Database CFHbase
Version 1.1
File cfhpub.txt
Date 06-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/cfhbase/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF101.html
Gene CFH
Disease Factor H deficiency
OMIM 134370
GDB 120041
Sequence IDRefSeq:D0040; IDRefSeq:C0040; UniProt:P08603
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments previously known as HF1base
Comments sequence entry reference in every entry
//
ID #R28X32(1),=; standard; MUTATION; SUSHI1
Accession H0024
Systematic name Allele 1: g.51431_51434delAGAA, c.155_158delAGAA,
Systematic name p.28fsX32
Original code Sporadic case
Description Allele 1: deletion in the exon 2 leading to a
Description premature stop codon in the SUSHI1 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9551389
RefAuthors Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y.,
RefAuthors Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle Genetic studies into inherited and sporadic hemolytic
RefTitle uremic syndrome.
RefLoc Kidney Int 53:836-844 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 51431..51434
Feature /change: -agaa
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 155..158
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 28..29
Feature /change: RN -> IQKFX
Feature /domain: SUSHI1
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Further information: The graft failed and patient had
Treatment nephrectomy three months later
Sex XY
Age 36
//
ID R78G(1),=; standard; MUTATION; SUSHI1
Accession H0042
Systematic name Allele 1: g.51581A>G, c.232A>G, r.232a>g, p.Arg78Gly
Original code S023#101
Description Allele 1: a point mutation in the exon 2 leading to
Description an amino acid change in the SUSHI1 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 51581
Feature /change: a -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 305
Feature /codon: agg -> ggg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 78
Feature /change: R -> G
Feature /domain: SUSHI1
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Original description of the mutation is R60G
//
ID #I124X136(1),=; standard; MUTATION; SUSHI2
Accession H0034
Systematic name Allele 1: g.54439_54463delTTAATTACCGTGAATGTGACACAGA,
Systematic name c.371_395delTTAATTACCGTGAATGTGACACAGA,
Systematic name r.371_395deluuaauuaccgugaaugugacacaga, p.Ile124fsX13
Original code Patient 9
Description Allele 1: a frame shift deletion mutation in the exon
Description 4 leading to a premature stop codon in the SUSHI2 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 54439..54463
Feature /change: -ttaattaccg tgaatgtgac acaga
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 444..468
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 124..132
Feature /change: INYRECDTD -> MDGPMIFLYV KLX
Feature /domain: SUSHI2
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Sex XX
Ethnic origin Caucasoid
Comment -!-Patient died despite weekly administration of FFP
//
ID R127L(1a),R127L(1a); standard; MUTATION; SUSHI2,SUSHI2
Accession H0028
Systematic name Allele 1 and 2: g.54448G>T, c.380G>T, r.380g>u, p.Arg127Leu
Original code Patient 3
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change in the SUSHI2 domain
Date 22-Dec-2004 (Rel. 1, Created)
Date 22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 54448
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 453
Feature /codon: cgt -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature /change: R -> L
Feature /domain: SUSHI2
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 54448
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 453
Feature /codon: cgt -> ctt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature /change: R -> L
Feature /domain: SUSHI2
Symptoms Hemolytic and renal abnormalities
Symptoms Membranoproliferative glomerulonephritis
Sex XY
Ethnic origin Caucasoid; Turkey
Relative CFHbase; H0029 brother
//
ID R127L(1b),R127L(1b); standard; MUTATION; SUSHI2,SUSHI2
Accession H0029
Systematic name Allele 1 and 2: g.54448G>T, c.380G>T, r.380g>u, p.Arg127Leu
Original code Patient 4
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change in the SUSHI2 domain
Date 22-Dec-2004 (Rel. 1, Created)
Date 22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 54448
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 453
Feature /codon: cgt -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature /change: R -> L
Feature /domain: SUSHI2
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 54448
Feature /change: g -> t
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 453
Feature /codon: cgt -> ctt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature /change: R -> L
Feature /domain: SUSHI2
Symptoms Hemolytic and renal abnormalities
Symptoms Membranoproliferative glomerulonephritis
Sex XY
Ethnic origin Caucasoid; Turkey
Relative CFHbase; H0028 brother
//
ID P139S(1),P139S(1); standard; MUTATION; SUSHI2,SUSHI2
Accession H0107
Systematic name Allele 1 and 2: g.54483C>T, c.415C>T, r.415c>u, p.Pro139Ser
Description Allele 1 and 2: A point mutation in the exon 4 leading to
Description an amino acid change in the SUSHI2 domain
Date 27-Apr-2011 (Rel. 1, Created)
Date 27-Apr-2011 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (27-Apr-2011) to CFHbase.
RefLoc Lone Schejbel; e-mail lone.schejbel@rh.regionh.dk
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 54483
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 488
Feature /codon: cct -> tct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 139
Feature /change: P -> S
Feature /domain: SUSHI2
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 54483
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 488
Feature /codon: cct -> tct; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 139
Feature /change: P -> S
Feature /domain: SUSHI2
Treatment
//
ID E189X(1a),E189X(1a); standard; MUTATION; SUSHI3,SUSHI3
Accession H0004
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code II-3
Description Allele 1 and 2: point mutation in the exon 5 leading to a
Description premature stop codon in the SUSHI3 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803850
RefAuthors Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M.,
RefAuthors Rodriguez de Cordoba, S.
RefTitle Molecular basis for factor H and FHL-1 deficiency in an
RefTitle italian family.
RefLoc Immunogenetics 51:366-369 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
Protein exp. Complete absence of factor H and FHL-1
Symptoms Other clinical features: systemic lupus erythematosus with
Symptoms chronic renal failure, highly reduced C3 serum levels and
Symptoms low concentrations of C5-C9, skin lesions with ulcerations
Symptoms and central nervous system involvement with psychosis
Sex XX
Ethnic origin Caucasoid; Italy
Parents Consanguineous
Relative CFHbase; H0005 brother
Relative CFHbase; H0006 brother
//
ID E189X(1b),E189X(1b); standard; MUTATION; SUSHI3,SUSHI3
Accession H0005
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code II-2
Description Allele 1 and 2: point mutation in the exon 5 leading to a
Description premature stop codon in the SUSHI3 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803850
RefAuthors Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M.,
RefAuthors Rodriguez de Cordoba, S.
RefTitle Molecular basis for factor H and FHL-1 deficiency in an
RefTitle italian family.
RefLoc Immunogenetics 51:366-369 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
Protein exp. Complete absence of factor H and FHL-1
Symptoms Other clinical features: highly reduced C3 serum levels
Symptoms and low concentrations of C5-C9, three episodes of
Symptoms meningococcal meningitis
Sex XY
Ethnic origin Caucasoid; Italy
Parents Consanguineous
Relative CFHbase; H0004 sister
Relative CFHbase; H0006 brother
//
ID E189X(1c),E189X(1c); standard; MUTATION; SUSHI3,SUSHI3
Accession H0006
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code II-4
Description Allele 1 and 2: point mutation in the exon 5 leading to a
Description premature stop codon in the SUSHI3 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803850
RefAuthors Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M.,
RefAuthors Rodriguez de Cordoba, S.
RefTitle Molecular basis for factor H and FHL-1 deficiency in an
RefTitle italian family.
RefLoc Immunogenetics 51:366-369 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 56043
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 638
Feature /codon: gaa -> taa; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature /change: E -> X
Feature /domain: SUSHI3
Protein exp. Complete absence of factor H and FHL-1
Symptoms Other clinical features: highly reduced C3 serum levels
Symptoms and low concentrations of C5-C9, one episode of
Symptoms meningococcal meningitis
Sex XY
Ethnic origin Caucasoid; Italy
Parents Consanguineous
Relative CFHbase; H0004 sister
Relative CFHbase; H0005 brother
//
ID Q408X(1a),Intron 3(1a); standard; MUTATION; SUSHI7,
Accession H0085
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code A-III.5
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 45
Sex XY
Family history Inherited
Relative CFHbase; H0086;father
Relative CFHbase; H0087;cousin
Relative CFHbase; H0088;cousin
Treatment
//
ID Q408X(1b),Intron 3(1b); standard; MUTATION; SUSHI7,
Accession H0086
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code A-II.3
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Sex XY
Family history Inherited
Relative CFHbase; H0085;son
Relative CFHbase; H0087;niece
Relative CFHbase; H0088;nephew
Treatment
//
ID Q408X(1c),Intron 3(1c); standard; MUTATION; SUSHI7,
Accession H0087
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code A-III.1
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 63
Sex XX
Family history Inherited
Relative CFHbase; H0085;cousin
Relative CFHbase; H0086;uncle
Relative CFHbase; H0088;brother
Treatment
//
ID Q408X(1d),Intron 3(1d); standard; MUTATION; SUSHI7,
Accession H0088
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code A-III.3
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 67
Sex XY
Family history Inherited
Relative CFHbase; H0085;cousin
Relative CFHbase; H0086;uncle
Relative CFHbase; H0087;sister
Treatment
//
ID Q408X(2a),Intron 3(2a); standard; MUTATION; SUSHI7,
Accession H0089
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code B-II.1
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 48
Sex XY
Family history Inherited
Relative CFHbase; H0090;mother
Relative CFHbase; H0091;son
Relative CFHbase; H0092;son
Treatment
//
ID Q408X(2b),Intron 3(2b); standard; MUTATION; SUSHI7,
Accession H0090
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code B-I.2
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 68
Sex XX
Family history Inherited
Relative CFHbase; H0089;son
Relative CFHbase; H0091;grandson
Relative CFHbase; H0092;grandson
Treatment
//
ID Q408X(2c),Intron 3(2c); standard; MUTATION; SUSHI7,
Accession H0091
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code B-III.1
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Sex XY
Family history Inherited
Relative CFHbase; H0089;father
Relative CFHbase; H0090;grandmother
Relative CFHbase; H0092;brother
Treatment
//
ID Q408X(2d),Intron 3(2d); standard; MUTATION; SUSHI7,
Accession H0092
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code B-III.2
Description Allele 1: A point mutation in the exon 9 leading to a
Description premature stop codon in the SUSHI7 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI7 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68555
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 1295
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature /change: Q -> X
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Sex XY
Family history Inherited
Relative CFHbase; H0089;father
Relative CFHbase; H0090;grandmother
Relative CFHbase; H0091;brother
Treatment
//
ID C431S(1),C431S(1); standard; MUTATION; SUSHI7,SUSHI7
Accession H0030
Systematic name Allele 1 and 2: g.68624T>A, c.1291T>A, r.1291u>a,
Systematic name p.Cys431Ser
Original code Patient 5
Description Allele 1 and 2: a point mutation in the exon 9 leading to
Description an amino acid change in the SUSHI7 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 68624
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 1364
Feature /codon: tgt -> agt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 431
Feature /change: C -> S
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 68624
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 1364
Feature /codon: tgt -> agt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 431
Feature /change: C -> S
Feature /domain: SUSHI7
Symptoms Hemolytic and renal abnormalities
Symptoms Membranoproliferative glomerulonephritis
Sex XY
Comment -!-Stable renal function 12 yr after diagnosis
//
ID C431Y(1),C431Y(1); standard; MUTATION; SUSHI7,SUSHI7
Accession H0072
Systematic name Allele 1 and 2: g.68625G>A, c.1292G>A, r.1292g>a,
Systematic name p.Cys431Tyr
Original code patient
Description Allele 1 and 2: A point mutation in the exon 9 leading to
Description an amino acid change in the SUSHI7 domain
Date 21-Apr-2008 (Rel. 1, Created)
Date 21-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18336910
RefAuthors Montes, T., Goicoechea de Jorge, E., Ramos, R., Goma, M.,
RefAuthors Pujol, O., Sanchez-Corral, P., Rodriguez de Cordoba, S.
RefTitle Genetic deficiency of complement factor H in a patient
RefTitle with age-related macular degeneration and
RefTitle membranoproliferative glomerulonephritis.
RefLoc Mol Immunol:2897-2904 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 68625
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 1365
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 431
Feature /change: C -> Y
Feature /domain: SUSHI7
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 68625
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 1365
Feature /codon: tgt -> tat; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 431
Feature /change: C -> Y
Feature /domain: SUSHI7
Age 56
Sex XY
Ethnic origin Spain
Family history Not known
Symptoms Hemolytic and renal abnormalities
Symptoms Chronic renal failure
Symptoms Membranoproliferative glomerulonephritis
Symptoms Infections: none
IgG 584 mg/dL
Treatment Renal transplantation: Yes
Treatment : Yes
//
ID #K474X479(1a),=; standard; MUTATION; SUSHI8
Accession H0011
Systematic name Allele 1: g.92248delA, c.1493delA, p.474fsX479
Original code F39#3
Description Allele 1: deletion in the exon 10 leading to a
Description premature stop codon in the SUSHI8 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 92248
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 1493
Feature /note: The deleted adenine may be any of the three
Feature /note: adenines of the codon (positions 1493-1495)
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 474
Feature /change: K -> NINANX
Feature /domain: SUSHI8
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Sex XX
Age 25
Ethnic origin Caucasoid; Italy
Relative CFHbase; H0012; brother
//
ID #K474X479(1b),=; standard; MUTATION; SUSHI8
Accession H0012
Systematic name Allele 1: g.92248delA, c.1493delA, p.474fsX479
Original code F40#3
Description Allele 1: deletion in the exon 10 leading to a
Description premature stop codon in the SUSHI8 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 92248
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 1493
Feature /note: The deleted adenine may be any of the three
Feature /note: adenines of the codon (positions 1493-1495)
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 474
Feature /change: K -> NINANX
Feature /domain: SUSHI8
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Sex XY
Age 22
Ethnic origin Caucasoid; Italy
Relative CFHbase; H0011; sister
//
ID N516K(1),=; standard; MUTATION; SUSHI9,
Accession H0101
Systematic name Allele 1: g.94051T>A, c.1548T>A, r.1548u>a,
Systematic name p.Asn516Lys
Original code P.1
Description Allele 1: A point mutation in the exon 11 leading to
Description an amino acid change in the SUSHI9 domain
Date 01-Jul-2010 (Rel. 1, Created)
Date 01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18557729
RefAuthors Le Quintrec, M., Lionet, A., Kamar, N., Karras, A.,
RefAuthors Barbier, S., Buchler, M., Fakhouri, F., Provost, F.,
RefAuthors Fridman, W. H., Thervet, E., Legendre, C., Zuber, J.,
RefAuthors Fremeaux-Bacchi, V.
RefTitle Complement mutation-associated de novo thrombotic
RefTitle microangiopathy following kidney transplantation.
RefLoc Am J Transplant:1694-1701 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 94051
Feature /change: t -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 1621
Feature /codon: aat -> aaa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 516
Feature /change: N -> K
Feature /domain: SUSHI9
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 47
Sex XX
Ethnic origin France
Symptoms Hemolytic and renal abnormalities
Symptoms Other clinical features: nephroangiosclerosis
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Other treatment: plasma exchange
Comment The patient carried mutation in CFI gene also.
Comment CFIbase; I0013
//
ID C536R(1),C959Y(1); standard; MUTATION; SUSHI9,SUSHI16
Accession H0001
Systematic name Allele 1: g.94109T>C, c.1679T>C, p.C536R
Systematic name Allele 2: g.119142G>A, c.2949G>A, p.C959Y
Original code 13-month-old boy
Description Allele 1: point mutation in the exon 11 leading to an
Description amino acid change in the SUSHI9 domain
Description Allele 2: point mutation in the exon 18 leading to an
Description amino acid change in the SUSHI16 domain
Date 15-Apr-2003 (Rel. 1, Created)
Date 15-Apr-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9312129
RefAuthors Ault, B. H., Schmidt, B. Z., Fowler, N. L., Kashtan, C.
RefAuthors E., Ahmed, A. E., Vogt, B. A., Colten, H. R.
RefTitle Human factor H deficiency. mutations in framework cysteine
RefTitle residues and block in H protein secretion and
RefTitle intracellular catabolism.
RefLoc J Biol Chem 272:25168-25175 (1997)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 94109
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 1679
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 536
Feature /change: C -> R
Feature /domain: SUSHI9
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 119142
Feature /change: g -> a
Feature /genomic_region: exon; 18
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2949
Feature /codon: tgt -> tat; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 959
Feature /change: C -> Y
Feature /domain: SUSHI16
Symptoms Hemolytic and renal abnormalities
Symptoms Membranoproliferative glomerulonephritis
Symptoms Other clinical features: hypocomplementic hypertensive
Symptoms renal disease
Treatment Renal transplantation: Yes: Date: 02/96
Sex XY
Ethnic origin Caucasoid; American
//
ID C630W(1),=; standard; MUTATION; SUSHI11
Accession H0055
Systematic name Allele 1: g.104916T>G, c.1890T>G, r.1890u>g,
Systematic name p.Cys630Trp
Original code Case 1
Description Allele 1: a point mutation in the exon 13 leading to
Description an amino acid change in the SUSHI11 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 104916
Feature /change: t -> g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 1963
Feature /codon: tgt -> tgg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 630
Feature /change: C -> W
Feature /domain: SUSHI11
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic. Father carrier.
//
ID C673S(1),C673S(1); standard; MUTATION; SUSHI11,SUSHI11
Accession H0031
Systematic name Allele 1 and 2: g.105044G>C, c.2018G>C, r.2018g>c,
Systematic name p.Cys673Ser
Original code Patient 6
Description Allele 1 and 2: a point mutation in the exon 13 leading to
Description an amino acid change in the SUSHI11 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 105044
Feature /change: g -> c
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2091
Feature /codon: tgt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature /change: C -> S
Feature /domain: SUSHI11
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 105044
Feature /change: g -> c
Feature /genomic_region: exon; 13
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2091
Feature /codon: tgt -> tct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature /change: C -> S
Feature /domain: SUSHI11
Symptoms Hemolytic and renal abnormalities
Symptoms Membranoproliferative glomerulonephritis
Sex XX
Ethnic origin Caucasoid
Comment -!-CRI 2 yr after diagnosis
//
ID C673Y(1),=; standard; MUTATION; SUSHI11
Accession H0037
Systematic name Allele 1: g.105044G>A, c.2018G>A, r.2018g>a,
Systematic name p.Cys673Tyr
Original code Patient 12
Description Allele 1: a point mutation in the exon 13 leading to
Description an amino acid change in the SUSHI11 domain
Date 27-Dec-2004 (Rel. 1, Created)
Date 27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 105044
Feature /change: g -> a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2091
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature /change: C -> Y
Feature /domain: SUSHI11
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Other clinical features: recurrence of haemolysis,
Symptoms progressive renal failure
Treatment Dialysis
Sex XX
Ethnic origin Caucasoid
//
ID S714X(1),=; standard; MUTATION; SUSHI12
Accession H0056
Systematic name Allele 1: g.105275C>G, c.2141C>G, r.2141c>g,
Systematic name p.Ser714X
Original code Case 2
Description Allele 1: a point mutation in the exon 14 leading to
Description a premature stop codon in the SUSHI12 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 105275
Feature /change: c -> g
Feature /genomic_region: exon; 14
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2214
Feature /codon: tca -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 714
Feature /change: S -> X
Feature /domain: SUSHI12
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic. Mother carrier.
//
ID @N767X774(1),=; standard; MUTATION; SUSHI13
Accession H0033
Systematic name Allele 1: g.106839_106840insA, c.2300_2301insA,
Systematic name r.2300_2301insa, p.Asn767fsX8
Original code Patient 8
Description Allele 1: a frame shift insertion mutation in the
Description exon 15 leading to a premature stop codon in the SUSHI13
Description domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0040: 106840
Feature /change: +a
Feature /genomic_region: exon; 15
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 2374
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 767
Feature /change: N -> KQEGIRSX
Feature /domain: SUSHI13
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive and well
Treatment Further information: no recurrence 4 yr after renal
Treatment transplantation
Sex XY
//
ID @N767X774(2); standard; MUTATION; SUSHI13
Accession H0083
Systematic name Allele 1: g.106840C>C, c.2301C>C, r.2301c>c, p.Asn767Asn
Systematic name Allele 2: g.106839_106840insA, c.2300_2301insA,
Systematic name r.2300_2301insa
Original code Patient 1
Description Allele 2: A frame shift insertion mutation in the exon 15
Description leading to a premature stop codon in the SUSHI13 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18371543
RefAuthors Boyer, O., Noel, L. H., Balzamo, E., Guest, G., Biebuyck,
RefAuthors N., Charbit, M., Salomon, R., Fremeaux-Bacchi, V.,
RefAuthors Niaudet, P.
RefTitle Complement factor H deficiency and posttransplantation
RefTitle glomerulonephritis with isolated C3 deposits.
RefLoc Am J Kidney Dis:671-677 (2008)
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: insertion
Feature /loc: EMBL: AL049744: 106840
Feature /change: +a
Feature /genomic_region: exon; 15
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: EMBL: Y00716; GI:116131; : 2374
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 767
Feature /change: N -> KQEGIRSX
Feature /domain: SUSHI13
Age 1,4
Sex XY
Ethnic origin Negroid; Africa
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Proteinuria
Treatment Renal transplantation: Yes
Treatment : Yes
Comment Patient has also CFI: c.548A>G (CFI:I0012) and MCP:
Comment c.796G>A mutations.
//
ID E850K(1),=; standard; MUTATION; SUSHI14
Accession H0057
Systematic name Allele 1: g.115388G>A, c.2548G>A, r.2548g>a,
Systematic name p.Glu850Lys
Original code Case 3
Description Allele 1: a point mutation in the exon 16 leading to
Description an amino acid change in the SUSHI14 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 115388
Feature /change: g -> a
Feature /genomic_region: exon; 16
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2621
Feature /codon: gaa -> aaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 850
Feature /change: E -> K
Feature /domain: SUSHI14
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID H893R(1),=; standard; MUTATION; SUSHI15
Accession H0036
Systematic name Allele 1: g.115986A>G, c.2678A>G, r.2678a>g,
Systematic name p.His893Arg
Original code Patient 11
Description Allele 1: a point mutation in the exon 17 leading to
Description an amino acid change in the SUSHI15 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 115986
Feature /change: a -> g
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2751
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 893
Feature /change: H -> R
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Thrombocytopenia
Symptoms Other clinical features: anemia
Treatment Dialysis
Treatment Further information: patient presented with chronic
Treatment hemolysis requiring weekly administration of RTP during
Treatment 4 mo.
Sex XX
Ethnic origin Caucasoid
Comment -!-No recurrence 5 yr after onset
//
ID H893R(2),=; standard; MUTATION; SUSHI15
Accession H0040
Systematic name Allele 1: g.115986A>G, c.2678A>G, r.2678a>g,
Systematic name p.His893Arg
Original code Patient 15
Description Allele 1: a point mutation in the exon 17 leading to
Description an amino acid change in the SUSHI15 domain
Date 27-Dec-2004 (Rel. 1, Created)
Date 27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 115986
Feature /change: a -> g
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2751
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 893
Feature /change: H -> R
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Chronic renal failure
Symptoms Other clinical features: hypertension
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Further information: 18 mo after the transplantation,
Treatment recurrence of progressive renal failure associated with
Treatment hemolytic anemia occurred, and he required again
Treatment hemodialysis. Graft biopsy revealed TMA lesions.
Sex XY
Ethnic origin Caucasoid
//
ID Y899X(1a),Y899X(1a); standard; MUTATION; SUSHI15,SUSHI15
Accession H0026
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code Patient 1
Description Allele 1 and 2: a point mutation in the exon 17 leading to
Description a premature stop codon in the SUSHI15 domain
Date 22-Dec-2004 (Rel. 1, Created)
Date 22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Treatment Other treatment: Patient has been receiving fresh frozen
Treatment plasma treatment every week since age 4. After 4 yr
Treatment follow-up, his renal function remained normal and no
Treatment relapse of hemolysis occurred.
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CFHbase; H0027 cousin
//
ID Y899X(1b),Y899X(1b); standard; MUTATION; SUSHI15,SUSHI15
Accession H0027
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code Patient 2
Description Allele 1 and 2: a point mutation in the exon 17 leading to
Description a premature stop codon in the SUSHI15 domain
Date 22-Dec-2004 (Rel. 1, Created)
Date 22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Treatment Renal transplantation: Yes
Treatment Outcome: Alive and well
Treatment Further information: Kidney transplantation was
Treatment performed at age 7. Twice-monthly plasma infusions were
Treatment performed during the 2yr after transplantation, and
Treatment graft function is currently normal.
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CFHbase; H0026 cousin
//
ID Y899X(2),Y899X(2); standard; MUTATION; SUSHI15,SUSHI15
Accession H0054
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code 8-month-old boy
Description Allele 1 and 2: a point mutation in the exon 17 leading to
Description a premature stop codon in the SUSHI15 domain
Date 21-Oct-2005 (Rel. 1, Created)
Date 21-Oct-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15685522
RefAuthors Licht, C., Weyersberg, A., Heinen, S., Stapenhorst, L.,
RefAuthors Devenge, J., Beck, B., Waldherr, R., Kirschfink, M.,
RefAuthors Zipfel, P. F., Hoppe, B.
RefTitle Successful plasma therapy for atypical hemolytic uremic
RefTitle syndrome caused by factor H deficiency owing to a novel
RefTitle mutation in the complement cofactor protein domain 15.
RefLoc Am J Kidney Dis 45:415-421 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2770
Feature /codon: tat -> taa; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
Protein exp. complete factor H deficiency
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XY
Ethnic origin Caucasoid
Parents Consanguineous
//
ID Y899X(3),Y899X(3); standard; MUTATION; SUSHI15,SUSHI15
Accession H0084
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code Patient 2
Description Allele 1 and 2: A point mutation in the exon 17 leading to
Description a premature stop codon in the SUSHI15 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18371543
RefAuthors Boyer, O., Noel, L. H., Balzamo, E., Guest, G., Biebuyck,
RefAuthors N., Charbit, M., Salomon, R., Fremeaux-Bacchi, V.,
RefAuthors Niaudet, P.
RefTitle Complement factor H deficiency and posttransplantation
RefTitle glomerulonephritis with isolated C3 deposits.
RefLoc Am J Kidney Dis:671-677 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 2770
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 116005
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: EMBL: Y00716; GI:116131; : 2770
Feature /codon: tat -> taa; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 899
Feature /change: Y -> X
Feature /domain: SUSHI15
Age 0
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Non-consanguineous
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
//
ID C915S(1),=; standard; MUTATION; SUSHI15
Accession H0035
Systematic name Allele 1: g.116051T>A, c.2743T>A, r.2743u>a,
Systematic name p.Cys915Ser
Original code Patient 10
Description Allele 1: a point mutation in the exon 17 leading to
Description an amino acid change in the SUSHI15 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116051
Feature /change: t -> a
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2816
Feature /codon: tgc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 915
Feature /change: C -> S
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Further information: Recurrence of HUS occurred 25 d
Treatment later, with hemolysis and lesions of thrombotic
Treatment microangiopathy (TMA) on the transplant biopsy, leading
Treatment to transplantectomy
Sex XX
Ethnic origin Caucasoid
//
ID Q925X(1),=; standard; MUTATION; SUSHI15
Accession H0032
Systematic name Allele 1: g.116081C>T, c.2773C>T, r.2773c>u,
Systematic name p.Gln925X
Original code Patient 7
Description Allele 1: a point mutation in the exon 17 leading to
Description a premature stop codon in the SUSHI15 domain
Date 23-Dec-2004 (Rel. 1, Created)
Date 23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 116081
Feature /change: c -> t
Feature /genomic_region: exon; 17
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 2846
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 925
Feature /change: Q -> X
Feature /domain: SUSHI15
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive and well
Treatment Further information: no recurrence of HUS has occurred
Treatment during the 10 yr follow-up after transplantation
Sex XY
Comment -!-Original description of the mutation is Q924X
//
ID Q950H(1),=; standard; MUTATION; SUSHI16
Accession H0043
Systematic name Allele 1: g.119116G>T, c.2850G>T, r.2850g>u,
Systematic name p.Gln950His
Original code S026#118
Description Allele 1: a point mutation in the exon 18 leading to
Description an amino acid change in the SUSHI16 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 119116
Feature /change: g -> t
Feature /genomic_region: exon; 18
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2923
Feature /codon: cag -> cat; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 950
Feature /change: Q -> H
Feature /domain: SUSHI16
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID Q950H(2),=; standard; MUTATION; SUSHI16,
Accession H0102
Systematic name Allele 1: g.119116G>T, c.2850G>T, r.2850g>u,
Systematic name p.Gln950His
Original code P.2
Description Allele 1: A point mutation in the exon 18 leading to
Description an amino acid change in the SUSHI16 domain
Date 01-Jul-2010 (Rel. 1, Created)
Date 01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18557729
RefAuthors Le Quintrec, M., Lionet, A., Kamar, N., Karras, A.,
RefAuthors Barbier, S., Buchler, M., Fakhouri, F., Provost, F.,
RefAuthors Fridman, W. H., Thervet, E., Legendre, C., Zuber, J.,
RefAuthors Fremeaux-Bacchi, V.
RefTitle Complement mutation-associated de novo thrombotic
RefTitle microangiopathy following kidney transplantation.
RefLoc Am J Transplant:1694-1701 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 119116
Feature /change: g -> t
Feature /genomic_region: exon; 18
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 2923
Feature /codon: cag -> cat; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 950
Feature /change: Q -> H
Feature /domain: SUSHI16
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 48
Sex XY
Ethnic origin France
Symptoms Hemolytic and renal abnormalities
Symptoms Other clinical features: crescent glomerulonephritis
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Other treatment: plasma exchange
//
ID Y951H(1),=; standard; MUTATION; SUSHI16
Accession H0044
Systematic name Allele 1: g.119117T>C, c.2851T>C, r.2851u>c,
Systematic name p.Tyr951His
Original code S025#087
Description Allele 1: a point mutation in the exon 18 leading to
Description an amino acid change in the SUSHI16 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 119117
Feature /change: t -> c
Feature /genomic_region: exon; 18
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2924
Feature /codon: tat -> cat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 951
Feature /change: Y -> H
Feature /domain: SUSHI16
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID T956M(1),=; standard; MUTATION; SUSHI16
Accession H0009
Systematic name Allele 1: g.119133C>T, c.2940C>T, p.T956M
Original code HUS12
Description Allele 1: point mutation in the exon 18 leading to
Description an amino acid change in the SUSHI16 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170895
RefAuthors Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E.,
RefAuthors Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S.,
RefAuthors Sanchez-Corral, P.
RefTitle Clustering of missense mutations in the C-terminal region
RefTitle of factor H in atypical hemolytic uremic syndrome.
RefLoc Am J Hum Genet 68:478-484 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 119133
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 18
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 2940
Feature /codon: acg -> atg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 956
Feature /change: T -> M
Feature /domain: SUSHI16
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Normal plasma levels of factor H
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid; Spain
Comment -!-mother carries the T956M mutation in heterozygosis
//
ID W978C(1),=; standard; MUTATION; SUSHI16
Accession H0058
Systematic name Allele 1: g.119200G>T, c.2934G>T, r.2934g>u,
Systematic name p.Trp978Cys
Original code Case 4
Description Allele 1: a point mutation in the exon 18 leading to
Description an amino acid change in the SUSHI16 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 119200
Feature /change: g -> t
Feature /genomic_region: exon; 18
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3007
Feature /codon: tgg -> tgt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 978
Feature /change: W -> C
Feature /domain: SUSHI16
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sibling HUS. Mother and grandmother carrier.
//
ID Y1021F(1),R1210C(5); standard; MUTATION; SUSHI17,SUSHI20
Accession H0069
Systematic name Allele 1: g.120410A>T, c.3062A>T, r.3062a>u, p.Tyr1021Phe
Systematic name Allele 2: g.125675C>T, c.3628C>T, r.3628c>u, p.Arg1210Cys
Original code Case 16
Description Allele 1: a point mutation in the exon 19 leading to an
Description amino acid change in the SUSHI17 domain
Description Allele 2: a point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 120410
Feature /change: a -> t
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3135
Feature /codon: tat -> ttt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1021
Feature /change: Y -> F
Feature /domain: SUSHI17
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic. Mother and father carriers.
//
ID C1043R(1),=; standard; MUTATION; SUSHI17
Accession H0059
Systematic name Allele 1: g.120475T>C, c.3127T>C, r.3127u>c,
Systematic name p.Cys1043Arg
Original code Case 5
Description Allele 1: a point mutation in the exon 19 leading to
Description an amino acid change in the SUSHI17 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 120475
Feature /change: t -> c
Feature /genomic_region: exon; 19
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3200
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1043
Feature /change: C -> R
Feature /domain: SUSHI17
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID Q1076E(1),#K1162X1168(1); standard; MUTATION;
ID SUSHI18,SUSHI19
Accession H0016
Systematic name Allele 1: g.121974C>G, c.3299C>G, p.Q1076E
Systematic name Allele 2: g.124422delA, c.3559delA, p.1162fsX1168
Original code Patient 1
Description Allele 1: point mutation in the exon 20 leading to an
Description amino acid change in the SUSHI18 domain
Description Allele 2: frameshift deletion in the exon 21 leading to a
Description premature stop codon in the SUSHI19 domain
Date 12-May-2003 (Rel. 1, Created)
Date 12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170896
RefAuthors Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S.,
RefAuthors Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J.
RefAuthors A., Goodship, T. H.
RefTitle Factor H mutations in hemolytic uremic syndrome cluster in
RefTitle exons 18-20, a domain important for host cell recognition.
RefLoc Am J Hum Genet 68:485-490 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 121974
Feature /change: c -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3299
Feature /codon: caa -> gaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1076
Feature /change: Q -> E
Feature /domain: SUSHI18
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 124422
Feature /change: -a
Feature /genomic_region: exon; 21
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0040: 3559
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1162
Feature /change: K -> NAYIRVX
Feature /domain: SUSHI19
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
//
ID Q1076E(2),=; standard; MUTATION; SUSHI18
Accession H0060
Systematic name Allele 1: g.121974C>G, c.3226C>G, r.3226c>g,
Systematic name p.Gln1076Glu
Original code Case 6
Description Allele 1: a point mutation in the exon 20 leading to
Description an amino acid change in the SUSHI18 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 121974
Feature /change: c -> g
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3299
Feature /codon: caa -> gaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1076
Feature /change: Q -> E
Feature /domain: SUSHI18
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic. Father carrier.
//
ID R1078S(1a),Intron 3(3a); standard; MUTATION; SUSHI18,
Accession H0093
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code C-II.2
Description Allele 1: A point mutation in the exon 20 leading to an
Description amino acid change in the SUSHI18 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI18 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 121982
Feature /change: g -> t
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3307
Feature /codon: agg -> agt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature /change: R -> S
Feature /domain: SUSHI18
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 57
Sex XY
Family history Inherited
Relative CFHbase; H0094;sister
Relative CFHbase; H0095;brother
Treatment
//
ID R1078S(1b),Intron 3(3b); standard; MUTATION; SUSHI18,
Accession H0094
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code C-II.3
Description Allele 1: A point mutation in the exon 20 leading to an
Description amino acid change in the SUSHI18 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI18 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 121982
Feature /change: g -> t
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3307
Feature /codon: agg -> agt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature /change: R -> S
Feature /domain: SUSHI18
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Sex XX
Family history Inherited
Relative CFHbase; H0093;brother
Relative CFHbase; H0095;brother
Treatment
//
ID R1078S(1c),Intron 3(3c); standard; MUTATION; SUSHI18,
Accession H0095
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code C-II.5
Description Allele 1: A point mutation in the exon 20 leading to an
Description amino acid change in the SUSHI18 domain
Description Allele 2: A point mutation in the intron 3 leading to an
Description amino acid change in the SUSHI18 domain
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 121982
Feature /change: g -> t
Feature /genomic_region: exon; 20
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3307
Feature /codon: agg -> agt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature /change: R -> S
Feature /domain: SUSHI18
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Sex XY
Family history Inherited
Relative CFHbase; H0093;brother
Relative CFHbase; H0094;sister
Treatment
//
ID D1119G(1),=; standard; MUTATION; SUSHI19
Accession H0017
Systematic name Allele 1: g.124292A>G, c.3429A>G, p.D1119G
Original code Patient 2
Description Allele 1: point mutation in the exon 21 leading to
Description an amino acid change in the SUSHI19 domain
Date 12-May-2003 (Rel. 1, Created)
Date 12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170896
RefAuthors Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S.,
RefAuthors Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J.
RefAuthors A., Goodship, T. H.
RefTitle Factor H mutations in hemolytic uremic syndrome cluster in
RefTitle exons 18-20, a domain important for host cell recognition.
RefLoc Am J Hum Genet 68:485-490 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124292
Feature /change: a -> g
Feature /genomic_region: exon; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3429
Feature /codon: gac -> ggc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1119
Feature /change: D -> G
Feature /domain: SUSHI19
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Normal FH levels, indicating a functional abnormality
Protein exp. in the secreted protein
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Comment -!-Affected sibling with normal C3 and FH levels
//
ID V1134G(1),=; standard; MUTATION; SUSHI19
Accession H0061
Systematic name Allele 1: g.124337T>G, c.3401T>G, r.3401u>g,
Systematic name p.Val1134Gly
Original code Case 7
Description Allele 1: a point mutation in the exon 21 leading to
Description an amino acid change in the SUSHI19 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124337
Feature /change: t -> g
Feature /genomic_region: exon; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3474
Feature /codon: gtt -> ggt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1134
Feature /change: V -> G
Feature /domain: SUSHI19
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic. Mother carrier.
//
ID Y1142D(1),=; standard; MUTATION; SUSHI19
Accession H0062
Systematic name Allele 1: g.124360T>G, c.3424T>G, r.3424u>g,
Systematic name p.Tyr1142Asp
Original code Case 8
Description Allele 1: a point mutation in the exon 21 leading to
Description an amino acid change in the SUSHI19 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124360
Feature /change: t -> g
Feature /genomic_region: exon; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3497
Feature /codon: tat -> gat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1142
Feature /change: Y -> D
Feature /domain: SUSHI19
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID W1157R(1),=; standard; MUTATION; SUSHI19
Accession H0063
Systematic name Allele 1: g.124405T>C, c.3469T>C, r.3469u>c,
Systematic name p.Trp1157Arg
Original code Case 9
Description Allele 1: a point mutation in the exon 21 leading to
Description an amino acid change in the SUSHI19 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124405
Feature /change: t -> c
Feature /genomic_region: exon; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3542
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1157
Feature /change: W -> R
Feature /domain: SUSHI19
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID C1163W(1),=; standard; MUTATION; SUSHI19
Accession H0045
Systematic name Allele 1: g.124425C>G, c.3489C>G, r.3489c>g,
Systematic name p.Cys1163Trp
Original code R087#134
Description Allele 1: a point mutation in the exon 21 leading to
Description an amino acid change in the SUSHI19 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124425
Feature /change: c -> g
Feature /genomic_region: exon; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3562
Feature /codon: tgc -> tgg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1163
Feature /change: C -> W
Feature /domain: SUSHI19
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID E1172X(1),=; standard; MUTATION; SUSHI20
Accession H0025
Systematic name Allele 1: g.125561G>T, c.3587G>T, p.E1172X
Original code R043
Description Allele 1: point mutation in the exon 22 leading to a
Description premature stop codon in the SUSHI20 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12697737
RefAuthors Manuelian, T., Hellwage, J., Meri, S., Caprioli, J.,
RefAuthors Noris, M., Heinen, S., Jozsi, M., Neumann, H. P., Remuzzi,
RefAuthors G., Zipfel, P. F.
RefTitle Mutations in factor H reduce binding affinity to C3b and
RefTitle heparin and surface attachment to endothelial cells in
RefTitle hemolytic uremic syndrome.
RefLoc J Clin Invest 111:1181-1190 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125561
Feature /change: g -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 3587
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature /change: E -> X
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Both normal and mutant protein, which lacks most of SCR20
Protein exp. and consequently has a lower molecular weight
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
//
ID E1172X(2),=; standard; MUTATION; SUSHI20
Accession H0046
Systematic name Allele 1: g.125561G>T, c.3514G>T, r.3514g>u,
Systematic name p.Glu1172X
Original code S027#022
Description Allele 1: a point mutation in the exon 22 leading to
Description a premature stop codon in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125561
Feature /change: g -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 3587
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature /change: E -> X
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID E1172X(3),=; standard; MUTATION; SUSHI20
Accession H0047
Systematic name Allele 1: g.125561G>T, c.3514G>T, r.3514g>u,
Systematic name p.Glu1172X
Original code R063#081
Description Allele 1: a point mutation in the exon 22 leading to
Description a premature stop codon in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125561
Feature /change: g -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0040: 3587
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature /change: E -> X
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID W1183L(1),=; standard; MUTATION; SUSHI20
Accession H0007
Systematic name Allele 1: g.125595G>T, c.3621G>T, p.W1183L
Original code HUS2
Description Allele 1: point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170895
RefAuthors Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E.,
RefAuthors Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S.,
RefAuthors Sanchez-Corral, P.
RefTitle Clustering of missense mutations in the C-terminal region
RefTitle of factor H in atypical hemolytic uremic syndrome.
RefLoc Am J Hum Genet 68:478-484 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125595
Feature /change: g -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3621
Feature /codon: tgg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature /change: W -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Normal plasma levels of factor H
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XY
Ethnic origin Caucasoid; Spain
Relative Description of pedigree:De novo
//
ID W1183L(2),=; standard; MUTATION; SUSHI20
Accession H0039
Systematic name Allele 1: g.125595G>T, c.3548G>T, r.3548g>u,
Systematic name p.Trp1183Leu
Original code Patient 14
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 27-Dec-2004 (Rel. 1, Created)
Date 27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125595
Feature /change: g -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3621
Feature /codon: tgg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature /change: W -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Treatment Dialysis
Sex XX
Ethnic origin Caucasoid
//
ID W1183R(1),=; standard; MUTATION; SUSHI20
Accession H0041
Systematic name Allele 1: g.125594T>A, c.3547T>A, r.3547u>a,
Systematic name p.Trp1183Arg
Original code 2-year-old boy, Ref[2]045
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12020532
RefAuthors Remuzzi, G., Ruggenenti, P., Codazzi, D., Noris, M.,
RefAuthors Caprioli, J., Locatelli, G., Gridelli, B.
RefTitle Combined kidney and liver transplantation for familial
RefTitle haemolytic uraemic syndrome.
RefLoc Lancet 359:1671-1672 (2002)
RefNumber [2]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125594
Feature /change: t -> a
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3620
Feature /codon: tgg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature /change: W -> R
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Other clinical features: chronic microangiopathic
Symptoms haemolysis
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Further information: a liver transplantation was done
Treatment simultaneously
Treatment Other treatment: a second liver transplantation was done
Treatment after patient developed a severe hepatic encephalopathy
Sex XY
Ethnic origin Caucasoid; Argentina
//
ID T1184R(1),=; standard; MUTATION; SUSHI20
Accession H0019
Systematic name Allele 1: g.125598C>G, c.3624C>G, p.T1184R
Original code Patient 4
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 12-May-2003 (Rel. 1, Created)
Date 12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170896
RefAuthors Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S.,
RefAuthors Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J.
RefAuthors A., Goodship, T. H.
RefTitle Factor H mutations in hemolytic uremic syndrome cluster in
RefTitle exons 18-20, a domain important for host cell recognition.
RefLoc Am J Hum Genet 68:485-490 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125598
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3624
Feature /codon: aca -> aga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1184
Feature /change: T -> R
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. FH levels normal, but C3 low
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Sex XY
Comment -!-His unaffected mother shows the same change at this
Comment position
//
ID K1186T(1),=; standard; MUTATION; SUSHI20,
Accession H0103
Systematic name Allele 1: g.125604A>C, c.3557A>C, r.3557a>c,
Systematic name p.Lys1186Thr
Original code P.3
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 01-Jul-2010 (Rel. 1, Created)
Date 01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18557729
RefAuthors Le Quintrec, M., Lionet, A., Kamar, N., Karras, A.,
RefAuthors Barbier, S., Buchler, M., Fakhouri, F., Provost, F.,
RefAuthors Fridman, W. H., Thervet, E., Legendre, C., Zuber, J.,
RefAuthors Fremeaux-Bacchi, V.
RefTitle Complement mutation-associated de novo thrombotic
RefTitle microangiopathy following kidney transplantation.
RefLoc Am J Transplant:1694-1701 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125604
Feature /change: a -> c
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3630
Feature /codon: aaa -> aca; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1186
Feature /change: K -> T
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 49
Sex XY
Ethnic origin France
Symptoms Hemolytic and renal abnormalities
Symptoms Other clinical features: crescent glomerulonephritis
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Other treatment: plasma exchange
Comment The patient carried mutation in CFI gene also.
Comment CFIbase; I0014
//
ID L1189F(1),=; standard; MUTATION; SUSHI20
Accession H0070
Systematic name Allele 1: g.125612C>T, c.3565C>T, r.3565c>u,
Systematic name p.Leu1189Phe
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 03-Jan-2006 (Rel. 1, Created)
Date 03-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15163532
RefAuthors Rodriguez de Cordoba, S., Esparza-Gordillo, J., Goicoechea
RefAuthors de Jorge, E., Lopez-Trascasa, M., Sanchez-Corral, P.
RefTitle The human complement factor H: functional roles, genetic
RefTitle variations and disease associations.
RefLoc Mol Immunol 41:355-367 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125612
Feature /change: c -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3638
Feature /codon: ctt -> ttt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1189
Feature /change: L -> F
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
//
ID L1189R(1),=; standard; MUTATION; SUSHI20
Accession H0008
Systematic name Allele 1: g.125613T>G, c.3639T>G, p.L1189R
Original code HUS11
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 08-May-2003 (Rel. 1, Created)
Date 08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170895
RefAuthors Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E.,
RefAuthors Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S.,
RefAuthors Sanchez-Corral, P.
RefTitle Clustering of missense mutations in the C-terminal region
RefTitle of factor H in atypical hemolytic uremic syndrome.
RefLoc Am J Hum Genet 68:478-484 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125613
Feature /change: t -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3639
Feature /codon: ctt -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1189
Feature /change: L -> R
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Normal plasma levels of factor H
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid; Spain
Comment -!-mother died as a consequence of postpartum aHUS
//
ID S1191L(1a),S1191L(1a); standard; MUTATION; SUSHI20,SUSHI20
Accession H0002
Systematic name Allele 1 and 2: g.125619C>T, c.3645C>T, p.S1191L
Original code VI-4
Description Allele 1 and 2: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 07-May-2003 (Rel. 1, Created)
Date 07-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10577907
RefAuthors Ying, L., Katz, Y., Schlesinger, M., Carmi, R., Shalev,
RefAuthors H., Haider, N., Beck, G., Sheffield, V. C., Landau, D.
RefTitle Complement factor H gene mutation associated with
RefTitle autosomal recessive atypical hemolytic uremic syndrome.
RefLoc Am J Hum Genet 65:1538-1546 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9811382
RefAuthors Ohali, M., Shalev, H., Schlesinger, M., Katz, Y., Kachko,
RefAuthors L., Carmi, R., Sofer, S., Landau, D.
RefTitle Hypocomplementemic autosomal recessive hemolytic uremic
RefTitle syndrome with decreased factor H.
RefLoc Pediatr Nephrol 12:619-624 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
Protein exp. low levels of serum CFH
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Other clinical features: hypertension, oliguria, edema
Sex XY
Age 2 weeks
Ethnic origin Caucasoid; Bedouin-Arab; Israel
Parents Consanguineous
Relative CFHbase; H0003
Comment -!-In the same large Bedouin kindred were totally 11 aHUS
Comment patients, but only two of them were genotyped
//
ID S1191L(1b),S1191L(1b); standard; MUTATION; SUSHI20,SUSHI20
Accession H0003
Systematic name Allele 1 and 2: g.125619C>T, c.3645C>T, p.S1191L
Original code VI-24
Description Allele 1 and 2: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 07-May-2003 (Rel. 1, Created)
Date 07-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10577907
RefAuthors Ying, L., Katz, Y., Schlesinger, M., Carmi, R., Shalev,
RefAuthors H., Haider, N., Beck, G., Sheffield, V. C., Landau, D.
RefTitle Complement factor H gene mutation associated with
RefTitle autosomal recessive atypical hemolytic uremic syndrome.
RefLoc Am J Hum Genet 65:1538-1546 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9811382
RefAuthors Ohali, M., Shalev, H., Schlesinger, M., Katz, Y., Kachko,
RefAuthors L., Carmi, R., Sofer, S., Landau, D.
RefTitle Hypocomplementemic autosomal recessive hemolytic uremic
RefTitle syndrome with decreased factor H.
RefLoc Pediatr Nephrol 12:619-624 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
Protein exp. low levels of serum CFH
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Other clinical features: hypertension, oliguria
Sex XX
Age 2 weeks
Ethnic origin Caucasoid; Bedouin-Arab; Israel
Parents Consanguineous
Relative CFHbase; H0002
Comment -!-In the same large Bedouin kindred were totally 11 aHUS
Comment patients, but only two of them were genotyped
//
ID S1191L(2a),V1197A(3a); standard; MUTATION; SUSHI20,SUSHI20
Accession H0075
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code I:2
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 16
Sex XX
Family history Inherited
Relative CFHbase; H0076twin-son
Relative CFHbase; H0077twin-son
Relative CFHbase; H0078granddaughter
Relative CFHbase; H0079grandson
Relative CFHbase; H0080grandson
Relative CFHbase; H0081grandson
Relative CFHbase; H0082great_grandson
Symptoms Infections: none
Treatment No renal transplantation
Treatment Outcome: Deceased
//
ID S1191L(2b),V1197A(3b); standard; MUTATION; SUSHI20,SUSHI20
Accession H0076
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code II:1
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 45
Sex XY
Family history Inherited
Relative CFHbase; H0075mother
Relative CFHbase; H0077twin-brother
Relative CFHbase; H0078niece
Relative CFHbase; H0079nephew
Relative CFHbase; H0080nephew
Relative CFHbase; H0081nephew
Relative CFHbase; H0082grand_nephew
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Symptoms Infections: none
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
Treatment Outcome: Deceased
//
ID S1191L(2c),V1197A(3c); standard; MUTATION; SUSHI20,SUSHI20
Accession H0077
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code II:1
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 46
Sex XY
Family history Inherited
Relative CFHbase; H0075mother
Relative CFHbase; H0076twin-brother
Relative CFHbase; H0078daughter
Relative CFHbase; H0079son
Relative CFHbase; H0080son
Relative CFHbase; H0081nephew
Relative CFHbase; H0082grandson
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Symptoms Infections: none
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
Treatment Outcome: Deceased
//
ID S1191L(2d),V1197A(3d); standard; MUTATION; SUSHI20,SUSHI20
Accession H0078
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code III:4
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 19
Sex XY
Family history Inherited
Relative CFHbase; H0075grandmother
Relative CFHbase; H0076uncle
Relative CFHbase; H0077father
Relative CFHbase; H0079brother
Relative CFHbase; H0080brother
Relative CFHbase; H0081cousin
Relative CFHbase; H0082nephew
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Infections: none
Treatment No renal transplantation
Treatment Outcome: Deceased
//
ID S1191L(2e),V1197A(3e); standard; MUTATION; SUSHI20,SUSHI20
Accession H0079
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code III:5
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 5
Sex XY
Family history Inherited
Relative CFHbase; H0075grandmother
Relative CFHbase; H0076uncle
Relative CFHbase; H0077father
Relative CFHbase; H0078daughter
Relative CFHbase; H0080brother
Relative CFHbase; H0081cousin
Relative CFHbase; H0082nephew
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Infections: none
Treatment No renal transplantation
Treatment Outcome: Deceased
//
ID S1191L(2f),V1197A(3f); standard; MUTATION; SUSHI20,SUSHI20
Accession H0080
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code III:6
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 28
Sex XY
Family history Inherited
Relative CFHbase; H0075grandmother
Relative CFHbase; H0076uncle
Relative CFHbase; H0077father
Relative CFHbase; H0078daughter
Relative CFHbase; H0079brother
Relative CFHbase; H0081cousin
Relative CFHbase; H0082nephew
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Infections: none
Treatment Dialysis
Treatment No renal transplantation
Treatment Outcome: Alive and well
//
ID S1191L(2g),V1197A(3h); standard; MUTATION; SUSHI20,SUSHI20
Accession H0081
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code III:8
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 7
Sex XY
Family history Inherited
Relative CFHbase; H0074grandmother
Relative CFHbase; H0075uncle
Relative CFHbase; H0076uncle
Relative CFHbase; H0077cousin
Relative CFHbase; H0078cousin
Relative CFHbase; H0079cousin
Relative CFHbase; H0080cousin
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Treatment : Yes
Treatment Outcome: Deceased
//
ID S1191L(2h),V1197A(3h); standard; MUTATION; SUSHI20,SUSHI20
Accession H0082
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code IV:1
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17076561
RefAuthors Venables, J. P., Strain, L., Routledge, D., Bourn, D.,
RefAuthors Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson,
RefAuthors A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S.,
RefAuthors Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle Atypical haemolytic uraemic syndrome associated with a
RefTitle hybrid complement gene.
RefLoc PLoS Med:e431 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3663
Feature /codon: gtt -> gct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
Age 7
Sex XY
Family history Inherited
Relative CFHbase; H0075great_grandmother
Relative CFHbase; H0076great_uncle
Relative CFHbase; H0077grandfather
Relative CFHbase; H0078aunt
Relative CFHbase; H0079uncle
Relative CFHbase; H0080uncle
Relative CFHbase; H0081uncle
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Chronic renal failure
Symptoms Infections: severe
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
Treatment Outcome: Deceased
//
ID S1191L(3a),=; standard; MUTATION; SUSHI20,
Accession H0098
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code Twin.1 Ref [3]
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 30-Jun-2010 (Rel. 1, Created)
Date 30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15696434
RefAuthors Olie, K. H., Goodship, T. H., Verlaak, R., Florquin, S.,
RefAuthors Groothoff, J. W., Strain, L., Weening, J. J., Davin, J. C.
RefTitle Posttransplantation cytomegalovirus-induced recurrence of
RefTitle atypical hemolytic uremic syndrome associated with a
RefTitle factor H mutation: successful treatment with intensive
RefTitle plasma exchanges and ganciclovir.
RefLoc Am J Kidney Dis:e12-15 (2005)
RefNumber [2]
RefCrossRef PUBMED; 16431247
RefAuthors Davin, J. C., Olie, K. H., Verlaak, R., Horuz, F.,
RefAuthors Florquin, S., Weening, J. J., Groothoff, J. W., Strain,
RefAuthors L., Goodship, T. H.
RefTitle Complement factor H-associated atypical hemolytic uremic
RefTitle syndrome in monozygotic twins: concordant presentation,
RefTitle discordant response to treatment.
RefLoc Am J Kidney Dis:e27-30 (2006)
RefNumber [3]
RefCrossRef PUBMED; 18483746
RefAuthors Davin, J. C., Strain, L., Goodship, T. H.
RefTitle Plasma therapy in atypical haemolytic uremic syndrome:
RefTitle lessons from a family with a factor H mutation.
RefLoc Pediatr Nephrol:1517-1521 (2008)
RefCrossRef PUBMED; 15696434
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 4
Sex XX
Relative CFHbase; H0099; twin
Relative CFHbase; H0100; sister
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Symptoms Other clinical features: hematomas, oliguria,
Symptoms increased plasma creatinine level
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Other treatment: plasma exchange and ganciclovir
//
ID S1191L(3b),=; standard; MUTATION; SUSHI20,
Accession H0099
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code Twin.2 Ref. [3]
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 30-Jun-2010 (Rel. 1, Created)
Date 30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15696434
RefAuthors Olie, K. H., Goodship, T. H., Verlaak, R., Florquin, S.,
RefAuthors Groothoff, J. W., Strain, L., Weening, J. J., Davin, J. C.
RefTitle Posttransplantation cytomegalovirus-induced recurrence of
RefTitle atypical hemolytic uremic syndrome associated with a
RefTitle factor H mutation: successful treatment with intensive
RefTitle plasma exchanges and ganciclovir.
RefLoc Am J Kidney Dis:e12-15 (2005)
RefNumber [2]
RefCrossRef PUBMED; 16431247
RefAuthors Davin, J. C., Olie, K. H., Verlaak, R., Horuz, F.,
RefAuthors Florquin, S., Weening, J. J., Groothoff, J. W., Strain,
RefAuthors L., Goodship, T. H.
RefTitle Complement factor H-associated atypical hemolytic uremic
RefTitle syndrome in monozygotic twins: concordant presentation,
RefTitle discordant response to treatment.
RefLoc Am J Kidney Dis:e27-30 (2006)
RefNumber [3]
RefCrossRef PUBMED; 18483746
RefAuthors Davin, J. C., Strain, L., Goodship, T. H.
RefTitle Plasma therapy in atypical haemolytic uremic syndrome:
RefTitle lessons from a family with a factor H mutation.
RefLoc Pediatr Nephrol:1517-1521 (2008)
RefCrossRef PUBMED; 15696434
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 4.5
Sex XX
Relative CFHbase; H0098; twin
Relative CFHbase; H0100; sister
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Other clinical features: hemolysis without renal failure,
Symptoms respiratory tract infection
Treatment plasma exchange, steroid and antihistamine therapy
//
ID S1191L(3c),=; standard; MUTATION; SUSHI20,
Accession H0100
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code Older sister Ref. [2]
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 30-Jun-2010 (Rel. 1, Created)
Date 30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15300478
RefAuthors Olie, K. H., Florquin, S., Groothoff, J. W., Verlaak, R.,
RefAuthors Strain, L., Goodship, T. H., Weening, J. J., Davin, J. C.
RefTitle Atypical relapse of hemolytic uremic syndrome after
RefTitle transplantation.
RefLoc Pediatr Nephrol:1173-1176 (2004)
RefNumber [2]
RefCrossRef PUBMED; 18483746
RefAuthors Davin, J. C., Strain, L., Goodship, T. H.
RefTitle Plasma therapy in atypical haemolytic uremic syndrome:
RefTitle lessons from a family with a factor H mutation.
RefLoc Pediatr Nephrol:1517-1521 (2008)
RefCrossRef PUBMED; 15696434
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 3
Sex XX
Relative CFHbase; H0098; sister
Relative CFHbase; H0099; sister
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Chronic renal failure
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Treatment Peritoneal Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive
Treatment Further information: transplantation was done
Treatment second time
Treatment after 6 years of the first one.
Treatment Other treatment: plasma exchange, azathioprine,
Treatment cyclosporine, prednisone
//
ID S1191L(4),=; standard; MUTATION; SUSHI20,
Accession H0104
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 01-Jul-2010 (Rel. 1, Created)
Date 01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19005013
RefAuthors Saland, J. M., Shneider, B. L., Bromberg, J. S., Shi, P.
RefAuthors A., Ward, S. C., Magid, M. S., Benchimol, C., Seikaly, M.
RefAuthors G., Emre, S. H., Bresin, E., Remuzzi, G.
RefTitle Successful split liver-kidney transplant for factor H
RefTitle associated hemolytic uremic syndrome.
RefLoc Clin J Am Soc Nephrol:201-206 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125619
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3645
Feature /codon: tcg -> ttg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature /change: S -> L
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 0.75
Sex XY
Parents Non-consanguineous
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Symptoms Other clinical features: hepatosplenomegaly
Treatment Renal transplantation: Yes
Treatment Outcome: Alive and well
Treatment Further information: The weight and height of the
Treatment patient is half of the normal for the age.
Treatment Other treatment: plasma exchange
//
ID S1191W(1),=; standard; MUTATION; SUSHI20
Accession H0071
Systematic name Allele 1: g.125619C>G, c.3572C>G, r.3572c>g,
Systematic name p.Ser1191Trp
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 03-Jan-2006 (Rel. 1, Created)
Date 03-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15163532
RefAuthors Rodriguez de Cordoba, S., Esparza-Gordillo, J., Goicoechea
RefAuthors de Jorge, E., Lopez-Trascasa, M., Sanchez-Corral, P.
RefTitle The human complement factor H: functional roles, genetic
RefTitle variations and disease associations.
RefLoc Mol Immunol 41:355-367 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125619
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3645
Feature /codon: tcg -> tgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature /change: S -> W
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
//
ID G1194D(1a),=; standard; MUTATION; SUSHI20
Accession H0048
Systematic name Allele 1: g.125628G>A, c.3581G>A, r.3581g>a,
Systematic name p.Gly1194Asp
Original code F169#130
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125628
Feature /change: g -> a
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3654
Feature /codon: ggt -> gat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1194
Feature /change: G -> D
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Relative CFHbase; H0049;
//
ID G1194D(1b),=; standard; MUTATION; SUSHI20
Accession H0049
Systematic name Allele 1: g.125628G>A, c.3581G>A, r.3581g>a,
Systematic name p.Gly1194Asp
Original code F170#130
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125628
Feature /change: g -> a
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3654
Feature /codon: ggt -> gat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1194
Feature /change: G -> D
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Relative CFHbase; H0048;
//
ID V1197A(1),=; standard; MUTATION; SUSHI20
Accession H0050
Systematic name Allele 1: g.125637T>C, c.3590T>C, r.3590u>c,
Systematic name p.Val1197Ala
Original code 052(Ref[2])
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
RefNumber [2]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3663
Feature /codon: gtt -> gct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID V1197A(2),=; standard; MUTATION; SUSHI20
Accession H0051
Systematic name Allele 1: g.125637T>C, c.3590T>C, r.3590u>c,
Systematic name p.Val1197Ala
Original code R062#056
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125637
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3663
Feature /codon: gtt -> gct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1197
Feature /change: V -> A
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID E1198A(1),=; standard; MUTATION; SUSHI20
Accession H0052
Systematic name Allele 1: g.125640A>C, c.3593A>C, r.3593a>c,
Systematic name p.Glu1198Ala
Original code R088#152
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125640
Feature /change: a -> c
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3666
Feature /codon: gaa -> gca; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1198
Feature /change: E -> A
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID F1199S(1),=; standard; MUTATION; SUSHI20
Accession H0038
Systematic name Allele 1: g.125643T>C, c.3596T>C, r.3596u>c,
Systematic name p.Phe1199Ser
Original code Patient 13
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 27-Dec-2004 (Rel. 1, Created)
Date 27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14978182
RefAuthors Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C.,
RefAuthors Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman
RefAuthors Fridman, W., Weiss, L.
RefTitle Heterozygous and homozygous factor h deficiencies
RefTitle associated with hemolytic uremic syndrome or
RefTitle membranoproliferative glomerulonephritis: report and
RefTitle genetic analysis of 16 cases.
RefLoc J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125643
Feature /change: t -> c
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3669
Feature /codon: ttt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1199
Feature /change: F -> S
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Atypical HUS, not associated with diarrhea
Sex XX
Ethnic origin Caucasoid
//
ID R1210C(1a),=; standard; MUTATION; SUSHI20
Accession H0013
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code F106#24
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Sex XY
Age 3
Ethnic origin Caucasoid; Italy
Parents Non-consanguineous
Relative CFHbase; H0014; brother
Comment -!-Unaffected father carries the same mutation
//
ID R1210C(1b),=; standard; MUTATION; SUSHI20
Accession H0014
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code F108#24
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Sex XY
Age 3,5
Ethnic origin Caucasoid; Italy
Parents Non-consanguineous
Relative CFHbase; H0013; brother
Comment -!-Unaffected father carries the same mutation
//
ID R1210C(2),=; standard; MUTATION; SUSHI20
Accession H0015
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code R16
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Serum factor H levels within the normal range
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Chronic renal failure
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Outcome: Alive and bad
Treatment Further information: Graft function deteriorated
Treatment acutely on day 7 posttransplantation, and allograft
Treatment biopsy showed recurrent HUS. A partial improvement was
Treatment achieved with plasma exchange, but this was not
Treatment sustained and the graft failed 3 mo later.
Sex XX
Age 31
Ethnic origin Caucasoid; Italy
Parents Non-consanguineous
Comment -!-The mutation was also found in the father and two of
Comment -!-five healthy siblings
//
ID R1210C(3),=; standard; MUTATION; SUSHI20
Accession H0053
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Original code S013#069
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 28-Dec-2004 (Rel. 1, Created)
Date 28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14583443
RefAuthors Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio,
RefAuthors P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S.,
RefAuthors Daina, E., Remuzzi, G., Noris, M.
RefTitle Complement factor H mutations and gene polymorphisms in
RefTitle haemolytic uraemic syndrome: the C-257T, the A2089G and
RefTitle the G2881T polymorphisms are strongly associated with the
RefTitle disease.
RefLoc Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
//
ID R1210C(4),=; standard; MUTATION; SUSHI20
Accession H0065
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Original code Case 12
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID R1210C(6),=; standard; MUTATION; SUSHI20,
Accession H0105
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 01-Jul-2010 (Rel. 1, Created)
Date 01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 19633317
RefAuthors Hirt-Minkowski, P., Schaub, S., Mayr, M., Schifferli, J.
RefAuthors A., Dickenmann, M., Fremeaux-Bacchi, V., Steiger, J.
RefTitle Haemolytic uraemic syndrome caused by factor H mutation:
RefTitle is single kidney transplantation under intensive
RefTitle plasmatherapy an option?
RefLoc Nephrol Dial Transplant:3548-3551 (2009)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 23
Sex XY
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Typical HUS, associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Symptoms Other clinical features: upper respiratory tract infection,
Symptoms fever, nausea, asthenia
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Other treatment: plasma exchange
//
ID R1210C(7),=; standard; MUTATION; SUSHI20,
Accession H0106
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Description Allele 1: A point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20534299
RefAuthors Albertazzi, V., Bonucchi, D., De Amicis, S., Americo, C.,
RefAuthors Ghiandai, G., Cappelli, G.
RefTitle A favorable 3-year outcome of kidney transplantation in
RefTitle atypical hemolytic uremic syndrome associated with a
RefTitle factor H mutation: case report.
RefLoc Transplant Proc:1352-1354 (2010)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125675
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3701
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1210
Feature /change: R -> C
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no mutation
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no mutation
Feature aa; 6
Feature /rnalink: 5
Feature /name: no mutation
Age 40
Sex XX
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Acute renal failure
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment Other treatment: plasmapheresis
//
ID R1215G(1),=; standard; MUTATION; SUSHI20
Accession H0018
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code Patient 3
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 12-May-2003 (Rel. 1, Created)
Date 12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11170896
RefAuthors Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S.,
RefAuthors Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J.
RefAuthors A., Goodship, T. H.
RefTitle Factor H mutations in hemolytic uremic syndrome cluster in
RefTitle exons 18-20, a domain important for host cell recognition.
RefLoc Am J Hum Genet 68:485-490 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125690
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3716
Feature /codon: cga -> gga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> G
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Protein exp. Normal C3 and FH levels
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Sex XX
Ethnic origin Caucasoid; United Kingdom
Comment -!-inherited from her father, who is unaffected
//
ID R1215G(2a),=; standard; MUTATION; SUSHI20
Accession H0020
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code Family 2a; III
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9551389
RefAuthors Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y.,
RefAuthors Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle Genetic studies into inherited and sporadic hemolytic
RefTitle uremic syndrome.
RefLoc Kidney Int 53:836-844 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125690
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3716
Feature /codon: cga -> gga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> G
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XY
Relative CFHbase; H0021; brother
Relative CFHbase; H0022; nephew
Comment -!-It is likely that this family (2a) and family 2b
Comment -!-(accession H0023) are related to each other
//
ID R1215G(2b),=; standard; MUTATION; SUSHI20
Accession H0021
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code Family 2a; III:16
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9551389
RefAuthors Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y.,
RefAuthors Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle Genetic studies into inherited and sporadic hemolytic
RefTitle uremic syndrome.
RefLoc Kidney Int 53:836-844 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125690
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3716
Feature /codon: cga -> gga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> G
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XY
Relative CFHbase; H0020; brother
Relative CFHbase; H0022; daughter
Comment -!-It is likely that this family (2a) and family 2b
Comment -!-(accession H0023) are related to each other
//
ID R1215G(2c),=; standard; MUTATION; SUSHI20
Accession H0022
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code Family 2a; IV:12
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9551389
RefAuthors Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y.,
RefAuthors Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle Genetic studies into inherited and sporadic hemolytic
RefTitle uremic syndrome.
RefLoc Kidney Int 53:836-844 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125690
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3716
Feature /codon: cga -> gga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> G
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XX
Relative CFHbase; H0020; uncle
Relative CFHbase; H0021; father
Comment -!-It is likely that this family (2a) and family 2b
Comment -!-(accession H0023) are related to each other
//
ID R1215G(3),=; standard; MUTATION; SUSHI20
Accession H0023
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code Family 2b; IV:2
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 13-May-2003 (Rel. 1, Created)
Date 13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9551389
RefAuthors Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y.,
RefAuthors Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle Genetic studies into inherited and sporadic hemolytic
RefTitle uremic syndrome.
RefLoc Kidney Int 53:836-844 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125690
Feature /change: c -> g
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3716
Feature /codon: cga -> gga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> G
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Sex XX
Comment -!-It is likely that this family 2b and family 2a
Comment -!-(accessions H0020, H0021 and H0022) are related to each
Comment -!-other
//
ID R1215Q(1),=; standard; MUTATION; SUSHI20
Accession H0010
Systematic name Allele 1: g.125691G>A, c.3717G>A, p.R1215Q
Original code F34#1
Description Allele 1: point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 09-May-2003 (Rel. 1, Created)
Date 09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11158219
RefAuthors Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B.,
RefAuthors Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi,
RefAuthors G., Noris, M.
RefTitle The molecular basis of familial hemolytic uremic syndrome:
RefTitle mutation analysis of factor H gene reveals a hot spot in
RefTitle short consensus repeat 20.
RefLoc J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125691
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3717
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature /change: R -> Q
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Symptoms Hemolytic anemia
Symptoms Thrombocytopenia
Symptoms Other clinical features: upper respiratory track infection
Sex XY
Age 1
Ethnic origin Caucasoid; Italy
//
ID R1215Q(2a),R1215R(1a); standard; MUTATION; SUSHI20,SUSHI20
Accession H0073
Systematic name Allele 1: g.125691G>A, c.3644G>A, r.3644g>a, p.Arg1215Gln
Systematic name Allele 2: g.125691G>G, c.3644G>G, r.3644g>g, p.Arg1215Arg
Original code patient 1
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17973958
RefAuthors Jalanko, H., Peltonen, S., Koskinen, A., Puntila, J.,
RefAuthors Isoniemi, H., Holmberg, C., Pinomaki, A., Armstrong, E.,
RefAuthors Koivusalo, A., Tukiainen, E., Makisalo, H., Saland, J.,
RefAuthors Remuzzi, G., de Cordoba, S., Lassila, R., Meri, S.,
RefAuthors Jokiranta, T. S.
RefTitle Successful liver-kidney transplantation in two children
RefTitle with aHUS caused by a mutation in complement factor H.
RefLoc Am J Transplant:216-221 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125691
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3717
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature /change: R -> Q
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125691
Feature /change: g -> g
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3717
Feature /codon: cga -> cga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature /change: R -> R
Feature /domain: SUSHI20
Protein level Increased
Activity Reduced
Age 1
Sex XY
Ethnic origin Caucasoid; Finland
Family history Inherited
Relative CFHbase; H0074aunt
Symptoms Hemolytic and renal abnormalities
Symptoms Acute renal failure
Symptoms Proteinuria
Symptoms Infections: mild
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
Treatment Outcome: Alive and well
Treatment Further information: Combined transplantation of kidney and
Treatment liver.
//
ID R1215Q(2b),R1215R(1b); standard; MUTATION; SUSHI20,SUSHI20
Accession H0074
Systematic name Allele 1: g.125691G>A, c.3644G>A, r.3644g>a, p.Arg1215Gln
Systematic name Allele 2: g.125691G>G, c.3644G>G, r.3644g>g, p.Arg1215Arg
Original code patient 2
Description Allele 1: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Description Allele 2: A point mutation in the exon 22 leading to an
Description amino acid change in the SUSHI20 domain
Date 28-Apr-2008 (Rel. 1, Created)
Date 28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17973958
RefAuthors Jalanko, H., Peltonen, S., Koskinen, A., Puntila, J.,
RefAuthors Isoniemi, H., Holmberg, C., Pinomaki, A., Armstrong, E.,
RefAuthors Koivusalo, A., Tukiainen, E., Makisalo, H., Saland, J.,
RefAuthors Remuzzi, G., de Cordoba, S., Lassila, R., Meri, S.,
RefAuthors Jokiranta, T. S.
RefTitle Successful liver-kidney transplantation in two children
RefTitle with aHUS caused by a mutation in complement factor H.
RefLoc Am J Transplant:216-221 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 125691
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3717
Feature /codon: cga -> caa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature /change: R -> Q
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 125691
Feature /change: g -> g
Feature /genomic_region: exon; 22
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 3717
Feature /codon: cga -> cga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature /change: R -> R
Feature /domain: SUSHI20
Protein level Increased
Activity Reduced
Age 16
Sex XX
Ethnic origin Caucasoid; Finland
Family history Inherited
Relative CFHbase; H0073nephew
Symptoms Hemolytic and renal abnormalities
Symptoms Typical HUS, associated with diarrhea
Symptoms Proteinuria
Symptoms Infections: none
Treatment Dialysis
Treatment Renal transplantation: Yes
Treatment : Yes
Treatment Outcome: Alive and well
Treatment Further information: Combined transplantation of kidney and
Treatment liver.
//
ID #T1216-1(1),=; standard; MUTATION; SUSHI20
Accession H0066
Systematic name Allele 1: g.125693_125695delACA, c.3646_3648delACA,
Systematic name r.3646_3648delaca, p.Thr1216del
Original code Case 13
Description Allele 1: an inframe deletion in the exon 22 leading
Description to an amino acid change in the SUSHI20 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 125693..125695
Feature /change: -aca
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0040: 3719..3721
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1216
Feature /change: -T
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID P1226S(1),=; standard; MUTATION; SUSHI20
Accession H0067
Systematic name Allele 1: g.125723C>T, c.3676C>T, r.3676c>u,
Systematic name p.Pro1226Ser
Original code Case 14
Description Allele 1: a point mutation in the exon 22 leading to
Description an amino acid change in the SUSHI20 domain
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 125723
Feature /change: c -> t
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0040: 3749
Feature /codon: cca -> tca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1226
Feature /change: P -> S
Feature /domain: SUSHI20
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID #X1232X1269(1),=; standard; MUTATION;
Accession H0068
Systematic name Allele 1: g.125742_125745delAGAA, c.3695_3698delAGAA,
Systematic name r.3695_3698delagaa, p.1232fsX37
Original code Case 15
Description Allele 1: a terminator deletion mutation in the exon
Description 22 leading to a elongation of the amino acid sequence
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0040: 125742..125745
Feature /change: -agaa
Feature /genomic_region: exon; 22
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: terminator; frameshift
Feature /loc: IDRefSeq: C0040: 3768..3771
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; elongation
Feature /loc: UniProt: P08603; CFAH_HUMAN: 1232..1233
Feature /change: XN -> FNHKVHTFIQ NFSIKSVLNF IFYVLFYSFL FIRKILDX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
ID Intron 3(4),Intron 3(4); standard; MUTATION;
Accession H0096
Systematic name Allele 1 and 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code D
Description Allele 1 and 2: A point mutation in the intron 3 leading to
Description an amino acid change
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Age 54
Sex XY
Family history Inherited
Treatment
//
ID Intron 3(5),R567G(1); standard; MUTATION;
Accession H0097
Systematic name Allele 1: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Systematic name Allele 2: g.103553A>G, c.1699A>G, r.1699a>g, p.Arg567Gly
Original code E
Description Allele 1: A point mutation in the intron 3 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 12 leading to an
Description amino acid change
Date 23-May-2008 (Rel. 1, Created)
Date 23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18252232
RefAuthors Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F.
RefAuthors P., den Hollander, A. I.
RefTitle Basal laminar drusen caused by compound heterozygous
RefTitle variants in the CFH gene.
RefLoc Am J Hum Genet:516-523 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: EMBL: AL049744: 52398
Feature /change: t -> g
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: EMBL: AL049744: 103553
Feature /change: a -> g
Feature /genomic_region: exon; 12
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: EMBL: Y00716; GI:116131; : 1772
Feature /codon: aga -> gga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: SWISSPROT: P08603; CFAH_HUMAN: 567
Feature /change: R -> G
Age 54
Sex XX
Family history Inherited
Treatment
//
ID Intron 21(1),=; standard; MUTATION;
Accession H0064
Systematic name Allele 1: g.IVS21+1G>A, c.3566+1G>A, r.3566+1g>a,
Original code Case 10
Description Allele 1: a point mutation in the intron 21 leading
Description to aberrant splicing
Date 30-Dec-2005 (Rel. 1, Created)
Date 30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12960213
RefAuthors Neumann, H. P., Salzmann, M., Bohnert-Iwan, B.,
RefAuthors Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U.,
RefAuthors Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U.,
RefAuthors Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P.
RefAuthors F.
RefTitle Haemolytic uraemic syndrome and mutations of the factor H
RefTitle gene: a registry-based study of german speaking countries.
RefLoc J Med Genet 40:676-681 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0040: 124430
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: intron; 21
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: no change
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: no change
Feature aa; 6
Feature /rnalink: 5
Feature /name: no change
Symptoms Hemolytic and renal abnormalities
Symptoms Hemolytic uremic syndrome
Symptoms Atypical HUS, not associated with diarrhea
Ethnic origin Caucasoid
Comment -!-Sporadic.
//
//
|
