, H., Arredondo-Vega, F. X., Santisteban, I.,
RefAuthors Fuhrer, H., Tuchschmid, P., Jochum, W., Aguzzi, A.,
RefAuthors Lederman, H. M., Fleischman, A., Winkelstein, J. A.,
RefAuthors Seger, R. A., Hershfield, M. S.
RefTitle Adenosine deaminase deficiency in adults
RefLoc Blood 89:2849-2855 (1997)
DB CrossRef OMIM; 608958.0003
DB CrossRef OMIM; 608958.0015
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28991
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 397
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 101
Feature /change: R -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32461
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 738
Feature /codon: gcc -> acc; 1
Feature /note: 50% of A215T-derived clones lacked exon 7
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 215
Feature /change: A -> T
Diagnosis Adult onset combined immunodeficiency
Symptoms Recurrent otitis; Bronchitis; Pneumonia; Sepsis;
Symptoms Meningitis; Hepatitis;
Age 28
Sex XY
dAXP 508 nmol/ml
Total lymphoc 1420
IgA 246 mg/dL
IgG 708 mg/dL
IgM 65 mg/dL
CD3 82.9 %
CD4 64.7 %
CD8 17.4 %
//
ID R101Q(2),Intron 1(1); standard; MUTATION;
Accession A0011
Systematic name Allele 1: g.28991G>A, c.397G>A, p.R101Q
Systematic name Allele 2: g.IVS1+1G>C
Description Allele 1; missense mutation in the exon 4
Description Allele 2; point mutation at intron 1 leading to
Description unstable mRNA
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 6854019
RefAuthors Uberti, J., Peterson, W. D. Jr., Lightbody, J. J.,
RefAuthors Johnson, R. M.
RefTitle A phenotypically normal revertant of an adenosine
RefTitle deaminase-deficient lymphoblast cell line
RefLoc J. Immunol. 130:2866-2870 (1983)
RefNumber [2]
RefCrossRef PUBMED; 3839802
RefAuthors Bonthron, D. T., Markham, A. F., Ginsburg, D., Orkin,
RefAuthors S. H.
RefTitle Identification of a point mutation in the adenosine
RefTitle deaminase gene responsible for immunodeficiency
RefLoc J. Clin. Invest. 76:894-897 (1985)
RefNumber [3]
RefCrossRef PUBMED; 8023852
RefAuthors Hirschhorn, R., Yang, D. R., Israni, A., Huie, M. L.,
RefAuthors Ownby, D. R.
RefTitle Somatic mosaicism for a newly identified splice-site
RefTitle mutation in a patient with adenosine deaminase-deficient
RefTitle immunodeficiency and spontaneous clinical recovery
RefLoc Am. J. Hum. Genet. 55:59-68 (1994)
DB CrossRef Coriell Cell Repository; GM01715
DB CrossRef Coriell Cell Repository; GM02445
DB CrossRef OMIM; 608958.0003
DB CrossRef OMIM; 608958.0024
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28991
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 397
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 101
Feature /change: R -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /loc: IDRefSeq: D0001: 4064
Feature /change: g -> c
Feature /genomic_region: intron; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Somatic mosaicism
Symptoms Failure to thrive; Pneumonia;
Age 2.5 yr
Sex XY
Ethnic origin Negroid
ADA activity 1-6%
//
ID P104L(1),P104L(1); standard; MUTATION;
Accession A0035
Systematic name Allele 1 and 2: g.29000C>T, c.406C>T, p.P104L
Original code BMV
Description Allele 1 and 2; missense mutation in the exon 4
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7691348
RefAuthors Atasoy, U., Norby-Slycord, C. J., Markert, M. L.
RefTitle A missense mutation in exon 4 of the human adenosine
RefTitle deaminase gene causes severe combined immunodeficiency
RefLoc Hum. Mol. Genet. 2:1307-1308 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29000
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 406
Feature /codon: ccg -> ctg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 104
Feature /change: P -> L
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29000
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 406
Feature /codon: ccg -> ctg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 104
Feature /change: P -> L
Diagnosis Severe combined immunodeficiency
Sex XY
//
ID #H105X132(1a),R235Q(1a); standard; MUTATION;
Accession A0061
Systematic name Allele 1: g.29003delA, c.314delA, r.314dela, p.His105fsX28
Systematic name Allele 2: g.32598G>A, c.704G>A, r.704g>a, p.Arg235Gln
Original code P2 ref. 1; F1 ref. 2
Description Allele 1: a frame shift deletion mutation in the exon 3
Description leading to a premature stop codon
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 22-Feb-2005 (Rel. 1, Created)
Date 22-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11313286
RefAuthors Ariga, T., Oda, N., Yamaguchi, K., Kawamura, N., Kikuta,
RefAuthors H., Taniuchi, S., Kobayashi, Y., Terada, K., Ikeda, H.,
RefAuthors Hershfield, M. S., Kobayashi, K., Sakiyama, Y.
RefTitle T-cell lines from 2 patients with adenosine
RefTitle deaminase (ADA) deficiency showed the restoration of ADA
RefTitle activity resulted from the reversion of an inherited
RefTitle mutation.
RefLoc Blood 97:2896-2899 (2001)
RefNumber [2]
RefCrossRef PUBMED; 11160213
RefAuthors Ariga, T., Oda, N., Sanstisteban, I., Arredondo-Vega, F.
RefAuthors X., Shioda, M., Ueno, H., Terada, K., Kobayashi, K.,
RefAuthors Hershfield, M. S., Sakiyama, Y.
RefTitle Molecular basis for paradoxical carriers of adenosine
RefTitle deaminase (ADA) deficiency that show extremely low levels
RefTitle of ADA activity in peripheral blood cells without
RefTitle immunodeficiency.
RefLoc J Immunol 166:1698-1702 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 29003
Feature /change: -a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 409
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 105
Feature /change: H -> PCWPTPKWSQ SPGTRLKGTS PQTRWWPX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32598
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 799
Feature /codon: cgg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 235
Feature /change: R -> Q
Diagnosis Severe combined immunodeficiency
Age 0.9
Sex XX
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative ADAbase; A0062 mother
Relative ADAbase; A0063 brother
Metabolites deoxy AXP:153 nmol/ml; 14.2 %
WBC 0.7-1.7
IgA <0.06
IgG 1.62
IgM 0.135
//
ID #H105X132(1c),M310T(1c); standard; MUTATION;
Accession A0063
Systematic name Allele 1: g.29003delA, c.314delA, r.314dela, p.His105fsX28
Systematic name Allele 2: g.34437T>C, c.929T>C, r.929u>c, p.Met310Thr
Original code F1 ref. 2
Description Allele 1: a frame shift deletion mutation in the exon 3
Description leading to a premature stop codon
Description Allele 2: a point mutation in the exon 9 leading to an
Description amino acid change
Date 22-Feb-2005 (Rel. 1, Created)
Date 22-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11313286
RefAuthors Ariga, T., Oda, N., Yamaguchi, K., Kawamura, N., Kikuta,
RefAuthors H., Taniuchi, S., Kobayashi, Y., Terada, K., Ikeda, H.,
RefAuthors Hershfield, M. S., Kobayashi, K., Sakiyama, Y.
RefTitle T-cell lines from 2 patients with adenosine
RefTitle deaminase (ADA) deficiency showed the restoration of ADA
RefTitle activity resulted from the reversion of an inherited
RefTitle mutation.
RefLoc Blood 97:2896-2899 (2001)
RefNumber [2]
RefCrossRef PUBMED; 11160213
RefAuthors Ariga, T., Oda, N., Sanstisteban, I., Arredondo-Vega, F.
RefAuthors X., Shioda, M., Ueno, H., Terada, K., Kobayashi, K.,
RefAuthors Hershfield, M. S., Sakiyama, Y.
RefTitle Molecular basis for paradoxical carriers of adenosine
RefTitle deaminase (ADA) deficiency that show extremely low levels
RefTitle of ADA activity in peripheral blood cells without
RefTitle immunodeficiency.
RefLoc J Immunol 166:1698-1702 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 29003
Feature /change: -a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 409
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 105
Feature /change: H -> PCWPTPKWSQ SPGTRLKGTS PQTRWWPX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34437
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1024
Feature /codon: atg -> acg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 310
Feature /change: M -> T
Diagnosis Partial ADA deficiency
Sex XY
Ethnic origin Mongoloid; Japan
Family history Inherited
Relative ADAbase; A0061 sister
Relative ADAbase; A0062 mother
Metabolites deoxy AXP:15 nmol/ml; 1.0 %
//
ID L107P(1),R211C(1); standard; MUTATION;
Accession A0015
Systematic name Allele 1: g.29009T>C, c.415T>C, p.L107P
Systematic name Allele 2: g.32449C>T, c.726C>T, p.R211C
Original code 4396
Description Allele 1; missense mutation in the exon 4
Description Allele 2; missense mutation in the exon 7
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
RefNumber [2]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef Coriell Cell Repository; GM04396
DB CrossRef OMIM; 608958.0013
DB CrossRef OMIM; 608958.0014
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29009
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 415
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 107
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32449
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 726
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 211
Feature /change: R -> C
Diagnosis Partial ADA deficiency
ADA activity 8%
//
ID L107P(2),?; standard; MUTATION;
Accession A0029
Systematic name Allele 1: g.29009T>C, c.415T>C, p.L107P
Description Allele 1; missense mutation in the exon 4
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef Coriell Cell Repository; GM03136
DB CrossRef OMIM; 608958.0013
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29009
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 415
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 107
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Severe combined immunodeficiency
Sex XX
Ethnic origin Caucasoid
//
ID L107P(3),?; standard; MUTATION;
Accession A0030
Systematic name Allele 1: g.29009T>C, c.415T>C, p.L107P
Original code Fa
Description Allele 1; missense mutation in the exon 4
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef OMIM; 608958.0013
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29009
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 415
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 107
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Severe combined immunodeficiency
//
ID Q119X(1),R235Q(2); standard; MUTATION;
Accession A0064
Systematic name Allele 1: g.29044C>T, c.355C>T, r.355c>u, p.Gln119X
Systematic name Allele 2: g.32598G>A, c.704G>A, r.704g>a, p.Arg235Gln
Original code P1
Description Allele 1: a point mutation in the exon 3 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 22-Feb-2005 (Rel. 1, Created)
Date 22-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11313286
RefAuthors Ariga, T., Oda, N., Yamaguchi, K., Kawamura, N., Kikuta,
RefAuthors H., Taniuchi, S., Kobayashi, Y., Terada, K., Ikeda, H.,
RefAuthors Hershfield, M. S., Kobayashi, K., Sakiyama, Y.
RefTitle T-cell lines from 2 patients with adenosine
RefTitle deaminase (ADA) deficiency showed the restoration of ADA
RefTitle activity resulted from the reversion of an inherited
RefTitle mutation.
RefLoc Blood 97:2896-2899 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29044
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 450
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 119
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32598
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 799
Feature /codon: cgg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 235
Feature /change: R -> Q
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive;
Symptoms Others:
Symptoms Respiratory distress
Age 1.1
Sex XX
Ethnic origin Mongoloid; Japan
Family history Inherited
Metabolites deoxy AXP:79 nmol/ml
//
ID #D123X132(1),#D123X132(1); standard; MUTATION;
Accession A0005
Systematic name Allele 1 and 2: g.29827delG, c.462delG, p.D123fsX132
Original code GC
Description Allele 1 and 2; frameshift deletion in the exon 5
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 29827
Feature /change: -g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 462
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 123
Feature /change: D -> TSPQTRWWPX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 29827
Feature /change: -g
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 462
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 123
Feature /change: D -> TSPQTRWWPX
Diagnosis Severe combined immunodeficiency
Age 2 mo
Sex XX
Ethnic origin Italy
dAXP n.d.
//
ID P126Q(1),G216R(5); standard; MUTATION;
Accession A0008
Systematic name Allele 1: g.29837C>A, c.472C>A, p.P126Q
Systematic name Allele 2: g.32464G>A, c.741G>A, p.G216R
Original code 1 (CKu)
Description Allele 1; missense mutation in the exon 5
Description Allele 2; missense mutation in the exon 7
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9108404
RefAuthors Ozsahin, H., Arredondo-Vega, F. X., Santisteban, I.,
RefAuthors Fuhrer, H., Tuchschmid, P., Jochum, W., Aguzzi, A.,
RefAuthors Lederman, H. M., Fleischman, A., Winkelstein, J. A.,
RefAuthors Seger, R. A., Hershfield, M. S.
RefTitle Adenosine deaminase deficiency in adults
RefLoc Blood 89:2849-2855 (1997)
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29837
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 472
Feature /codon: cca -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 126
Feature /change: P -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
Diagnosis Adult onset combined immunodeficiency
Symptoms Recurrent bacterial sinopulmonary infections; hyper-IgE;
Age 39
Sex XX
dAXP 28 nmol/ml
Total lymphoc 275
IgE 1780 IU/mL
CD4 69 %
CD8 22 %
CD19 7 %
//
ID V129M(1),V129M(1); standard; MUTATION;
Accession A0006
Systematic name Allele 1 and 2: g.29845G>A, c.480G>A, p.V129M
Original code AR
Description Allele 1 and 2; missense mutation in the exon 5
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29845
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 480
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 129
Feature /change: V -> M
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29845
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 480
Feature /codon: gtg -> atg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 129
Feature /change: V -> M
Diagnosis Severe combined immunodeficiency
Age 23 mo
Sex XX
Ethnic origin Italy
dAXP 169 nmol/ml; 18.3 %
//
ID V129M(2),?; standard; MUTATION;
Accession A0007
Systematic name Allele 1: g.29845G>A, c.480G>A, p.V129M
Original code GB
Description Allele 1; missense mutation in the exon 5
Description Allele 2; not identified
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29845
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 480
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 129
Feature /change: V -> M
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Delayed onset combined immunodeficiency
Age 16 mo
Sex XY
Ethnic origin Italy
dAXP n.d.
//
ID G140E(1),#E319X321(6); standard; MUTATION;
Accession A0003
Systematic name Allele 1: g.29879G>A, c.514G>A, p.G140E
Systematic name Allele 2: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Original code JS
Description Allele 1; missense mutation in the exon 5
Description Allele 2; frameshift deletion in the exon 10
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29879
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 514
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 140
Feature /change: G -> E
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
Diagnosis T and B cell-negative severe combined immunodeficiency
Diagnosis Severe combined immunodeficiency
Age 2 mo
Sex XX
Ethnic origin US
dAXP 543 nmol/ml; 66.4 %
//
ID R142X(1),R142X(1); standard; MUTATION;
Accession A0054
Systematic name Allele 1 and 2: g.29884C>T, c.519C>T, p.R142X
Original code SeGo
Description Allele 1 and 2; nonsense mutation in the exon 5
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8589684
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S.,
RefAuthors Loubser, M., Meydan, N., Roifman, C., Howell, P. L.,
RefAuthors Bowen, T., Weinberg, K. I., Schroeder, M. L., Herschfield,
RefAuthors M. S.
RefTitle Three new adenosine deaminase mutations that define a
RefTitle splicing enhancer and cause severe and partial phenotypes:
RefTitle implications for evolution of a CpG hotspot and expression
RefTitle of a transduced ADA cDNA
RefLoc Hum. Mol. Genet. 4:2081-2087 (1995)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29884
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 519
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 142
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29884
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 519
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 142
Feature /change: R -> X
Diagnosis Severe combined immunodeficiency
Sex XY
Ethnic origin Caucasoid; Canada
ADA activity <1%
dAXP 302 nmol/ml; 22.6 %
//
ID R142X(2),R142X(2); standard; MUTATION;
Accession A0055
Systematic name Allele 1 and 2: g.29884C>T, c.519C>T, p.R142X
Original code ZaDy
Description Allele 1 and 2; nonsense mutation in the exon 5
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8589684
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S.,
RefAuthors Loubser, M., Meydan, N., Roifman, C., Howell, P. L.,
RefAuthors Bowen, T., Weinberg, K. I., Schroeder, M. L., Herschfield,
RefAuthors M. S.
RefTitle Three new adenosine deaminase mutations that define a
RefTitle splicing enhancer and cause severe and partial phenotypes:
RefTitle implications for evolution of a CpG hotspot and expression
RefTitle of a transduced ADA cDNA
RefLoc Hum. Mol. Genet. 4:2081-2087 (1995)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29884
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 519
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 142
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29884
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 519
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 142
Feature /change: R -> X
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Interstitial pneumonia;
Age 3 months
Sex XY
Ethnic origin Caucasoid; Canada
//
ID R149Q(1),P297Q(2); standard; MUTATION;
Accession A0016
Systematic name Allele 1: g.29906G>A, c.541G>A, p.R149Q
Systematic name Allele 2: g.34398C>A, c.985C>A, p.P297Q
Original code 6143
Description Allele 1; missense mutation in the exon 5
Description Allele 2; missense mutation in the exon 10
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2783588
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A., Orkin, S. H.
RefTitle Identification of a point mutation resulting in a
RefTitle heat-labile adenosine deaminase (ADA) in two unrelated
RefTitle children with partial ADA deficiency
RefLoc J. Clin. Invest. 83:497-501 (1989)
RefNumber [2]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
DB CrossRef Coriell Cell Repository; GM06143
DB CrossRef OMIM; 608958.0009
DB CrossRef OMIM; 608958.0011
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29906
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 541
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 149
Feature /change: R -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34398
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 985
Feature /codon: ccg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 297
Feature /change: P -> Q
Diagnosis Partial ADA deficiency
ADA activity 70%
//
ID R149W(1),#E337-1(1); standard; MUTATION;
Accession A0002
Systematic name Allele 1: g.29905C>T, c.540C>T, p.R149W
Systematic name Allele 2: g.35133_35135delGAA, c.1104_1106delGAA, p.E337del
Original code CS
Description Allele 1; missense mutation in the exon 5
Description Allele 2; inframe deletion in the exon 11
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29905
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 540
Feature /codon: cgg -> tgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 149
Feature /change: R -> W
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 35133..35135
Feature /change: -gaa
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0001: 1104..1106
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P00813; ADA_HUMAN: 337
Feature /change: -E
Diagnosis Severe combined immunodeficiency
Age 12 mo
Sex XY
Ethnic origin US
dAXP 359 nmol/ml; 41.5 %
//
ID L152M(1),L152M(1); standard; MUTATION;
Accession A0058
Systematic name Allele 1 and 2: g.29914C>A, c.549C>A, p.L152M
Original code NYS
Description Allele 1 and 2; missense mutation in the exon 5
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9225964
RefLoc Hirschhorn, R., Borkowsky, W., Jiang, C. K., Yang, D. R.,
RefLoc Jenkins, T.
RefTitle Two newly identified mutations (Thr233Ile and Leu152Met)
RefTitle in partially adenosine deaminase-deficient (ADA-)
RefTitle individuals that result in differing biochemical and
RefTitle metabolic phenotypes
RefLoc Hum. Genet. 100:22-29 (1997)
DB CrossRef Coriell Cell Repository; GM08832
DB CrossRef OMIM; 608958.0027
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29914
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 549
Feature /codon: ctg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 152
Feature /change: L -> M
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29914
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 549
Feature /codon: ctg -> atg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 152
Feature /change: L -> M
Diagnosis Partial ADA deficiency
Age 2.5 yr
Sex XY
ADA activity 0
dAXP 39 nmol/ml
//
ID R156H(1),G216R(6); standard; MUTATION;
Accession A0044
Systematic name Allele 1: g.29927G>A, c.562G>A, p.R156H
Systematic name Allele 2: g.32464G>A, c.741G>A, p.G216R
Original code AA
Description Allele 1; missense mutation in the exon 5
Description Allele 2; missense mutation in the exon 7
Date 01-Aug-2000 (Rel. 1, Created)
Date 01-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29927
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 562
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
Diagnosis Late onset combined immunodeficiency
Symptoms Autoimmune thyroid insufficiency
Age 8 yr
Sex XX
Ethnic origin Caucasoid
dAXP 264 nmol/ml
//
ID R156C(1),L304R(1); standard; MUTATION;
Accession A0024
Systematic name Allele 1: g.29926C>T, c.561C>T, p.R156C
Systematic name Allele 2: g.34419T>G, c.1006T>G, p.L304R
Description Allele 1; missense mutation in the exon 5
Description Allele 2; missense mutation in the exon 10
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 3007108
RefAuthors Valerio, D., Dekker, B. M., Duyvesteyn, M. G., van der
RefAuthors Voorn, L., Berkvens, T. M., van Ormondt, H., van der Eb.
RefAuthors A. J.
RefTitle One adenosine deaminase allele in a patient with severe
RefTitle combined immunodeficiency contains a point mutation
RefTitle abolishing enzyme activity
RefLoc EMBO. J. 5:113-119 (1986)
RefNumber [2]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
RefNumber [3]
RefCrossRef PUBMED; 1284479
RefAuthors Hirschhorn, R.
RefTitle Identification of two new missense mutations (R156C and
RefTitle S291L) in two ADA- SCID patients unusual for response to
RefTitle therapy with partial exchange transfusions
RefLoc Hum. Mutat. 1:166-168 (1992)
DB CrossRef Coriell Cell Repository; GM02471
DB CrossRef OMIM; 608958.0018
DB CrossRef OMIM; 608958.0005
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 561
Feature /codon: cgc -> tgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34419
Feature /change: t -> g
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1006
Feature /codon: ctg -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 304
Feature /change: L -> R
Diagnosis Severe combined immunodeficiency
Comment -!-General: Patient has also a -> g mutation, leading to
Comment -!-General: amino acid substitution K80R, which is known
Comment -!-General: as a functional polymorphism
//
ID R156H(2),#E319X321(7); standard; MUTATION;
Accession A0046
Systematic name Allele 1: g.29927G>A, c.562G>A, p.R156H
Systematic name Allele 2: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Original code MJ
Description Allele 1; missense mutation in the exon 5
Description Allele 2; frameshift deletion in the exon 10
Date 02-Aug-2000 (Rel. 1, Created)
Date 02-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29927
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 562
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
Diagnosis Delayed onset combined immunodeficiency
Symptoms Failure to thrive; Chronic interstitial pneumonia;
Age 3
Sex XX
Ethnic origin Caucasoid
dAXP 218 nmol/ml
//
ID R156H(3),Intron 5(3); standard; MUTATION;
Accession A0056
Systematic name Allele 1: g.29927G>A, c.562G>A, p.R156H
Systematic name Allele 2: g.IVS5+1G>A, c.EX5del, p.E121fsX131
Description Allele 1; missense mutation in the exon 5
Description Allele 2; point mutation at intron 5 leading to
Description frameshift deletion and premature termination
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8673127
RefAuthors Hirschhorn, R., Yang, D. R., Puck, J. M., Huie, M. L.,
RefAuthors Jiang, C. K., Kurlandsky, L. E.
RefTitle Spontaneous in vivo reversion to normal of an inherited
RefTitle mutation in a patient with adenosine deaminase deficiency
RefLoc Nat. Genet. 13:290-295 (1996)
DB CrossRef OMIM; 608958.0026
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29927
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 562
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29939
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 458..573
Feature /change: -aggggacctc accccagacg aggtggtggc cctagtgggc
Feature /change: cagggcctgc aggaggggga gcgagacttc ggggtcaagg
Feature /change: cccggtccat cctgtgctgc atgcgccacc agccca
Feature /note: deletion of exon 5
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 121..160
Feature /change: EGDLTPDEVV ALVGQGLQEG ERDFGVKARS ILCCMRHQPN
Feature /change: -> ELVPQGGGAV X
Diagnosis Somatic mosaicism
ADA activity <1%
dAXP 22 nmol/ml
//
ID R156H(4),Intron 10(2); standard; MUTATION;
Accession A0045
Systematic name Allele 1: g.29927G>A, c.562G>A, p.R156H
Systematic name Allele 2: g.34484G>A, c.1070_1071insATGA, p.N326fsX334
Original code JH
Description Allele 1; missense mutation in the exon 5
Description Allele 2; point mutation at intron 10 leads to a new
Description splice donor site, 4 intornic bp insertion, frameshift
Description and premature termination
Date 02-Aug-2000 (Rel. 1, Created)
Date 02-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29927
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 562
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: insertion
Feature /loc: IDRefSeq: D0001: 34484
Feature /change: g -> a
Feature /genomic_region: intron; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 1071
Feature /change: +atga
Feature /note: insertion of 4 intronic bp
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 326
Feature /change: N -> MKHQCGQIX
Diagnosis Delayed onset combined immunodeficiency
Symptoms Pneumonia; Recurrent diarrhea
Age 1.2
Sex XX
Ethnic origin Caucasoid
dAXP 253 nmol/ml
//
ID R156H(5),#R235X310(1); standard; MUTATION;
Accession A0073
Systematic name Allele 1: g.27156G>A, c.467G>A, r.467g>a, p.Arg156His
Systematic name Allele 2: g.29831delG, c.704delG, r.704delg, p.Leu236fsX75
Description Allele 1: A point mutation in the exon 5 leading to an
Description amino acid change
Description Allele 2: A frame shift deletion mutation in the exon 8
Description leading to a premature stop codon
Date 29-Jun-2010 (Rel. 1, Created)
Date 29-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18952502
RefAuthors Liu, P., Santisteban, I., Burroughs, L. M., Ochs, H. D.,
RefAuthors Torgerson, T. R., Hershfield, M. S., Rawlings, D. J.,
RefAuthors Scharenberg, A. M.
RefTitle Immunologic reconstitution during PEG-ADA therapy in an
RefTitle unusual mosaic ADA deficient patient.
RefLoc Clin Immunol:162-174 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 27156
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 595
Feature /codon: cgc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 156
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 29831
Feature /change: -g
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 832
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 235
Feature /change: R ->
Feature /change: RWDTATTPWK TRPFITGCGR KTCTSRSAPG PATSLVPGSR
Feature /change: TRSMQSFGSK MTRLTTRSTQ MTRSSSSPPW TLITRX
Diagnosis ADA deficiency and combined immunodeficiency
Symptoms severe chronic lung disease, chronic sinus inflammation
Age 5.5
Sex XY
IgG 15
//
ID V177M(1),#K340X348(1); standard; MUTATION;
Accession A0042
Systematic name Allele 1: g.31226G>A, c.624G>A, p.V177M
Systematic name Allele 2: g.35143_35144delAG, c.1114_1115delAG, p.K340fsX348
Original code AnRo
Description Allele 1; missense mutation in the exon 6
Description Allele 2; frameshift deletion in the exon 11
Date 01-Aug-2000 (Rel. 1, Created)
Date 01-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 31226
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 624
Feature /codon: gtg -> atg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 177
Feature /change: V -> M
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 35143..35144
Feature /change: -ag
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1114..1115
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 340
Feature /change: K -> KGASRPALX
Diagnosis Late onset combined immunodeficiency
Age 6 yr
Sex XX
Ethnic origin Caucasoid
dAXP 139 nmol/ml
//
ID A179D(1),R211H(3); standard; MUTATION;
Accession A0038
Systematic name Allele 1: g.31233C>A, c.631C>A, p.A179D
Systematic name Allele 2: g.32450G>A, c.727G>A, p.R211H
Original code HT
Description Allele 1; missense mutation in the exon 6
Description Allele 2; missense mutation in the exon 7
Date 28-Jul-2000 (Rel. 1, Created)
Date 28-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 7599635
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Debre,
RefAuthors M., Fischer, A., Perignon, J. L., Hilman, B., ElDahr, J.,
RefAuthors Dreyfus, D. H., Gelfand, E. W., Howell, P. L., Hershfield,
RefAuthors M. S.
RefTitle Four new adenosine deaminase mutations, altering a
RefTitle zinc-binding histidine, two conserved alanines, and a 5'
RefTitle splice site
RefLoc Hum. Mutat. 5:243-250 (1995)
DB CrossRef OMIM; 608958.0004
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 31233
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 631
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 179
Feature /change: A -> D
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32450
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 727
Feature /codon: cgt -> cat; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 211
Feature /change: R -> H
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Pneumonia; Chronic diarrhea; Thrush;
Symptoms Dermatitis; Lymphopenia
Age 3 months
Sex XY
Ethnic origin Negroid; USA
ADA activity <1%
dAXP 354 nmol/ml
//
ID #I180X185(1),Intron 7(1); standard; MUTATION;
Accession A0060
Systematic name Allele 1: g.31236_31237delTT, c.634_635delTT, p.I180fsX185
Systematic name Allele 2: g.32497G>A, c.702_773delGAGGCTGTGAAGAGCGGCATTCACCGTACTGTCCACGCCGGGGAGGTGGGCTCGGCCGAAGTAGTAAAAGAG, p.E203_A227del
Description Allele 1; frameshift deletion in the exon 6 leading to
Description frameshift and premature termination
Description Allele 2; point mutation at intron 7 leading to
Description inframe deletion of 24 amino acids
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8501134
RefAuthors Kawamoto, H., Ito, K., Kashii, S., Monden, S., Fujita, M.,
RefAuthors Norioka, M., Sasai, Y., Okuma, M.
RefTitle A point mutation in the 5' splice region of intron 7
RefTitle causes a deletion of exon 7 in adenosine deaminase mRNA
RefLoc J. Cell. Biochem. 51:322-325 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 31236..31237
Feature /change: -tt
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 634..635
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 180
Feature /change: I -> RPGWRX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32497
Feature /change: g -> a
Feature /genomic_region: intron; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; inframe
Feature /loc: IDRefSeq: C0001: 702..773
Feature /change: -gaggctgtga agagcggcat tcaccgtact gtccacgccg
Feature /change: gggaggtggg ctcggccgaa gtagtaaaag ag
Feature /note: deletion of exon 7
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P00813; ADA_HUMAN: 203..226
Feature /change: -EAVKSGIHRT VHAGEVGSAE VVKE
Diagnosis Severe combined immunodeficiency
Sex XY
Ethnic origin Mongoloid; Japan
//
ID Q199P(1),G216R(7); standard; MUTATION;
Accession A0004
Systematic name Allele 1: g.31293A>C, c.691A>C, p.Q199P
Systematic name Allele 2: g.32464G>A, c.741G>A, p.G216R
Original code JH
Description Allele 1; missense mutation in the exon 6
Description Allele 2; missense mutation in the exon 7
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10200056
RefCrossRef Human Mutation, Mutation in Brief #142 (1997) Online
RefLoc Arredondo-Vega, F. X., Santisteban, I., Notarangelo, L.D.,
RefLoc El Dahr, J., Buckley, R., Roifman, C., Conley, M. E.,
RefLoc Hershfield, M. S.
RefTitle Seven novel mutations in the adenosine deaminase (ADA)
RefTitle gene in patients with severe and delayed onset combined
RefTitle immunodeficiency: G74C, V129M, G140E, R149W, Q199P,
RefTitle 462delG, and E337del
RefLoc Hum. Mut. 11:482 (1998)
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 31293
Feature /change: a -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 691
Feature /codon: cag -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 199
Feature /change: Q -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
Diagnosis Delayed onset combined immunodeficiency
Age 4 y
Sex XY
Ethnic origin Canada
dAXP 177 nmol/ml; 13.6 %
//
ID R211H(1),A329V(5); standard; MUTATION;
Accession A0021
Systematic name Allele 1: g.32450G>A, c.727G>A, p.R211H
Systematic name Allele 2: g.35110C>T, c.1081C>T, p.A329V
Description Allele 1; missense mutation in the exon 7
Description Allele 2; missense mutation in the exon 11
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 3475710
RefAuthors Akeson, A. L., Wiginton, D. A., States, J. C., Perme, C.
RefAuthors M., Dusing, M. R., Hutton, J. J.
RefTitle Mutations in the human adenosine deaminase gene that
RefTitle affect protein structure and RNA splicing
RefLoc Proc. Natl. Acad. Sci. USA 84:5947-5951 (1987)
RefNumber [2]
RefCrossRef PUBMED; 3182793
RefAuthors Akeson, A. L., Wiginton, D. A., Dusing, M. R., States, J.
RefAuthors C., Hutton, J. J.
RefTitle Mutant human adenosine deaminase alleles and their
RefTitle expression by transfection into fibroblasts
RefLoc J. Biol. Chem. 263:16291-16296 (1988)
RefNumber [3]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef Coriell Cell Repository; GM02756
DB CrossRef OMIM; 608958.0004
DB CrossRef OMIM; 608958.0006
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32450
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 727
Feature /codon: cgt -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 211
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
Diagnosis Severe combined immunodeficiency
//
ID A215T(1),A215T(1); standard; MUTATION;
Accession A0018
Systematic name Allele 1 and 2: g.32461G>A, c.738G>A, p.A215T
Original code 2294
Description Allele 1 and 2; missense mutation in the exon 7
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
DB CrossRef Coriell Cell Repository; GM02294
DB CrossRef OMIM; 608958.0015
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32461
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 738
Feature /codon: gcc -> acc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 215
Feature /change: A -> T
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32461
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 738
Feature /codon: gcc -> acc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 215
Feature /change: A -> T
Diagnosis Partial ADA deficiency
ADA activity 15%
//
ID G216R(1),G216R(1); standard; MUTATION;
Accession A0028
Systematic name Allele 1 and 2: g.32464G>A, c.741G>A, p.G216R
Original code PT
Description Allele 1 and 2; missense mutation in the exon 7
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1680289
RefAuthors Hirschhorn, R., Chakravarti, V., Puck, J., Douglas, S. D.
RefTitle Homozygosity for a newly identified missense mutation in a
RefTitle patient with very severe combined immunodeficiency due to
RefTitle adenosine deaminase deficiency (ADA-SCID)
RefLoc Am. J. Hum. Genet. 49:878-85 (1991)
DB CrossRef Coriell Cell Repository; GM11411
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
Diagnosis Severe combined immunodeficiency
Sex XY
Ethnic origin Caucasoid; USA
ADA activity <1%
dAXP 2248 nmol/ml
//
ID G216R(2),#E319X321(5); standard; MUTATION;
Accession A0031
Systematic name Allele 1: g.32464G>A, c.741G>A, p.G216R
Systematic name Allele 2: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Description Allele 1; missense mutation in the exon 7
Description Allele 2; frameshift deletion in the exon 10
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-207 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8401541
RefAuthors Hirschhorn, R., Chen, A. S., Israni, A., Yang, D. R.,
RefAuthors Huie, M. L.
RefTitle Two new mutations at the adenosine deaminase (ADA) locus
RefTitle (Q254X and del nt1050-54) unusual for not being missense
RefTitle mutations
RefLoc Hum. Mutat. 2:320-323 (1993)
DB CrossRef Coriell Cell Repository; GM01390
DB CrossRef OMIM; 608958.0016
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
Diagnosis Severe combined immunodeficiency
Sex XY
Ethnic origin Caucasoid
//
ID G216R(3),Intron 5(2); standard; MUTATION;
Accession A0047
Systematic name Allele 1: g.32464G>A, c.741G>A, p.G216R
Systematic name Allele 2: g.IVS5+6T>A, c.EX5del, p.E121fsX131
Original code AD
Description Allele 1; missense mutation in the exon 7
Description Allele 2; point mutation at intron 5 leading to
Description frameshift deletion and premature termination
Date 02-Aug-2000 (Rel. 1, Created)
Date 02-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
DB CrossRef OMIM; 608958.0016
DB CrossRef OMIM; 608958.0026
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32464
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 741
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 216
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 29944
Feature /change: t -> a
Feature /genomic_region: intron; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 458..573
Feature /change: -aggggacctc accccagacg aggtggtggc cctagtgggc
Feature /change: cagggcctgc aggaggggga gcgagacttc ggggtcaagg
Feature /change: cccggtccat cctgtgctgc atgcgccacc agccca
Feature /note: deletion of exon 5
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 121..160
Feature /change: EGDLTPDEVV ALVGQGLQEG ERDFGVKARS ILCCMRHQPN
Feature /change: -> ELVPQGGGAV X
Diagnosis Delayed onset combined immunodeficiency
Symptoms Failure to thrive; Pneumonia;
Age 2
Sex XX
Ethnic origin Caucasoid
//
ID E217K(1),Deletion(3); standard; MUTATION;
Accession A0049
Systematic name Allele 1: g.32467G>A, c.744G>A, p.E217K
Description Allele 1 and 2; missense mutation in the exon 7
Date 02-Aug-2000 (Rel. 1, Created)
Date 02-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1401934
RefAuthors Hirschhorn, R., Nicknam, M. N., Eng, F., Yang, D. R.,
RefAuthors Borkowsky, W.
RefTitle Novel deletion and a new missense mutation (Glu 217 Lys)
RefTitle at the catalytic site in two adenosine deaminase alleles
RefTitle of a patient with neonatal onset adenosine deaminase-
RefTitle severe combined immunodeficiency
RefLoc J. Immunol. 149:3107-3112 (1992)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32467
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 744
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 217
Feature /change: E -> K
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /genomic_region: promoter and exons 1-5
Feature /note: the first nt corresponding to HSADAG is bp 26620
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Pneumonia; Diarrhea; Florid oral
Symptoms candidiasis
Age 6 weeks
dAXP 1707 nmol/ml
//
ID T233I(1),T233I(1); standard; MUTATION;
Accession A0059
Systematic name Allele 1 and 2: g.32592C>T, c.793C>T, p.T233I
Original code Kung
Description Allele 1 and 2; missense mutation in the exon 8
Date 03-Aug-2000 (Rel. 1, Created)
Date 03-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9225964
RefLoc Hirschhorn, R., Borkowsky, W., Jiang, C. K., Yang, D. R.,
RefLoc Jenkins, T.
RefTitle Two newly identified mutations (Thr233Ile and Leu152Met)
RefTitle in partially adenosine deaminase-deficient (ADA-)
RefTitle individuals that result in differing biochemical and
RefTitle metabolic phenotypes
RefLoc Hum. Genet. 100:22-29 (1997)
DB CrossRef Coriell Cell Repository; GM03029
DB CrossRef OMIM; 608958.0028
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32592
Feature /change: c -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 793
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 233
Feature /change: T -> I
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32592
Feature /change: c -> t
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 793
Feature /codon: aca -> ata; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 233
Feature /change: T -> I
Diagnosis Partial ADA deficiency
Age 10 yr
Sex XY
Ethnic origin Negroid; South Africa
ADA activity 16-20%
//
ID R235Q(1b),M310T(1b); standard; MUTATION;
Accession A0062
Systematic name Allele 1: g.32598G>A, c.704G>A, r.704g>a, p.Arg235Gln
Systematic name Allele 2: g.34437T>C, c.929T>C, r.929u>c, p.Met310Thr
Original code F1 ref. 2
Description Allele 1: a point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 9 leading to an
Description amino acid change
Date 22-Feb-2005 (Rel. 1, Created)
Date 22-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11313286
RefAuthors Ariga, T., Oda, N., Yamaguchi, K., Kawamura, N., Kikuta,
RefAuthors H., Taniuchi, S., Kobayashi, Y., Terada, K., Ikeda, H.,
RefAuthors Hershfield, M. S., Kobayashi, K., Sakiyama, Y.
RefTitle T-cell lines from 2 patients with adenosine
RefTitle deaminase (ADA) deficiency showed the restoration of ADA
RefTitle activity resulted from the reversion of an inherited
RefTitle mutation.
RefLoc Blood 97:2896-2899 (2001)
RefNumber [2]
RefCrossRef PUBMED; 11160213
RefAuthors Ariga, T., Oda, N., Sanstisteban, I., Arredondo-Vega, F.
RefAuthors X., Shioda, M., Ueno, H., Terada, K., Kobayashi, K.,
RefAuthors Hershfield, M. S., Sakiyama, Y.
RefTitle Molecular basis for paradoxical carriers of adenosine
RefTitle deaminase (ADA) deficiency that show extremely low levels
RefTitle of ADA activity in peripheral blood cells without
RefTitle immunodeficiency.
RefLoc J Immunol 166:1698-1702 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32598
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 799
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 235
Feature /change: R -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34437
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1024
Feature /codon: atg -> acg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 310
Feature /change: M -> T
Diagnosis Partial ADA deficiency
Sex XX
Ethnic origin Mongoloid; Japan
Relative ADAbase; A0061 child
Relative ADAbase; A0063 child
Metabolites deoxy AXP:15 nmol/ml; 0.9 %
//
ID R253P(1),R253P(1); standard; MUTATION;
Accession A0040
Systematic name Allele 1 and 2: g.32652G>C, c.853G>C, p.R253P
Original code CJ
Description Allele 1 and 2; missense mutation in the exon 8
Date 01-Aug-2000 (Rel. 1, Created)
Date 01-Aug-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8258146
RefAuthors Hirschhorn, R., Yang, D. R., Insel, R. A., Ballow, M.
RefTitle Severe combined immunodeficiency of reduced severity due
RefTitle to homozygosity for an adenosine deaminase missense
RefTitle mutation (Arg253Pro)
RefLoc Cell. Immunol. 152:383-393 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32652
Feature /change: g -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 853
Feature /codon: cgg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 253
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32652
Feature /change: g -> c
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 853
Feature /codon: cgg -> ccg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 253
Feature /change: R -> P
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive;
Age 15 months
Sex XY
Ethnic origin Caucasoid; USA
ADA activity 1-2%
dAXP 174 nmol/ml
IgA 0.7
IgE 57
IgG 6.35
IgM 0.87
Comment -!-Symptoms: Reduced severity SCID
//
ID Q254X(1),A329V(4); standard; MUTATION;
Accession A0027
Systematic name Allele 1: g.32654C>T, c.855C>T, p.Q254X
Systematic name Allele 2: g.35110C>T, c.1081C>T, p.A329V
Original code Te
Description Allele 1; nonsense mutation in the exon 8
Description Allele 2; missense mutation in the exon 11
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-207 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8401541
RefAuthors Hirschhorn, R., Chen, A. S., Israni, A., Yang, D. R.,
RefAuthors Huie, M. L.
RefTitle Two new mutations at the adenosine deaminase (ADA) locus
RefTitle (Q254X and del nt1050-54) unusual for not being missense
RefTitle mutations
RefLoc Hum. Mutat. 2:320-323 (1993)
DB CrossRef OMIM; 608958.0006
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32654
Feature /change: c -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0001: 855
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 254
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
Diagnosis Severe combined immunodeficiency
//
ID R282Q(1),R282Q(1); standard; MUTATION;
Accession A0074
Systematic name Allele 1 and 2: g.30148G>A, c.845G>A, r.845g>a, p.Arg282Gln
Description Allele 1 and 2: A point mutation in the exon 9 leading to
Description an amino acid change
Date 02-Aug-2010 (Rel. 1, Created)
Date 02-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19830125
RefAuthors Hellani, A., Almassri, N., Abu-Amero, K. K.
RefTitle A novel mutation in the ADA gene causing severe combined
RefTitle immunodeficiency in an arab patient: a case report.
RefLoc J Med Case Reports:6799 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 30148
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 973
Feature /codon: cgg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 282
Feature /change: R -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 30148
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 973
Feature /codon: cgg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 282
Feature /change: R -> Q
Diagnosis Severe combined immunodeficiency
Symptoms Infections:
Symptoms Failure to thrive; Skin rash; Protracted diarrhea;
Symptoms Others:
Symptoms Recurrent severe chest infections; Lymphopenia; Fever;
Age 14 mo
Sex XY
Ethnic origin Saudi arabia
Comment Parents and sister of patient are heterozygous for the same
Comment mutation¨.
//
ID S291L(1),A329V(6); standard; MUTATION;
Accession A0025
Systematic name Allele 1: g.34380C>T, c.967C>T, p.S291L
Systematic name Allele 2: g.35110C>T, c.1081C>T, p.A329V
Description Allele 1; missense mutation in the exon 10
Description Allele 2; missense mutation in the exon 11
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
RefNumber [2]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
RefNumber [3]
RefCrossRef PUBMED; 1284479
RefAuthors Hirschhorn, R.
RefTitle Identification of two new missense mutations (R156C and
RefTitle S291L) in two ADA- SCID patients unusual for response to
RefTitle therapy with partial exchange transfusions
RefLoc Hum. Mutat. 1:166-168 (1992)
DB CrossRef Coriell Cell Repository; GM04258
DB CrossRef OMIM; 608958.0006
DB CrossRef OMIM; 608958.0019
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34380
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 967
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 291
Feature /change: S -> L
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
Diagnosis Severe combined immunodeficiency
//
ID P297Q(1),P297Q(1); standard; MUTATION;
Accession A0017
Systematic name Allele 1 and 2: g.34398C>A, c.985C>A, p.P297Q
Original code 6142
Description Allele 1 and 2; missense mutation in the exon 10
Date 20-Apr-2000 (Rel. 1, Created)
Date 20-Apr-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 2783588
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A., Orkin, S. H.
RefTitle Identification of a point mutation resulting in a
RefTitle heat-labile adenosine deaminase (ADA) in two unrelated
RefTitle children with partial ADA deficiency
RefLoc J. Clin. Invest. 83:497-501 (1989)
RefNumber [2]
RefCrossRef PUBMED; 2166947
RefAuthors Hirschhorn, R., Tzall, S., Ellenbogen, A.
RefTitle Hot spot mutations in adenosine deaminase deficiency
RefTitle deaminase-deficient lymphoblast cell line
RefLoc Proc. Natl. Acad. Sci. USA 87:6171-6175 (1990)
DB CrossRef Coriell Cell Repository; GM06142
DB CrossRef OMIM; 608958.0009
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34398
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 985
Feature /codon: ccg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 297
Feature /change: P -> Q
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 34398
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 985
Feature /codon: ccg -> cag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 297
Feature /change: P -> Q
Diagnosis Partial ADA deficiency
ADA activity 56%
//
ID #E319X321(1),#E319X321(1); standard; MUTATION;
Accession A0033
Systematic name Allele 1 and 2: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Original code Proband 2
Description Allele 1 and 2; frameshift deletion in the exon 10
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8401541
RefAuthors Hirschhorn, R., Chen, A. S., Israni, A., Yang, D. R.,
RefAuthors Huie, M. L.
RefTitle Two new mutations at the adenosine deaminase (ADA) locus
RefTitle (Q254X and del nt1050-54) unusual for not being missense
RefTitle mutations
RefLoc Hum. Mutat. 2:320-323 (1993)
DB CrossRef Coriell Cell Repository; WG290
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
Diagnosis Severe combined immunodeficiency
//
ID #E319X321(2),#E319X321(2); standard; MUTATION;
Accession A0036
Systematic name Allele 1 and 2: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Original code JH
Description Allele 1 and 2; frameshift deletion in the exon 10
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8242080
RefAuthors Gossage, D. L., Norby-Slycord, C. J., Hershfield, M. S.,
RefAuthors Markert, M. L.
RefTitle A homozygous 5 base-pair deletion in exon 10 of the
RefTitle adenosine deaminase (ADA) gene in a child with severe
RefTitle combined immunodeficiency and very low levels of ADA mRNA
RefTitle and protein
RefLoc Hum. Mol. Genet. 2:1493-4 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Pneumonia; Protracted diarrhea; Otitis;
Symptoms Diaper candidiasis
Age 3 months
Sex XY
Ethnic origin Caucasoid
//
ID #E319X321(3),?; standard; MUTATION;
Accession A0032
Systematic name Allele 1: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Description Allele 1; frameshift deletion in the exon 10
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-207 (1992)
DB CrossRef Coriell Cell Repository; GM02436
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Severe combined immunodeficiency
Sex XX
Ethnic origin Caucasoid
//
ID #E319X321(4),?; standard; MUTATION;
Accession A0034
Systematic name Allele 1: g.34463_34467delGAAGA, c.1050_1054delGAAGA, p.E319fsX321
Original code Proband 4
Description Allele 1; frameshift deletion in the exon 10
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8401541
RefAuthors Hirschhorn, R., Chen, A. S., Israni, A., Yang, D. R.,
RefAuthors Huie, M. L.
RefTitle Two new mutations at the adenosine deaminase (ADA) locus
RefTitle (Q254X and del nt1050-54) unusual for not being missense
RefTitle mutations
RefLoc Hum. Mutat. 2:320-323 (1993)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 34463..34467
Feature /change: -gaaga
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1050..1054
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 319..320
Feature /change: EE -> GVX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Severe combined immunodeficiency
//
ID A329V(1),A329V(1); standard; MUTATION;
Accession A0026
Systematic name Allele 1 and 2: g.35110C>T, c.1081C>T, p.A329V
Original code DM
Description Allele 1 and 2; missense mutation in the exon 11
Date 27-Jul-2000 (Rel. 1, Created)
Date 27-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1346349
RefAuthors Hirschhorn, R., Ellenbogen, A., Tzall, S.
RefTitle Five missense mutations at the adenosine deaminase locus
RefTitle (ADA) detected by altered restriction fragments and their
RefTitle frequency in ADA--patients with severe combined
RefTitle immunodeficiency (ADA-SCID)
RefLoc Am. J. Med. Genet. 42:201-7 (1992)
DB CrossRef OMIM; 608958.0006
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
Diagnosis Severe combined immunodeficiency
//
ID A329V(2),Intron 3(1); standard; MUTATION;
Accession A0020
Systematic name Allele 1: g.35110C>T, c.1081C>T, p.A329V
Systematic name Allele 2: g.IVS3-2A>G, c.EX4del, p.G74_E121del
Description Allele 1; missense mutation in the exon 11
Description Allele 2; point mutation at intron 3 leading to
Description inframe deletion of 48 amino acids
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 3475710
RefAuthors Akeson, A. L., Wiginton, D. A., States, J. C., Perme, C.
RefAuthors M., Dusing, M. R., Hutton, J. J.
RefTitle Mutations in the human adenosine deaminase gene that
RefTitle affect protein structure and RNA splicing
RefLoc Proc. Natl. Acad. Sci. USA 84:5947-5951 (1987)
RefNumber [2]
RefCrossRef PUBMED; 3182793
RefAuthors Akeson, A. L., Wiginton, D. A., Dusing, M. R., States, J.
RefAuthors C., Hutton, J. J.
RefTitle Mutant human adenosine deaminase alleles and their
RefTitle expression by transfection into fibroblasts
RefLoc J. Biol. Chem. 263:16291-16296 (1988)
DB CrossRef Coriell Cell Repository; GM02825A
DB CrossRef OMIM; 608958.0006
DB CrossRef OMIM; 608958.0017
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35110
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0001: 1081
Feature /codon: gcg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P00813; ADA_HUMAN: 329
Feature /change: A -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 28906
Feature /change: a -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: loss of exon sequence; inframe
Feature /loc: IDRefSeq: C0001: 314..457
Feature /change: - gggctgccgg gaggctatca aaaggatcgc ctatgagttt
Feature /change: gtagagatga aggccaaaga gggcgtggtg tatgtggagg
Feature /change: tgcggtacag tccgcacctg ctggccaact ccaaagtgga
Feature /change: gccaatcccc tggaaccagg ctga
Feature /note: deletion of exon 4
Feature /inexloc: -2
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P00813; ADA_HUMAN: 74..121
Feature /change: -GCREAIKRIA YEFVEMKAKE GVVYVEVRYS PHLLANSKVE
Feature /change: PIPWNQAE
Diagnosis Severe combined immunodeficiency
//
ID Intron 2(1a),Intron 8(1a); standard; MUTATION;
Accession A0050
Systematic name Allele 1: g.16510G>A, c.95+1G>A, r.190_191insATAA, p.R32fsX31
Systematic name Allele 2: g.30081_30084delinsTGGAAGAGCAGATCTGG,
Systematic name c.781-3_781delinsTGGAAGAGCAGATCTGG,
Systematic name r.781_845del, p.Ile261fsX4
Original code EG
Description Allele 1; point mutation at intron 2 creates a new
Description splice acceptor site, 4 intornic bp insertion, frameshift
Description and premature termination
Description Allele 2; complex mutation at intron 8 and leading to
Description deletion of exon 9, frameshift and premature termination
Date 21-Jul-2000 (Rel. 1, Created)
Date 14-Mar-2012 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 8178821
RefAuthors Arredondo-Vega, F. X., Santisteban, I., Kelly, S.,
RefAuthors Schlossman, C. M., Umetsu, D. T., Hershfield, M. S.
RefTitle Correct splicing despite mutation of the invariant first
RefTitle nucleotide of a 5' splice site: a possible basis for
RefTitle disparate clinical phenotypes in siblings with adenosine
RefTitle deaminase deficiency
RefLoc Am. J. Hum. Genet. 54:820-830 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8120281
RefAuthors Umetsu, D. T., Schlossman, C. M., Ochs, H. D., Hershfield,
RefAuthors M. S.
RefTitle Heterogeneity of phenotype in two siblings with adenosine
RefTitle deaminase deficiency
RefLoc J. Allergy Clin. Immunol. 93:543-550 (1994)
DB CrossRef OMIM; 608958.0022
DB CrossRef OMIM; 608958.0023
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 16510
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 191
Feature /change: +ataa
Feature /note: insertion of 4 intronic bp
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 32
Feature /change: R -> RX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: complex
Feature /loc: IDRefSeq: D0001: 30081..30084
Feature /change: caga -> tggaagagca gatctgg
Feature /genomic_region: intron; 8, exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 909..973
Feature /change: -atctgcccct ggtccagcta cctcactggt gcctggaagc
Feature /change: cggacacgga gcatgcagtc attcg
Feature /note: deletion of exon 9
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 261..282
Feature /change: ICPWSSYLTG AWKPDTEHAV IR -> AQKX
Diagnosis Severe combined immunodeficiency
Symptoms Failure to thrive; Psedomonas sepsis; Pneumocystis pneumonia;
Age 9 months
Sex XX
Relative ADA; A0051 sister
ADA activity 0.5-1%
dAXP 269 nmol/ml
//
ID Intron 2(1b),Intron 8(1b); standard; MUTATION;
Accession A0051
Systematic name Allele 1: g.16510G>A, c.95+1G>A, r.190_191insATAA, p.R32fsX31
Systematic name Allele 2: g.30081_30084delinsTGGAAGAGCAGATCTGG,
Systematic name c.781-3_781delinsTGGAAGAGCAGATCTGG,
Systematic name r.781_845del, p.Ile261fsX4
Original code RG
Description Allele 1; point mutation at intron 2 creates a new
Description splice acceptor site, 4 intornic bp insertion, frameshift
Description and premature termination
Description Allele 2; complex mutation at intron 8 and leading to
Description deletion of exon 9, frameshift and premature termination
Date 21-Jul-2000 (Rel. 1, Created)
Date 14-Mar-2012 (Rel. 1, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 8178821
RefAuthors Arredondo-Vega, F. X., Santisteban, I., Kelly, S.,
RefAuthors Schlossman, C. M., Umetsu, D. T., Hershfield, M. S.
RefTitle Correct splicing despite mutation of the invariant first
RefTitle nucleotide of a 5' splice site: a possible basis for
RefTitle disparate clinical phenotypes in siblings with adenosine
RefTitle deaminase deficiency
RefLoc Am. J. Hum. Genet. 54:820-830 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8120281
RefAuthors Umetsu, D. T., Schlossman, C. M., Ochs, H. D., Hershfield,
RefAuthors M. S.
RefTitle Heterogeneity of phenotype in two siblings with adenosine
RefTitle deaminase deficiency
RefLoc J. Allergy Clin. Immunol. 93:543-550 (1994)
DB CrossRef OMIM; 608958.0022
DB CrossRef OMIM; 608958.0023
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 16510
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: loss of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 191
Feature /change: +ataa
Feature /note: insertion of 4 intronic bp
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 32
Feature /change: R -> RX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: complex
Feature /loc: IDRefSeq: D0001: 30081..30084
Feature /change: caga -> tggaagagca gatctgg
Feature /genomic_region: intron; 8, exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001; GI:113339; ADAC: 909..973
Feature /change: -atctgcccct ggtccagcta cctcactggt gcctggaagc
Feature /change: cggacacgga gcatgcagtc attcg
Feature /note: deletion of exon 9
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P00813; ADA_HUMAN: 261..282
Feature /change: ICPWSSYLTG AWKPDTEHAV IR -> AQKX
Diagnosis Somatic mosaicism
Sex XX
Relative ADA; A0050 sister
ADA activity 0.5-1%
dAXP 175 nmol/ml
//
ID Intron 10(1),Intron 10(1); standard; MUTATION;
Accession A0041
Systematic name Allele 1 and 2: g.IVS10-34G>A
Original code AlNe
Description Allele 1 and 2; point mutation at intron 10 creates a new
Description splice acceptor site, 32 intornic bp insertion, frameshift
Description and a new stop codon at 3' region
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8227344
RefAuthors Santisteban, I., Arredondo-Vega, F. X., Kelly, S., Mary,
RefAuthors A., Fischer, A., Hummell, D. S., Lawton, A., Sorensen, R.
RefAuthors U., Stiehm, E. R., Uribe, L., Weinberg, K., Herschfield,
RefAuthors M. S.
RefTitle Novel splicing, missense, and deletion mutations in seven
RefTitle adenosine deaminase-deficient patients with late/delayed
RefTitle onset of combined immunodeficiency disease. Contribution
RefTitle of genotype to phenotype.
RefLoc J. Clin. Invest. 92:2291-2302 (1993)
DB CrossRef OMIM; 608958.0020
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35066
Feature /change: g -> a
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: gain of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 314..457
Feature /change: + ttccatgttg tctgccattc tggcctttcc ag
Feature /note: insertion of 32 bp
Feature /inexloc: -34
Feature aa; 3
Feature /rnalink: 2
Feature /name: out-of-frame extension
Feature /loc: UniProt: P00813; ADA_HUMAN: 326
Feature /change: N
Feature /change: -> FHVVCHSGLS RTSMRPNLVS SQKMKRGSFS TCSIKPMGCH
Feature /change: LQPLQGRTSE DATPPSLHPV ESPQLCGAEQ HFYIYSFQED
Feature /change: HDLNSQLLML LNPMCPFLHT RIPRHGRVTS LIMCPGRDQR
Feature /change: PCTWAWLNLK PSFCGNLYX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 35066
Feature /change: g -> a
Feature /genomic_region: intron; 10
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: gain of exon sequence; frameshift
Feature /loc: IDRefSeq: C0001: 314..457
Feature /change: + ttccatgttg tctgccattc tggcctttcc ag
Feature /note: insertion of 32 bp
Feature /inexloc: -34
Feature aa; 6
Feature /rnalink: 5
Feature /name: out-of-frame extension
Feature /loc: UniProt: P00813; ADA_HUMAN: 326
Feature /change: N
Feature /change: -> FHVVCHSGLS RTSMRPNLVS SQKMKRGSFS TCSIKPMGCH
Feature /change: LQPLQGRTSE DATPPSLHPV ESPQLCGAEQ HFYIYSFQED
Feature /change: HDLNSQLLML LNPMCPFLHT RIPRHGRVTS LIMCPGRDQR
Feature /change: PCTWAWLNLK PSFCGNLYX
Diagnosis Late onset combined immunodeficiency
Age 15 yr
Sex XY
Ethnic origin Caucasoid
dAXP 60 nmol/ml
//
ID Intron 11(1a),Intron 11(1a); standard; MUTATION;
Accession A0066
Systematic name Allele 1 and 2: g.IVS11-15T>A, c.1112-15T>A, r.1112-15u>a,
Original code Sib A
Description Allele 1 and 2: a point mutation in the intron 11 create Description new acceptor splice site leading to 10 bp insertion and Description frameshift
Date 23-Feb-2005 (Rel. 1, Created)
Date 23-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11807006
RefAuthors Arredondo-Vega, F. X., Santisteban, I., Richard, E., Bali,
RefAuthors P., Koleilat, M., Loubser, M., Al-Ghonaium, A., Al-Helali,
RefAuthors M., Hershfield, M. S.
RefTitle Adenosine deaminase deficiency with mosaicism for
RefTitle a 'second-site suppressor' of a splicing mutation: decline
RefTitle in revertant T lymphocytes during enzyme replacement
RefTitle therapy.
RefLoc Blood 99:1005-1013 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32874
Feature /change: t -> a
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1207
Feature /change: +aaccaacgag
Feature /inexloc: -15
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation
Feature /loc: UniProt: P00813; ADA_HUMAN: 360
Feature /change: G ->
Feature /change: EPTRAEPLKT PLLQAFTLWS HPNSVGLSNI FTFIPSKKTM
Feature /change: ISIVSYX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32874
Feature /change: t -> a
Feature /genomic_region: intron; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1207
Feature /change: +aaccaacgag
Feature /inexloc: -15
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation
Feature /loc: UniProt: P00813; ADA_HUMAN: 360
Feature /change: G ->
Feature /change: EPTRAEPLKT PLLQAFTLWS HPNSVGLSNI FTFIPSKKTM
Feature /change: ISIVSYX
Diagnosis Delayed onset combined immunodeficiency
Symptoms Others:
Symptoms Bacterial menigitis
Age 4
Ethnic origin Caucasoid; Saudi Arabia
Family history Inherited
Relative ADAbase; A0067 sibling
Metabolites deoxy AXP:140 nmol/ml; 9.6 %
WBC 6.16
Total lymphoc 1.06
IgA 1.4
IgE 3.82
IgG 13.7
IgM 1.05
CD3 45
CD4 8.5
CD8 97
CD19 3.5
PHA 23.7
//
ID Intron 11(1b),Intron 11(2b); standard; MUTATION;
Accession A0067
Systematic name Allele 1: g.IVS11-15T>A, c.1112-15T>A, r.1112-15u>a,
Systematic name Allele 2: g.IVS11-15TGAACCAACGAG>A,
Systematic name c.1112-15TGAACCAACGAG>A, r.1112-15ugaaccaacgag>a,
Original code Sib B
Description Allele 1: a point mutation in the intron 11 leading to an
Description amino acid change
Description Allele 2: a indel mutation in the intron 11 leading to an
Description amino acid change
Date 23-Feb-2005 (Rel. 1, Created)
Date 23-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11807006
RefAuthors Arredondo-Vega, F. X., Santisteban, I., Richard, E., Bali,
RefAuthors P., Koleilat, M., Loubser, M., Al-Ghonaium, A., Al-Helali,
RefAuthors M., Hershfield, M. S.
RefTitle Adenosine deaminase deficiency with mosaicism for
RefTitle a 'second-site suppressor' of a splicing mutation: decline
RefTitle in revertant T lymphocytes during enzyme replacement
RefTitle therapy.
RefLoc Blood 99:1005-1013 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0001: 32874
Feature /change: t -> a
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0001: 1207
Feature /change: +aaccaacgag
Feature /inexloc: -15
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation
Feature /loc: UniProt: P00813; ADA_HUMAN: 360
Feature /change: G ->
Feature /change: EPTRAEPLKT PLLQAFTLWS HPNSVGLSNI FTFIPSKKTM
Feature /change: ISIVSYX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: indel
Feature /loc: IDRefSeq: D0001: 32874..32885
Feature /change: tgaaccaacg ag -> a
Feature /genomic_region: intron; 11
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature /inexloc: -15
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Diagnosis Delayed onset combined immunodeficiency
Symptoms Others:
Symptoms Bacterial menigitis
Age 16
Ethnic origin Caucasoid; Saudi Arabia
Family history Inherited
Relative ADAbase; A0066; sibling
Metabolites deoxy AXP:56 nmol/ml; 5.8 %
WBC 6.82
Total lymphoc 1.57
IgA 1.5
IgE 0.35
IgG 11.2
IgM 1.13
CD3 84
CD4 11
CD8 160
CD19 10
PHA 80.9
//
ID Deletion(1),Deletion(1); standard; MUTATION;
Accession A0022
Original code R.P.
Description Allele 1 and 2; 3.2 kb deletion spanning the promoter
Description and the first exon
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 3366897
RefAuthors Markert, M. L., Hutton, J. J., Wiginton, D. A., States,
RefAuthors J. C., Kaufman, R. E.
RefTitle Adenosine deaminase (ADA) deficiency due to deletion of
RefTitle the ADA gene promoter and first exon by homologous
RefTitle recombination between two Alu elements
RefLoc J. Clin. Invest. 81:1323-7 (1988)
DB CrossRef OMIM; 608958.0006
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 2430..5678
Feature /genomic_region: promoter and exon; 1
Feature /note: 26 bp segment 2430..2456 and 5679..5705
Feature /note: containing the junction point
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: no transcript
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 2430..5678
Feature /genomic_region: promoter and exon; 1
Feature /note: 26 bp segment 2430..2456 and 5679..5705
Feature /note: containing the junction point
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no transcript
Feature aa; 6
Feature /rnalink: 5
Feature /name: no translation
Diagnosis Severe combined immunodeficiency
//
ID Deletion(2),Deletion(2); standard; MUTATION;
Accession A0023
Description Allele 1 and 2; 3.2 kb deletion spanning the promoter
Description and the first exon
Date 21-Jul-2000 (Rel. 1, Created)
Date 21-Jul-2000 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 1696926
RefAuthors Berkvens, T. M., van Ormondt, H., Gerritsen, E. J., Khan,
RefAuthors P. M., van der Eb, A. J.
RefTitle Identical 3250-bp deletion between two AluI repeats in the
RefTitle ADA genes of unrelated ADA-SCID patients
RefLoc Genomics 7:486-90 (1990)
DB CrossRef OMIM; 608958.0006
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 2430..5678
Feature /genomic_region: promoter and exon; 1
Feature /note: 26 bp segment 2430..2456 and 5679..5705
Feature /note: containing the junction point
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: no transcript
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0001: 2430..5678
Feature /genomic_region: promoter and exon; 1
Feature /note: 26 bp segment 2430..2456 and 5679..5705
Feature /note: containing the junction point
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no transcript
Feature aa; 6
Feature /rnalink: 5
Feature /name: no translation
Diagnosis Severe combined immunodeficiency
//
//
|
