ID-bases-logo
- databases for immunodeficiency-causing variations

   CFHbase
   Variation registry for  Factor H deficiency


Database        CFHbase
Version         1.1
File            cfhpub.txt
Date            06-Jun-2011
Curator         Mauno Vihinen
Address         Protein Structure and Bioinformatics 
Address         Lund University, BMC D10, SE-22184 Lund, Sweden
Phone           +46 72 526 0022
Fax             +46 46 222 9328
Email           Mauno Vihinen
URL             http://structure.bmc.lu.se/idbase/cfhbase/
IDR factfile    http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF101.html
Gene            CFH
Disease         Factor H deficiency  
OMIM            134370
GDB             120041
Sequence        IDRefSeq:D0040; IDRefSeq:C0040; UniProt:P08603 
Numbering       start of the entry
Funding         Tampere University Hospital Medical Research Fund
Funding         European Union
Comments        previously known as HF1base
Comments        sequence entry reference in every entry
//
ID              #R28X32(1),=; standard; MUTATION; SUSHI1
Accession       H0024
Systematic name Allele 1: g.51431_51434delAGAA, c.155_158delAGAA, 
Systematic name p.28fsX32
Original code   Sporadic case
Description     Allele 1: deletion in the exon 2 leading to a 
Description     premature stop codon in the SUSHI1 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9551389
RefAuthors      Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y., 
RefAuthors      Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle        Genetic studies into inherited and sporadic hemolytic 
RefTitle        uremic syndrome.
RefLoc          Kidney Int 53:836-844 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 51431..51434
Feature           /change: -agaa
Feature           /genomic_region: exon; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 155..158
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 28..29
Feature           /change: RN -> IQKFX
Feature           /domain: SUSHI1
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment          Further information: The graft failed and patient had 
Treatment          nephrectomy three months later
Sex             XY
Age             36
//
ID              R78G(1),=; standard; MUTATION; SUSHI1
Accession       H0042
Systematic name Allele 1: g.51581A>G, c.232A>G, r.232a>g, p.Arg78Gly
Original code   S023#101
Description     Allele 1: a point mutation in the exon 2 leading to
Description     an amino acid change in the SUSHI1 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 51581
Feature           /change: a -> g
Feature           /genomic_region: exon; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 305
Feature           /codon: agg -> ggg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 78
Feature           /change: R -> G
Feature           /domain: SUSHI1
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Original description of the mutation is R60G
//
ID              #I124X136(1),=; standard; MUTATION; SUSHI2
Accession       H0034
Systematic name Allele 1: g.54439_54463delTTAATTACCGTGAATGTGACACAGA,
Systematic name c.371_395delTTAATTACCGTGAATGTGACACAGA,
Systematic name r.371_395deluuaauuaccgugaaugugacacaga, p.Ile124fsX13
Original code   Patient 9
Description     Allele 1: a frame shift deletion mutation in the exon
Description     4 leading to a premature stop codon in the SUSHI2 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 54439..54463
Feature           /change: -ttaattaccg tgaatgtgac acaga
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 444..468
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 124..132
Feature           /change: INYRECDTD -> MDGPMIFLYV KLX
Feature           /domain: SUSHI2
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XX
Ethnic origin   Caucasoid
Comment         -!-Patient died despite weekly administration of FFP
//
ID              R127L(1a),R127L(1a); standard; MUTATION; SUSHI2,SUSHI2
Accession       H0028
Systematic name Allele 1 and 2: g.54448G>T, c.380G>T, r.380g>u, p.Arg127Leu
Original code   Patient 3
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change in the SUSHI2 domain
Date            22-Dec-2004 (Rel. 1, Created)
Date            22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 54448
Feature           /change: g -> t
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 453
Feature           /codon: cgt -> ctt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature           /change: R -> L
Feature           /domain: SUSHI2
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 54448
Feature           /change: g -> t
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 453
Feature           /codon: cgt -> ctt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature           /change: R -> L
Feature           /domain: SUSHI2
Symptoms        Hemolytic and renal abnormalities
Symptoms           Membranoproliferative glomerulonephritis
Sex             XY
Ethnic origin   Caucasoid; Turkey
Relative        CFHbase; H0029 brother
//
ID              R127L(1b),R127L(1b); standard; MUTATION; SUSHI2,SUSHI2
Accession       H0029
Systematic name Allele 1 and 2: g.54448G>T, c.380G>T, r.380g>u, p.Arg127Leu
Original code   Patient 4
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change in the SUSHI2 domain
Date            22-Dec-2004 (Rel. 1, Created)
Date            22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 54448
Feature           /change: g -> t
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 453
Feature           /codon: cgt -> ctt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature           /change: R -> L
Feature           /domain: SUSHI2
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 54448
Feature           /change: g -> t
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 453
Feature           /codon: cgt -> ctt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 127
Feature           /change: R -> L
Feature           /domain: SUSHI2
Symptoms        Hemolytic and renal abnormalities
Symptoms           Membranoproliferative glomerulonephritis
Sex             XY
Ethnic origin   Caucasoid; Turkey
Relative        CFHbase; H0028 brother
//
ID              P139S(1),P139S(1); standard; MUTATION; SUSHI2,SUSHI2
Accession       H0107
Systematic name Allele 1 and 2: g.54483C>T, c.415C>T, r.415c>u, p.Pro139Ser
Description     Allele 1 and 2: A point mutation in the exon 4 leading to
Description     an amino acid change in the SUSHI2 domain
Date            27-Apr-2011 (Rel. 1, Created)
Date            27-Apr-2011 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefLoc          Submitted (27-Apr-2011) to CFHbase.
RefLoc          Lone Schejbel; e-mail lone.schejbel@rh.regionh.dk
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 54483
Feature           /change: c -> t
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 488
Feature           /codon: cct -> tct; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 139
Feature           /change: P -> S
Feature           /domain: SUSHI2
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 54483
Feature           /change: c -> t
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 488
Feature           /codon: cct -> tct; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 139
Feature           /change: P -> S
Feature           /domain: SUSHI2
Treatment         
//
ID              E189X(1a),E189X(1a); standard; MUTATION; SUSHI3,SUSHI3
Accession       H0004
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code   II-3
Description     Allele 1 and 2: point mutation in the exon 5 leading to a 
Description     premature stop codon in the SUSHI3 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803850
RefAuthors      Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M., 
RefAuthors      Rodriguez de Cordoba, S.
RefTitle        Molecular basis for factor H and FHL-1 deficiency in an 
RefTitle        italian family.
RefLoc          Immunogenetics 51:366-369 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
Protein exp.    Complete absence of factor H and FHL-1
Symptoms        Other clinical features: systemic lupus erythematosus with 
Symptoms        chronic renal failure, highly reduced C3 serum levels and 
Symptoms        low concentrations of C5-C9, skin lesions with ulcerations 
Symptoms        and central nervous system involvement with psychosis
Sex             XX
Ethnic origin   Caucasoid; Italy
Parents         Consanguineous
Relative        CFHbase; H0005 brother
Relative        CFHbase; H0006 brother
//
ID              E189X(1b),E189X(1b); standard; MUTATION; SUSHI3,SUSHI3
Accession       H0005
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code   II-2
Description     Allele 1 and 2: point mutation in the exon 5 leading to a 
Description     premature stop codon in the SUSHI3 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803850
RefAuthors      Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M., 
RefAuthors      Rodriguez de Cordoba, S.
RefTitle        Molecular basis for factor H and FHL-1 deficiency in an 
RefTitle        italian family.
RefLoc          Immunogenetics 51:366-369 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
Protein exp.    Complete absence of factor H and FHL-1
Symptoms        Other clinical features: highly reduced C3 serum levels 
Symptoms        and low concentrations of C5-C9, three episodes of 
Symptoms        meningococcal meningitis
Sex             XY
Ethnic origin   Caucasoid; Italy
Parents         Consanguineous
Relative        CFHbase; H0004 sister
Relative        CFHbase; H0006 brother
//
ID              E189X(1c),E189X(1c); standard; MUTATION; SUSHI3,SUSHI3
Accession       H0006
Systematic name Allele 1 and 2: g.56043G>T, c.638G>T, p.E189X
Original code   II-4
Description     Allele 1 and 2: point mutation in the exon 5 leading to a 
Description     premature stop codon in the SUSHI3 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803850
RefAuthors      Sanchez-Corral, P., Bellavia, D., Amico, L., Brai, M., 
RefAuthors      Rodriguez de Cordoba, S.
RefTitle        Molecular basis for factor H and FHL-1 deficiency in an 
RefTitle        italian family.
RefLoc          Immunogenetics 51:366-369 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 56043
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 638
Feature           /codon: gaa -> taa; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 189
Feature           /change: E -> X
Feature           /domain: SUSHI3
Protein exp.    Complete absence of factor H and FHL-1
Symptoms        Other clinical features: highly reduced C3 serum levels 
Symptoms        and low concentrations of C5-C9, one episode of 
Symptoms        meningococcal meningitis
Sex             XY
Ethnic origin   Caucasoid; Italy
Parents         Consanguineous
Relative        CFHbase; H0004 sister
Relative        CFHbase; H0005 brother
//
ID              Q408X(1a),Intron 3(1a); standard; MUTATION; SUSHI7,
Accession       H0085
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   A-III.5
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             45
Sex             XY
Family history  Inherited
Relative        CFHbase; H0086;father
Relative        CFHbase; H0087;cousin
Relative        CFHbase; H0088;cousin
Treatment          
//
ID              Q408X(1b),Intron 3(1b); standard; MUTATION; SUSHI7,
Accession       H0086
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   A-II.3
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Sex             XY
Family history  Inherited
Relative        CFHbase; H0085;son
Relative        CFHbase; H0087;niece
Relative        CFHbase; H0088;nephew
Treatment          
//
ID              Q408X(1c),Intron 3(1c); standard; MUTATION; SUSHI7,
Accession       H0087
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   A-III.1
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             63
Sex             XX
Family history  Inherited
Relative        CFHbase; H0085;cousin
Relative        CFHbase; H0086;uncle
Relative        CFHbase; H0088;brother
Treatment          
//
ID              Q408X(1d),Intron 3(1d); standard; MUTATION; SUSHI7,
Accession       H0088
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   A-III.3
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             67
Sex             XY
Family history  Inherited
Relative        CFHbase; H0085;cousin
Relative        CFHbase; H0086;uncle
Relative        CFHbase; H0087;sister
Treatment          
//
ID              Q408X(2a),Intron 3(2a); standard; MUTATION; SUSHI7,
Accession       H0089
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   B-II.1
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             48
Sex             XY
Family history  Inherited
Relative        CFHbase; H0090;mother
Relative        CFHbase; H0091;son
Relative        CFHbase; H0092;son
Treatment          
//
ID              Q408X(2b),Intron 3(2b); standard; MUTATION; SUSHI7,
Accession       H0090
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   B-I.2
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             68
Sex             XX
Family history  Inherited
Relative        CFHbase; H0089;son
Relative        CFHbase; H0091;grandson
Relative        CFHbase; H0092;grandson
Treatment          
//
ID              Q408X(2c),Intron 3(2c); standard; MUTATION; SUSHI7,
Accession       H0091
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   B-III.1
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Sex             XY
Family history  Inherited
Relative        CFHbase; H0089;father
Relative        CFHbase; H0090;grandmother
Relative        CFHbase; H0092;brother
Treatment          
//
ID              Q408X(2d),Intron 3(2d); standard; MUTATION; SUSHI7,
Accession       H0092
Systematic name Allele 1: g.68555C>T, c.1222C>T, r.1222c>u, p.Gln408X
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   B-III.2
Description     Allele 1: A point mutation in the exon 9 leading to a
Description     premature stop codon in the SUSHI7 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI7 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68555
Feature           /change: c -> t
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 1295
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 408
Feature           /change: Q -> X
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Sex             XY
Family history  Inherited
Relative        CFHbase; H0089;father
Relative        CFHbase; H0090;grandmother
Relative        CFHbase; H0091;brother
Treatment          
//
ID              C431S(1),C431S(1); standard; MUTATION; SUSHI7,SUSHI7
Accession       H0030
Systematic name Allele 1 and 2: g.68624T>A, c.1291T>A, r.1291u>a,
Systematic name p.Cys431Ser
Original code   Patient 5
Description     Allele 1 and 2: a point mutation in the exon 9 leading to
Description     an amino acid change in the SUSHI7 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 68624
Feature           /change: t -> a
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 1364
Feature           /codon: tgt -> agt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 431
Feature           /change: C -> S
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 68624
Feature           /change: t -> a
Feature           /genomic_region: exon; 9
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 1364
Feature           /codon: tgt -> agt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 431
Feature           /change: C -> S
Feature           /domain: SUSHI7
Symptoms        Hemolytic and renal abnormalities
Symptoms           Membranoproliferative glomerulonephritis
Sex             XY
Comment         -!-Stable renal function 12 yr after diagnosis
//
ID              C431Y(1),C431Y(1); standard; MUTATION; SUSHI7,SUSHI7
Accession       H0072
Systematic name Allele 1 and 2: g.68625G>A, c.1292G>A, r.1292g>a,
Systematic name p.Cys431Tyr
Original code   patient
Description     Allele 1 and 2: A point mutation in the exon 9 leading to
Description     an amino acid change in the SUSHI7 domain
Date            21-Apr-2008 (Rel. 1, Created)
Date            21-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18336910
RefAuthors      Montes, T., Goicoechea de Jorge, E., Ramos, R., Goma, M., 
RefAuthors      Pujol, O., Sanchez-Corral, P., Rodriguez de Cordoba, S.
RefTitle        Genetic deficiency of complement factor H in a patient 
RefTitle        with age-related macular degeneration and 
RefTitle        membranoproliferative glomerulonephritis.
RefLoc          Mol Immunol:2897-2904 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68625
Feature           /change: g -> a
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 1365
Feature           /codon: tgt -> tat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 431
Feature           /change: C -> Y
Feature           /domain: SUSHI7
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 68625
Feature           /change: g -> a
Feature           /genomic_region: exon; 9
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 1365
Feature           /codon: tgt -> tat; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 431
Feature           /change: C -> Y
Feature           /domain: SUSHI7
Age             56
Sex             XY
Ethnic origin   Spain
Family history  Not known
Symptoms        Hemolytic and renal abnormalities
Symptoms           Chronic renal failure
Symptoms           Membranoproliferative glomerulonephritis
Symptoms        Infections: none
IgG             584 mg/dL
Treatment       Renal transplantation: Yes
Treatment          : Yes
//
ID              #K474X479(1a),=; standard; MUTATION; SUSHI8
Accession       H0011
Systematic name Allele 1: g.92248delA, c.1493delA, p.474fsX479
Original code   F39#3
Description     Allele 1: deletion in the exon 10 leading to a 
Description     premature stop codon in the SUSHI8 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 92248
Feature           /change: -a
Feature           /genomic_region: exon; 10
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 1493
Feature           /note: The deleted adenine may be any of the three 
Feature           /note: adenines of the codon (positions 1493-1495)
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 474
Feature           /change: K -> NINANX
Feature           /domain: SUSHI8
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Sex             XX
Age             25
Ethnic origin   Caucasoid; Italy
Relative        CFHbase; H0012; brother
//
ID              #K474X479(1b),=; standard; MUTATION; SUSHI8
Accession       H0012
Systematic name Allele 1: g.92248delA, c.1493delA, p.474fsX479
Original code   F40#3
Description     Allele 1: deletion in the exon 10 leading to a 
Description     premature stop codon in the SUSHI8 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 92248
Feature           /change: -a
Feature           /genomic_region: exon; 10
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 1493
Feature           /note: The deleted adenine may be any of the three 
Feature           /note: adenines of the codon (positions 1493-1495)
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 474
Feature           /change: K -> NINANX
Feature           /domain: SUSHI8
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Sex             XY
Age             22
Ethnic origin   Caucasoid; Italy
Relative        CFHbase; H0011; sister
//
ID              N516K(1),=; standard; MUTATION; SUSHI9,
Accession       H0101
Systematic name Allele 1: g.94051T>A, c.1548T>A, r.1548u>a,
Systematic name p.Asn516Lys
Original code   P.1
Description     Allele 1: A point mutation in the exon 11 leading to
Description     an amino acid change in the SUSHI9 domain
Date            01-Jul-2010 (Rel. 1, Created)
Date            01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18557729
RefAuthors      Le Quintrec, M., Lionet, A., Kamar, N., Karras, A., 
RefAuthors      Barbier, S., Buchler, M., Fakhouri, F., Provost, F., 
RefAuthors      Fridman, W. H., Thervet, E., Legendre, C., Zuber, J., 
RefAuthors      Fremeaux-Bacchi, V.
RefTitle        Complement mutation-associated de novo thrombotic 
RefTitle        microangiopathy following kidney transplantation.
RefLoc          Am J Transplant:1694-1701 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 94051
Feature           /change: t -> a
Feature           /genomic_region: exon; 11
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 1621
Feature           /codon: aat -> aaa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 516
Feature           /change: N -> K
Feature           /domain: SUSHI9
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             47
Sex             XX
Ethnic origin   France
Symptoms        Hemolytic and renal abnormalities
Symptoms        Other clinical features: nephroangiosclerosis
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment       Other treatment: plasma exchange
Comment         The patient carried mutation in CFI gene also.
Comment         CFIbase; I0013
//
ID              C536R(1),C959Y(1); standard; MUTATION; SUSHI9,SUSHI16
Accession       H0001
Systematic name Allele 1: g.94109T>C, c.1679T>C, p.C536R
Systematic name Allele 2: g.119142G>A, c.2949G>A, p.C959Y
Original code   13-month-old boy
Description     Allele 1: point mutation in the exon 11 leading to an 
Description     amino acid change in the SUSHI9 domain
Description     Allele 2: point mutation in the exon 18 leading to an 
Description     amino acid change in the SUSHI16 domain
Date            15-Apr-2003 (Rel. 1, Created)
Date            15-Apr-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9312129
RefAuthors      Ault, B. H., Schmidt, B. Z., Fowler, N. L., Kashtan, C. 
RefAuthors      E., Ahmed, A. E., Vogt, B. A., Colten, H. R.
RefTitle        Human factor H deficiency. mutations in framework cysteine 
RefTitle        residues and block in H protein secretion and 
RefTitle        intracellular catabolism.
RefLoc          J Biol Chem 272:25168-25175 (1997)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 94109
Feature           /change: t -> c
Feature           /genomic_region: exon; 11
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 1679
Feature           /codon: tgc -> cgc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 536
Feature           /change: C -> R
Feature           /domain: SUSHI9
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 119142
Feature           /change: g -> a
Feature           /genomic_region: exon; 18
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2949
Feature           /codon: tgt -> tat; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 959
Feature           /change: C -> Y
Feature           /domain: SUSHI16
Symptoms        Hemolytic and renal abnormalities
Symptoms           Membranoproliferative glomerulonephritis
Symptoms        Other clinical features: hypocomplementic hypertensive 
Symptoms        renal disease
Treatment       Renal transplantation: Yes: Date: 02/96
Sex             XY
Ethnic origin   Caucasoid; American
//
ID              C630W(1),=; standard; MUTATION; SUSHI11
Accession       H0055
Systematic name Allele 1: g.104916T>G, c.1890T>G, r.1890u>g,
Systematic name p.Cys630Trp
Original code   Case 1
Description     Allele 1: a point mutation in the exon 13 leading to
Description     an amino acid change in the SUSHI11 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 104916
Feature           /change: t -> g
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 1963
Feature           /codon: tgt -> tgg; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 630
Feature           /change: C -> W
Feature           /domain: SUSHI11
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. Father carrier.
//
ID              C673S(1),C673S(1); standard; MUTATION; SUSHI11,SUSHI11
Accession       H0031
Systematic name Allele 1 and 2: g.105044G>C, c.2018G>C, r.2018g>c,
Systematic name p.Cys673Ser
Original code   Patient 6
Description     Allele 1 and 2: a point mutation in the exon 13 leading to
Description     an amino acid change in the SUSHI11 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 105044
Feature           /change: g -> c
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2091
Feature           /codon: tgt -> tct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature           /change: C -> S
Feature           /domain: SUSHI11
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 105044
Feature           /change: g -> c
Feature           /genomic_region: exon; 13
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2091
Feature           /codon: tgt -> tct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature           /change: C -> S
Feature           /domain: SUSHI11
Symptoms        Hemolytic and renal abnormalities
Symptoms           Membranoproliferative glomerulonephritis
Sex             XX
Ethnic origin   Caucasoid
Comment         -!-CRI 2 yr after diagnosis
//
ID              C673Y(1),=; standard; MUTATION; SUSHI11
Accession       H0037
Systematic name Allele 1: g.105044G>A, c.2018G>A, r.2018g>a,
Systematic name p.Cys673Tyr
Original code   Patient 12
Description     Allele 1: a point mutation in the exon 13 leading to
Description     an amino acid change in the SUSHI11 domain
Date            27-Dec-2004 (Rel. 1, Created)
Date            27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 105044
Feature           /change: g -> a
Feature           /genomic_region: exon; 13
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2091
Feature           /codon: tgt -> tat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 673
Feature           /change: C -> Y
Feature           /domain: SUSHI11
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms        Other clinical features: recurrence of haemolysis,
Symptoms        progressive renal failure
Treatment       Dialysis
Sex             XX
Ethnic origin   Caucasoid
//
ID              S714X(1),=; standard; MUTATION; SUSHI12
Accession       H0056
Systematic name Allele 1: g.105275C>G, c.2141C>G, r.2141c>g,
Systematic name p.Ser714X
Original code   Case 2
Description     Allele 1: a point mutation in the exon 14 leading to
Description     a premature stop codon in the SUSHI12 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 105275
Feature           /change: c -> g
Feature           /genomic_region: exon; 14
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2214
Feature           /codon: tca -> tga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 714
Feature           /change: S -> X
Feature           /domain: SUSHI12
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. Mother carrier.
//
ID              @N767X774(1),=; standard; MUTATION; SUSHI13
Accession       H0033
Systematic name Allele 1: g.106839_106840insA, c.2300_2301insA,
Systematic name r.2300_2301insa, p.Asn767fsX8
Original code   Patient 8
Description     Allele 1: a frame shift insertion mutation in the
Description     exon 15 leading to a premature stop codon in the SUSHI13
Description     domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: insertion
Feature           /loc: IDRefSeq: D0040: 106840
Feature           /change: +a
Feature           /genomic_region: exon; 15
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 2374
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 767
Feature           /change: N -> KQEGIRSX
Feature           /domain: SUSHI13
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive and well
Treatment          Further information: no recurrence 4 yr after renal
Treatment          transplantation
Sex             XY
//
ID              @N767X774(2); standard; MUTATION; SUSHI13
Accession       H0083
Systematic name Allele 1: g.106840C>C, c.2301C>C, r.2301c>c, p.Asn767Asn
Systematic name Allele 2: g.106839_106840insA, c.2300_2301insA,
Systematic name r.2300_2301insa
Original code   Patient 1
Description     Allele 2: A frame shift insertion mutation in the exon 15
Description     leading to a premature stop codon in the SUSHI13 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18371543
RefAuthors      Boyer, O., Noel, L. H., Balzamo, E., Guest, G., Biebuyck, 
RefAuthors      N., Charbit, M., Salomon, R., Fremeaux-Bacchi, V., 
RefAuthors      Niaudet, P.
RefTitle        Complement factor H deficiency and posttransplantation 
RefTitle        glomerulonephritis with isolated C3 deposits.
RefLoc          Am J Kidney Dis:671-677 (2008)
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: insertion
Feature           /loc: EMBL: AL049744: 106840
Feature           /change: +a
Feature           /genomic_region: exon; 15
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: EMBL: Y00716; GI:116131; : 2374
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 767
Feature           /change: N -> KQEGIRSX
Feature           /domain: SUSHI13
Age             1,4
Sex             XY
Ethnic origin   Negroid; Africa
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms           Proteinuria
Treatment       Renal transplantation: Yes
Treatment          : Yes
Comment         Patient has also CFI: c.548A>G (CFI:I0012) and MCP:
Comment         c.796G>A mutations.
//
ID              E850K(1),=; standard; MUTATION; SUSHI14
Accession       H0057
Systematic name Allele 1: g.115388G>A, c.2548G>A, r.2548g>a,
Systematic name p.Glu850Lys
Original code   Case 3
Description     Allele 1: a point mutation in the exon 16 leading to
Description     an amino acid change in the SUSHI14 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 115388
Feature           /change: g -> a
Feature           /genomic_region: exon; 16
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2621
Feature           /codon: gaa -> aaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 850
Feature           /change: E -> K
Feature           /domain: SUSHI14
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              H893R(1),=; standard; MUTATION; SUSHI15
Accession       H0036
Systematic name Allele 1: g.115986A>G, c.2678A>G, r.2678a>g,
Systematic name p.His893Arg
Original code   Patient 11
Description     Allele 1: a point mutation in the exon 17 leading to
Description     an amino acid change in the SUSHI15 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 115986
Feature           /change: a -> g
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2751
Feature           /codon: cat -> cgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 893
Feature           /change: H -> R
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Thrombocytopenia
Symptoms        Other clinical features: anemia
Treatment       Dialysis
Treatment          Further information: patient presented with chronic
Treatment          hemolysis requiring weekly administration of RTP during
Treatment          4 mo.
Sex             XX
Ethnic origin   Caucasoid
Comment         -!-No recurrence 5 yr after onset
//
ID              H893R(2),=; standard; MUTATION; SUSHI15
Accession       H0040
Systematic name Allele 1: g.115986A>G, c.2678A>G, r.2678a>g,
Systematic name p.His893Arg
Original code   Patient 15
Description     Allele 1: a point mutation in the exon 17 leading to
Description     an amino acid change in the SUSHI15 domain
Date            27-Dec-2004 (Rel. 1, Created)
Date            27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 115986
Feature           /change: a -> g
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2751
Feature           /codon: cat -> cgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 893
Feature           /change: H -> R
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Chronic renal failure
Symptoms        Other clinical features: hypertension
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment          Further information: 18 mo after the transplantation,
Treatment          recurrence of progressive renal failure associated with
Treatment          hemolytic anemia occurred, and he required again
Treatment          hemodialysis. Graft biopsy revealed TMA lesions.
Sex             XY
Ethnic origin   Caucasoid
//
ID              Y899X(1a),Y899X(1a); standard; MUTATION; SUSHI15,SUSHI15
Accession       H0026
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code   Patient 1
Description     Allele 1 and 2: a point mutation in the exon 17 leading to
Description     a premature stop codon in the SUSHI15 domain
Date            22-Dec-2004 (Rel. 1, Created)
Date            22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Treatment       Other treatment: Patient has been receiving fresh frozen
Treatment       plasma treatment every week since age 4. After 4 yr
Treatment       follow-up, his renal function remained normal and no
Treatment       relapse of hemolysis occurred.
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CFHbase; H0027 cousin
//
ID              Y899X(1b),Y899X(1b); standard; MUTATION; SUSHI15,SUSHI15
Accession       H0027
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code   Patient 2
Description     Allele 1 and 2: a point mutation in the exon 17 leading to
Description     a premature stop codon in the SUSHI15 domain
Date            22-Dec-2004 (Rel. 1, Created)
Date            22-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive and well
Treatment          Further information: Kidney transplantation was 
Treatment          performed at age 7. Twice-monthly plasma infusions were 
Treatment          performed during the 2yr after transplantation, and 
Treatment          graft function is currently normal.
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CFHbase; H0026 cousin
//
ID              Y899X(2),Y899X(2); standard; MUTATION; SUSHI15,SUSHI15
Accession       H0054
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code   8-month-old boy
Description     Allele 1 and 2: a point mutation in the exon 17 leading to
Description     a premature stop codon in the SUSHI15 domain
Date            21-Oct-2005 (Rel. 1, Created)
Date            21-Oct-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15685522
RefAuthors      Licht, C., Weyersberg, A., Heinen, S., Stapenhorst, L., 
RefAuthors      Devenge, J., Beck, B., Waldherr, R., Kirschfink, M., 
RefAuthors      Zipfel, P. F., Hoppe, B.
RefTitle        Successful plasma therapy for atypical hemolytic uremic 
RefTitle        syndrome caused by factor H deficiency owing to a novel 
RefTitle        mutation in the complement cofactor protein domain 15.
RefLoc          Am J Kidney Dis 45:415-421 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
Protein exp.    complete factor H deficiency
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XY
Ethnic origin   Caucasoid
Parents         Consanguineous
//
ID              Y899X(3),Y899X(3); standard; MUTATION; SUSHI15,SUSHI15
Accession       H0084
Systematic name Allele 1 and 2: g.116005T>A, c.2697T>A, r.2697u>a,
Systematic name p.Tyr899X
Original code   Patient 2
Description     Allele 1 and 2: A point mutation in the exon 17 leading to
Description     a premature stop codon in the SUSHI15 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18371543
RefAuthors      Boyer, O., Noel, L. H., Balzamo, E., Guest, G., Biebuyck, 
RefAuthors      N., Charbit, M., Salomon, R., Fremeaux-Bacchi, V., 
RefAuthors      Niaudet, P.
RefTitle        Complement factor H deficiency and posttransplantation 
RefTitle        glomerulonephritis with isolated C3 deposits.
RefLoc          Am J Kidney Dis:671-677 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 116005
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: EMBL: Y00716; GI:116131; : 2770
Feature           /codon: tat -> taa; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 899
Feature           /change: Y -> X
Feature           /domain: SUSHI15
Age             0
Sex             XY
Ethnic origin   Caucasoid; Turkey
Parents         Non-consanguineous
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
//
ID              C915S(1),=; standard; MUTATION; SUSHI15
Accession       H0035
Systematic name Allele 1: g.116051T>A, c.2743T>A, r.2743u>a,
Systematic name p.Cys915Ser
Original code   Patient 10
Description     Allele 1: a point mutation in the exon 17 leading to
Description     an amino acid change in the SUSHI15 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116051
Feature           /change: t -> a
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2816
Feature           /codon: tgc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 915
Feature           /change: C -> S
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment          Further information: Recurrence of HUS occurred 25 d 
Treatment          later, with hemolysis and lesions of thrombotic 
Treatment          microangiopathy (TMA) on the transplant biopsy, leading
Treatment          to transplantectomy
Sex             XX
Ethnic origin   Caucasoid
//
ID              Q925X(1),=; standard; MUTATION; SUSHI15
Accession       H0032
Systematic name Allele 1: g.116081C>T, c.2773C>T, r.2773c>u,
Systematic name p.Gln925X
Original code   Patient 7
Description     Allele 1: a point mutation in the exon 17 leading to
Description     a premature stop codon in the SUSHI15 domain
Date            23-Dec-2004 (Rel. 1, Created)
Date            23-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 116081
Feature           /change: c -> t
Feature           /genomic_region: exon; 17
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 2846
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 925
Feature           /change: Q -> X
Feature           /domain: SUSHI15
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive and well
Treatment          Further information: no recurrence of HUS has occurred
Treatment          during the 10 yr follow-up after transplantation
Sex             XY
Comment         -!-Original description of the mutation is Q924X
//
ID              Q950H(1),=; standard; MUTATION; SUSHI16
Accession       H0043
Systematic name Allele 1: g.119116G>T, c.2850G>T, r.2850g>u,
Systematic name p.Gln950His
Original code   S026#118
Description     Allele 1: a point mutation in the exon 18 leading to
Description     an amino acid change in the SUSHI16 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 119116
Feature           /change: g -> t
Feature           /genomic_region: exon; 18
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2923
Feature           /codon: cag -> cat; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 950
Feature           /change: Q -> H
Feature           /domain: SUSHI16
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              Q950H(2),=; standard; MUTATION; SUSHI16,
Accession       H0102
Systematic name Allele 1: g.119116G>T, c.2850G>T, r.2850g>u,
Systematic name p.Gln950His
Original code   P.2
Description     Allele 1: A point mutation in the exon 18 leading to
Description     an amino acid change in the SUSHI16 domain
Date            01-Jul-2010 (Rel. 1, Created)
Date            01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18557729
RefAuthors      Le Quintrec, M., Lionet, A., Kamar, N., Karras, A., 
RefAuthors      Barbier, S., Buchler, M., Fakhouri, F., Provost, F., 
RefAuthors      Fridman, W. H., Thervet, E., Legendre, C., Zuber, J., 
RefAuthors      Fremeaux-Bacchi, V.
RefTitle        Complement mutation-associated de novo thrombotic 
RefTitle        microangiopathy following kidney transplantation.
RefLoc          Am J Transplant:1694-1701 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 119116
Feature           /change: g -> t
Feature           /genomic_region: exon; 18
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 2923
Feature           /codon: cag -> cat; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 950
Feature           /change: Q -> H
Feature           /domain: SUSHI16
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             48
Sex             XY
Ethnic origin   France
Symptoms        Hemolytic and renal abnormalities
Symptoms        Other clinical features: crescent glomerulonephritis
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment       Other treatment: plasma exchange
//
ID              Y951H(1),=; standard; MUTATION; SUSHI16
Accession       H0044
Systematic name Allele 1: g.119117T>C, c.2851T>C, r.2851u>c,
Systematic name p.Tyr951His
Original code   S025#087
Description     Allele 1: a point mutation in the exon 18 leading to
Description     an amino acid change in the SUSHI16 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 119117
Feature           /change: t -> c
Feature           /genomic_region: exon; 18
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2924
Feature           /codon: tat -> cat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 951
Feature           /change: Y -> H
Feature           /domain: SUSHI16
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              T956M(1),=; standard; MUTATION; SUSHI16
Accession       H0009
Systematic name Allele 1: g.119133C>T, c.2940C>T, p.T956M
Original code   HUS12
Description     Allele 1: point mutation in the exon 18 leading to 
Description     an amino acid change in the SUSHI16 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170895
RefAuthors      Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E., 
RefAuthors      Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S., 
RefAuthors      Sanchez-Corral, P.
RefTitle        Clustering of missense mutations in the C-terminal region 
RefTitle        of factor H in atypical hemolytic uremic syndrome.
RefLoc          Am J Hum Genet 68:478-484 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 119133
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 18
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 2940
Feature           /codon: acg -> atg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 956
Feature           /change: T -> M
Feature           /domain: SUSHI16
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Normal plasma levels of factor H 
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid; Spain
Comment         -!-mother carries the T956M mutation in heterozygosis
//
ID              W978C(1),=; standard; MUTATION; SUSHI16
Accession       H0058
Systematic name Allele 1: g.119200G>T, c.2934G>T, r.2934g>u,
Systematic name p.Trp978Cys
Original code   Case 4
Description     Allele 1: a point mutation in the exon 18 leading to
Description     an amino acid change in the SUSHI16 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 119200
Feature           /change: g -> t
Feature           /genomic_region: exon; 18
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3007
Feature           /codon: tgg -> tgt; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 978
Feature           /change: W -> C
Feature           /domain: SUSHI16
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sibling HUS. Mother and grandmother carrier.
//
ID              Y1021F(1),R1210C(5); standard; MUTATION; SUSHI17,SUSHI20
Accession       H0069
Systematic name Allele 1: g.120410A>T, c.3062A>T, r.3062a>u, p.Tyr1021Phe
Systematic name Allele 2: g.125675C>T, c.3628C>T, r.3628c>u, p.Arg1210Cys
Original code   Case 16
Description     Allele 1: a point mutation in the exon 19 leading to an
Description     amino acid change in the SUSHI17 domain
Description     Allele 2: a point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 120410
Feature           /change: a -> t
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3135
Feature           /codon: tat -> ttt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1021
Feature           /change: Y -> F
Feature           /domain: SUSHI17
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. Mother and father carriers. 
//
ID              C1043R(1),=; standard; MUTATION; SUSHI17
Accession       H0059
Systematic name Allele 1: g.120475T>C, c.3127T>C, r.3127u>c,
Systematic name p.Cys1043Arg
Original code   Case 5
Description     Allele 1: a point mutation in the exon 19 leading to
Description     an amino acid change in the SUSHI17 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 120475
Feature           /change: t -> c
Feature           /genomic_region: exon; 19
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3200
Feature           /codon: tgc -> cgc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1043
Feature           /change: C -> R
Feature           /domain: SUSHI17
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              Q1076E(1),#K1162X1168(1); standard; MUTATION; 
ID              SUSHI18,SUSHI19
Accession       H0016
Systematic name Allele 1: g.121974C>G, c.3299C>G, p.Q1076E
Systematic name Allele 2: g.124422delA, c.3559delA, p.1162fsX1168
Original code   Patient 1
Description     Allele 1: point mutation in the exon 20 leading to an 
Description     amino acid change in the SUSHI18 domain
Description     Allele 2: frameshift deletion in the exon 21 leading to a 
Description     premature stop codon in the SUSHI19 domain
Date            12-May-2003 (Rel. 1, Created)
Date            12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170896
RefAuthors      Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S., 
RefAuthors      Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J. 
RefAuthors      A., Goodship, T. H.
RefTitle        Factor H mutations in hemolytic uremic syndrome cluster in 
RefTitle        exons 18-20, a domain important for host cell recognition.
RefLoc          Am J Hum Genet 68:485-490 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 121974
Feature           /change: c -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3299
Feature           /codon: caa -> gaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1076
Feature           /change: Q -> E
Feature           /domain: SUSHI18
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 124422
Feature           /change: -a
Feature           /genomic_region: exon; 21
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0040: 3559
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1162
Feature           /change: K -> NAYIRVX
Feature           /domain: SUSHI19
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
//
ID              Q1076E(2),=; standard; MUTATION; SUSHI18
Accession       H0060
Systematic name Allele 1: g.121974C>G, c.3226C>G, r.3226c>g,
Systematic name p.Gln1076Glu
Original code   Case 6
Description     Allele 1: a point mutation in the exon 20 leading to
Description     an amino acid change in the SUSHI18 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 121974
Feature           /change: c -> g
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3299
Feature           /codon: caa -> gaa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1076
Feature           /change: Q -> E
Feature           /domain: SUSHI18
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. Father carrier. 
//
ID              R1078S(1a),Intron 3(3a); standard; MUTATION; SUSHI18,
Accession       H0093
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   C-II.2
Description     Allele 1: A point mutation in the exon 20 leading to an
Description     amino acid change in the SUSHI18 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI18 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 121982
Feature           /change: g -> t
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3307
Feature           /codon: agg -> agt; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature           /change: R -> S
Feature           /domain: SUSHI18
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             57
Sex             XY
Family history  Inherited
Relative        CFHbase; H0094;sister
Relative        CFHbase; H0095;brother
Treatment          
//
ID              R1078S(1b),Intron 3(3b); standard; MUTATION; SUSHI18,
Accession       H0094
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   C-II.3
Description     Allele 1: A point mutation in the exon 20 leading to an
Description     amino acid change in the SUSHI18 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI18 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 121982
Feature           /change: g -> t
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3307
Feature           /codon: agg -> agt; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature           /change: R -> S
Feature           /domain: SUSHI18
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Sex             XX
Family history  Inherited
Relative        CFHbase; H0093;brother
Relative        CFHbase; H0095;brother
Treatment          
//
ID              R1078S(1c),Intron 3(3c); standard; MUTATION; SUSHI18,
Accession       H0095
Systematic name Allele 1: g.121982G>T, c.3234G>T, r.3234g>u, p.Arg1078Ser
Systematic name Allele 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   C-II.5
Description     Allele 1: A point mutation in the exon 20 leading to an
Description     amino acid change in the SUSHI18 domain
Description     Allele 2: A point mutation in the intron 3 leading to an
Description     amino acid change in the SUSHI18 domain
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 121982
Feature           /change: g -> t
Feature           /genomic_region: exon; 20
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3307
Feature           /codon: agg -> agt; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1078
Feature           /change: R -> S
Feature           /domain: SUSHI18
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Sex             XY
Family history  Inherited
Relative        CFHbase; H0093;brother
Relative        CFHbase; H0094;sister
Treatment          
//
ID              D1119G(1),=; standard; MUTATION; SUSHI19
Accession       H0017
Systematic name Allele 1: g.124292A>G, c.3429A>G, p.D1119G
Original code   Patient 2
Description     Allele 1: point mutation in the exon 21 leading to 
Description     an amino acid change in the SUSHI19 domain
Date            12-May-2003 (Rel. 1, Created)
Date            12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170896
RefAuthors      Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S., 
RefAuthors      Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J. 
RefAuthors      A., Goodship, T. H.
RefTitle        Factor H mutations in hemolytic uremic syndrome cluster in 
RefTitle        exons 18-20, a domain important for host cell recognition.
RefLoc          Am J Hum Genet 68:485-490 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124292
Feature           /change: a -> g
Feature           /genomic_region: exon; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3429
Feature           /codon: gac -> ggc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1119
Feature           /change: D -> G
Feature           /domain: SUSHI19
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Normal FH levels, indicating a functional abnormality 
Protein exp.    in the secreted protein 
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Comment         -!-Affected sibling with normal C3 and FH levels
//
ID              V1134G(1),=; standard; MUTATION; SUSHI19
Accession       H0061
Systematic name Allele 1: g.124337T>G, c.3401T>G, r.3401u>g,
Systematic name p.Val1134Gly
Original code   Case 7
Description     Allele 1: a point mutation in the exon 21 leading to
Description     an amino acid change in the SUSHI19 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124337
Feature           /change: t -> g
Feature           /genomic_region: exon; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3474
Feature           /codon: gtt -> ggt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1134
Feature           /change: V -> G
Feature           /domain: SUSHI19
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. Mother carrier. 
//
ID              Y1142D(1),=; standard; MUTATION; SUSHI19
Accession       H0062
Systematic name Allele 1: g.124360T>G, c.3424T>G, r.3424u>g,
Systematic name p.Tyr1142Asp
Original code   Case 8
Description     Allele 1: a point mutation in the exon 21 leading to
Description     an amino acid change in the SUSHI19 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124360
Feature           /change: t -> g
Feature           /genomic_region: exon; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3497
Feature           /codon: tat -> gat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1142
Feature           /change: Y -> D
Feature           /domain: SUSHI19
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              W1157R(1),=; standard; MUTATION; SUSHI19
Accession       H0063
Systematic name Allele 1: g.124405T>C, c.3469T>C, r.3469u>c,
Systematic name p.Trp1157Arg
Original code   Case 9
Description     Allele 1: a point mutation in the exon 21 leading to
Description     an amino acid change in the SUSHI19 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124405
Feature           /change: t -> c
Feature           /genomic_region: exon; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3542
Feature           /codon: tgg -> cgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1157
Feature           /change: W -> R
Feature           /domain: SUSHI19
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              C1163W(1),=; standard; MUTATION; SUSHI19
Accession       H0045
Systematic name Allele 1: g.124425C>G, c.3489C>G, r.3489c>g,
Systematic name p.Cys1163Trp
Original code   R087#134
Description     Allele 1: a point mutation in the exon 21 leading to
Description     an amino acid change in the SUSHI19 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124425
Feature           /change: c -> g
Feature           /genomic_region: exon; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3562
Feature           /codon: tgc -> tgg; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1163
Feature           /change: C -> W
Feature           /domain: SUSHI19
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              E1172X(1),=; standard; MUTATION; SUSHI20
Accession       H0025
Systematic name Allele 1: g.125561G>T, c.3587G>T, p.E1172X
Original code   R043
Description     Allele 1: point mutation in the exon 22 leading to a 
Description     premature stop codon in the SUSHI20 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12697737
RefAuthors      Manuelian, T., Hellwage, J., Meri, S., Caprioli, J., 
RefAuthors      Noris, M., Heinen, S., Jozsi, M., Neumann, H. P., Remuzzi, 
RefAuthors      G., Zipfel, P. F.
RefTitle        Mutations in factor H reduce binding affinity to C3b and 
RefTitle        heparin and surface attachment to endothelial cells in 
RefTitle        hemolytic uremic syndrome.
RefLoc          J Clin Invest 111:1181-1190 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125561
Feature           /change: g -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 3587
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature           /change: E -> X
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Both normal and mutant protein, which lacks most of SCR20 
Protein exp.    and consequently has a lower molecular weight
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
//
ID              E1172X(2),=; standard; MUTATION; SUSHI20
Accession       H0046
Systematic name Allele 1: g.125561G>T, c.3514G>T, r.3514g>u,
Systematic name p.Glu1172X
Original code   S027#022
Description     Allele 1: a point mutation in the exon 22 leading to
Description     a premature stop codon in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125561
Feature           /change: g -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 3587
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature           /change: E -> X
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              E1172X(3),=; standard; MUTATION; SUSHI20
Accession       H0047
Systematic name Allele 1: g.125561G>T, c.3514G>T, r.3514g>u,
Systematic name p.Glu1172X
Original code   R063#081
Description     Allele 1: a point mutation in the exon 22 leading to
Description     a premature stop codon in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125561
Feature           /change: g -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0040: 3587
Feature           /codon: gaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1172
Feature           /change: E -> X
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              W1183L(1),=; standard; MUTATION; SUSHI20
Accession       H0007
Systematic name Allele 1: g.125595G>T, c.3621G>T, p.W1183L
Original code   HUS2
Description     Allele 1: point mutation in the exon 22 leading to an 
Description     amino acid change in the SUSHI20 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170895
RefAuthors      Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E., 
RefAuthors      Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S., 
RefAuthors      Sanchez-Corral, P.
RefTitle        Clustering of missense mutations in the C-terminal region 
RefTitle        of factor H in atypical hemolytic uremic syndrome.
RefLoc          Am J Hum Genet 68:478-484 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125595
Feature           /change: g -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3621
Feature           /codon: tgg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature           /change: W -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Normal plasma levels of factor H
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XY
Ethnic origin   Caucasoid; Spain
Relative        Description of pedigree:De novo
//
ID              W1183L(2),=; standard; MUTATION; SUSHI20
Accession       H0039
Systematic name Allele 1: g.125595G>T, c.3548G>T, r.3548g>u,
Systematic name p.Trp1183Leu
Original code   Patient 14
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            27-Dec-2004 (Rel. 1, Created)
Date            27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125595
Feature           /change: g -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3621
Feature           /codon: tgg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature           /change: W -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Treatment       Dialysis
Sex             XX
Ethnic origin   Caucasoid
//
ID              W1183R(1),=; standard; MUTATION; SUSHI20
Accession       H0041
Systematic name Allele 1: g.125594T>A, c.3547T>A, r.3547u>a,
Systematic name p.Trp1183Arg
Original code   2-year-old boy, Ref[2]045
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12020532
RefAuthors      Remuzzi, G., Ruggenenti, P., Codazzi, D., Noris, M., 
RefAuthors      Caprioli, J., Locatelli, G., Gridelli, B.
RefTitle        Combined kidney and liver transplantation for familial 
RefTitle        haemolytic uraemic syndrome.
RefLoc          Lancet 359:1671-1672 (2002)
RefNumber       [2]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125594
Feature           /change: t -> a
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3620
Feature           /codon: tgg -> agg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1183
Feature           /change: W -> R
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Other clinical features: chronic microangiopathic
Symptoms        haemolysis
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment          Further information: a liver transplantation was done
Treatment          simultaneously
Treatment       Other treatment: a second liver transplantation was done
Treatment       after patient developed a severe hepatic encephalopathy
Sex             XY
Ethnic origin   Caucasoid; Argentina
//
ID              T1184R(1),=; standard; MUTATION; SUSHI20
Accession       H0019
Systematic name Allele 1: g.125598C>G, c.3624C>G, p.T1184R
Original code   Patient 4
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            12-May-2003 (Rel. 1, Created)
Date            12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170896
RefAuthors      Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S., 
RefAuthors      Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J. 
RefAuthors      A., Goodship, T. H.
RefTitle        Factor H mutations in hemolytic uremic syndrome cluster in 
RefTitle        exons 18-20, a domain important for host cell recognition.
RefLoc          Am J Hum Genet 68:485-490 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125598
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3624
Feature           /codon: aca -> aga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1184
Feature           /change: T -> R
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    FH levels normal, but C3 low
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Sex             XY
Comment         -!-His unaffected mother shows the same change at this 
Comment         position
//
ID              K1186T(1),=; standard; MUTATION; SUSHI20,
Accession       H0103
Systematic name Allele 1: g.125604A>C, c.3557A>C, r.3557a>c,
Systematic name p.Lys1186Thr
Original code   P.3
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            01-Jul-2010 (Rel. 1, Created)
Date            01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18557729
RefAuthors      Le Quintrec, M., Lionet, A., Kamar, N., Karras, A., 
RefAuthors      Barbier, S., Buchler, M., Fakhouri, F., Provost, F., 
RefAuthors      Fridman, W. H., Thervet, E., Legendre, C., Zuber, J., 
RefAuthors      Fremeaux-Bacchi, V.
RefTitle        Complement mutation-associated de novo thrombotic 
RefTitle        microangiopathy following kidney transplantation.
RefLoc          Am J Transplant:1694-1701 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125604
Feature           /change: a -> c
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3630
Feature           /codon: aaa -> aca; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1186
Feature           /change: K -> T
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             49
Sex             XY
Ethnic origin   France
Symptoms        Hemolytic and renal abnormalities
Symptoms        Other clinical features: crescent glomerulonephritis
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment       Other treatment: plasma exchange
Comment         The patient carried mutation in CFI gene also.
Comment         CFIbase; I0014
//
ID              L1189F(1),=; standard; MUTATION; SUSHI20
Accession       H0070
Systematic name Allele 1: g.125612C>T, c.3565C>T, r.3565c>u,
Systematic name p.Leu1189Phe
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            03-Jan-2006 (Rel. 1, Created)
Date            03-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15163532
RefAuthors      Rodriguez de Cordoba, S., Esparza-Gordillo, J., Goicoechea 
RefAuthors      de Jorge, E., Lopez-Trascasa, M., Sanchez-Corral, P.
RefTitle        The human complement factor H: functional roles, genetic 
RefTitle        variations and disease associations.
RefLoc          Mol Immunol 41:355-367 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125612
Feature           /change: c -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3638
Feature           /codon: ctt -> ttt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1189
Feature           /change: L -> F
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
//
ID              L1189R(1),=; standard; MUTATION; SUSHI20
Accession       H0008
Systematic name Allele 1: g.125613T>G, c.3639T>G, p.L1189R
Original code   HUS11
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            08-May-2003 (Rel. 1, Created)
Date            08-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170895
RefAuthors      Perez-Caballero, D., Gonzalez-Rubio, C., Gallardo, M. E., 
RefAuthors      Vera, M., Lopez-Trascasa, M., Rodriguez de Cordoba, S., 
RefAuthors      Sanchez-Corral, P.
RefTitle        Clustering of missense mutations in the C-terminal region 
RefTitle        of factor H in atypical hemolytic uremic syndrome.
RefLoc          Am J Hum Genet 68:478-484 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125613
Feature           /change: t -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3639
Feature           /codon: ctt -> cgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1189
Feature           /change: L -> R
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Normal plasma levels of factor H 
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid; Spain
Comment         -!-mother died as a consequence of postpartum aHUS
//
ID              S1191L(1a),S1191L(1a); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0002
Systematic name Allele 1 and 2: g.125619C>T, c.3645C>T, p.S1191L
Original code   VI-4
Description     Allele 1 and 2: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            07-May-2003 (Rel. 1, Created)
Date            07-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10577907
RefAuthors      Ying, L., Katz, Y., Schlesinger, M., Carmi, R., Shalev, 
RefAuthors      H., Haider, N., Beck, G., Sheffield, V. C., Landau, D.
RefTitle        Complement factor H gene mutation associated with 
RefTitle        autosomal recessive atypical hemolytic uremic syndrome.
RefLoc          Am J Hum Genet 65:1538-1546 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9811382
RefAuthors      Ohali, M., Shalev, H., Schlesinger, M., Katz, Y., Kachko, 
RefAuthors      L., Carmi, R., Sofer, S., Landau, D.
RefTitle        Hypocomplementemic autosomal recessive hemolytic uremic 
RefTitle        syndrome with decreased factor H.
RefLoc          Pediatr Nephrol 12:619-624 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
Protein exp.    low levels of serum CFH
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms        Other clinical features: hypertension, oliguria, edema
Sex             XY
Age             2 weeks
Ethnic origin   Caucasoid; Bedouin-Arab; Israel
Parents         Consanguineous
Relative        CFHbase; H0003 
Comment         -!-In the same large Bedouin kindred were totally 11 aHUS  
Comment         patients, but only two of them were genotyped 
//
ID              S1191L(1b),S1191L(1b); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0003
Systematic name Allele 1 and 2: g.125619C>T, c.3645C>T, p.S1191L
Original code   VI-24
Description     Allele 1 and 2: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            07-May-2003 (Rel. 1, Created)
Date            07-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10577907
RefAuthors      Ying, L., Katz, Y., Schlesinger, M., Carmi, R., Shalev, 
RefAuthors      H., Haider, N., Beck, G., Sheffield, V. C., Landau, D.
RefTitle        Complement factor H gene mutation associated with 
RefTitle        autosomal recessive atypical hemolytic uremic syndrome.
RefLoc          Am J Hum Genet 65:1538-1546 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9811382
RefAuthors      Ohali, M., Shalev, H., Schlesinger, M., Katz, Y., Kachko, 
RefAuthors      L., Carmi, R., Sofer, S., Landau, D.
RefTitle        Hypocomplementemic autosomal recessive hemolytic uremic 
RefTitle        syndrome with decreased factor H.
RefLoc          Pediatr Nephrol 12:619-624 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
Protein exp.    low levels of serum CFH
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms        Other clinical features: hypertension, oliguria
Sex             XX
Age             2 weeks
Ethnic origin   Caucasoid; Bedouin-Arab; Israel
Parents         Consanguineous
Relative        CFHbase; H0002 
Comment         -!-In the same large Bedouin kindred were totally 11 aHUS  
Comment         patients, but only two of them were genotyped 
//
ID              S1191L(2a),V1197A(3a); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0075
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   I:2
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             16
Sex             XX
Family history  Inherited
Relative        CFHbase; H0076twin-son
Relative        CFHbase; H0077twin-son
Relative        CFHbase; H0078granddaughter
Relative        CFHbase; H0079grandson
Relative        CFHbase; H0080grandson
Relative        CFHbase; H0081grandson
Relative        CFHbase; H0082great_grandson
Symptoms        Infections: none
Treatment       No renal transplantation
Treatment          Outcome: Deceased
//
ID              S1191L(2b),V1197A(3b); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0076
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   II:1
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             45
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075mother
Relative        CFHbase; H0077twin-brother
Relative        CFHbase; H0078niece
Relative        CFHbase; H0079nephew
Relative        CFHbase; H0080nephew
Relative        CFHbase; H0081nephew
Relative        CFHbase; H0082grand_nephew
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Symptoms        Infections: none
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
Treatment          Outcome: Deceased
//
ID              S1191L(2c),V1197A(3c); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0077
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   II:1
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             46
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075mother
Relative        CFHbase; H0076twin-brother
Relative        CFHbase; H0078daughter
Relative        CFHbase; H0079son
Relative        CFHbase; H0080son
Relative        CFHbase; H0081nephew
Relative        CFHbase; H0082grandson
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Symptoms        Infections: none
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
Treatment          Outcome: Deceased
//
ID              S1191L(2d),V1197A(3d); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0078
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   III:4
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             19
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075grandmother
Relative        CFHbase; H0076uncle
Relative        CFHbase; H0077father
Relative        CFHbase; H0079brother
Relative        CFHbase; H0080brother
Relative        CFHbase; H0081cousin
Relative        CFHbase; H0082nephew
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms        Infections: none
Treatment       No renal transplantation
Treatment          Outcome: Deceased
//
ID              S1191L(2e),V1197A(3e); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0079
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   III:5
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             5
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075grandmother
Relative        CFHbase; H0076uncle
Relative        CFHbase; H0077father
Relative        CFHbase; H0078daughter
Relative        CFHbase; H0080brother
Relative        CFHbase; H0081cousin
Relative        CFHbase; H0082nephew
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms        Infections: none
Treatment       No renal transplantation
Treatment          Outcome: Deceased
//
ID              S1191L(2f),V1197A(3f); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0080
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   III:6
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             28
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075grandmother
Relative        CFHbase; H0076uncle
Relative        CFHbase; H0077father
Relative        CFHbase; H0078daughter
Relative        CFHbase; H0079brother
Relative        CFHbase; H0081cousin
Relative        CFHbase; H0082nephew
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms        Infections: none
Treatment       Dialysis
Treatment       No renal transplantation
Treatment          Outcome: Alive and well
//
ID              S1191L(2g),V1197A(3h); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0081
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   III:8
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             7
Sex             XY
Family history  Inherited
Relative        CFHbase; H0074grandmother
Relative        CFHbase; H0075uncle
Relative        CFHbase; H0076uncle
Relative        CFHbase; H0077cousin
Relative        CFHbase; H0078cousin
Relative        CFHbase; H0079cousin
Relative        CFHbase; H0080cousin
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Treatment          : Yes
Treatment          Outcome: Deceased
//
ID              S1191L(2h),V1197A(3h); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0082
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u, p.Ser1191Leu
Systematic name Allele 2: g.125637T>C, c.3590T>C, r.3590u>c, p.Val1197Ala
Original code   IV:1
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17076561
RefAuthors      Venables, J. P., Strain, L., Routledge, D., Bourn, D., 
RefAuthors      Powell, H. M., Warwicker, P., Diaz-Torres, M. L., Sampson, 
RefAuthors      A., Mead, P., Webb, M., Pirson, Y., Jackson, M. S., 
RefAuthors      Hughes, A., Wood, K. M., Goodship, J. A., Goodship, T. H.
RefTitle        Atypical haemolytic uraemic syndrome associated with a 
RefTitle        hybrid complement gene.
RefLoc          PLoS Med:e431 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
Age             7
Sex             XY
Family history  Inherited
Relative        CFHbase; H0075great_grandmother
Relative        CFHbase; H0076great_uncle
Relative        CFHbase; H0077grandfather
Relative        CFHbase; H0078aunt
Relative        CFHbase; H0079uncle
Relative        CFHbase; H0080uncle
Relative        CFHbase; H0081uncle
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Chronic renal failure
Symptoms        Infections: severe
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
Treatment          Outcome: Deceased
//
ID              S1191L(3a),=; standard; MUTATION; SUSHI20,
Accession       H0098
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code   Twin.1 Ref [3]
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            30-Jun-2010 (Rel. 1, Created)
Date            30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15696434
RefAuthors      Olie, K. H., Goodship, T. H., Verlaak, R., Florquin, S., 
RefAuthors      Groothoff, J. W., Strain, L., Weening, J. J., Davin, J. C.
RefTitle        Posttransplantation cytomegalovirus-induced recurrence of 
RefTitle        atypical hemolytic uremic syndrome associated with a 
RefTitle        factor H mutation: successful treatment with intensive 
RefTitle        plasma exchanges and ganciclovir.
RefLoc          Am J Kidney Dis:e12-15 (2005)
RefNumber       [2]
RefCrossRef     PUBMED; 16431247
RefAuthors      Davin, J. C., Olie, K. H., Verlaak, R., Horuz, F., 
RefAuthors      Florquin, S., Weening, J. J., Groothoff, J. W., Strain, 
RefAuthors      L., Goodship, T. H.
RefTitle        Complement factor H-associated atypical hemolytic uremic 
RefTitle        syndrome in monozygotic twins: concordant presentation, 
RefTitle        discordant response to treatment.
RefLoc          Am J Kidney Dis:e27-30 (2006)
RefNumber       [3]
RefCrossRef     PUBMED; 18483746
RefAuthors      Davin, J. C., Strain, L., Goodship, T. H.
RefTitle        Plasma therapy in atypical haemolytic uremic syndrome: 
RefTitle        lessons from a family with a factor H mutation.
RefLoc          Pediatr Nephrol:1517-1521 (2008)
RefCrossRef     PUBMED; 15696434
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             4
Sex             XX
Relative        CFHbase; H0099; twin
Relative        CFHbase; H0100; sister
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Symptoms        Other clinical features: hematomas, oliguria,
Symptoms        increased plasma creatinine level
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment       Other treatment: plasma exchange and ganciclovir
//
ID              S1191L(3b),=; standard; MUTATION; SUSHI20,
Accession       H0099
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code   Twin.2 Ref. [3]
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            30-Jun-2010 (Rel. 1, Created)
Date            30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15696434
RefAuthors      Olie, K. H., Goodship, T. H., Verlaak, R., Florquin, S., 
RefAuthors      Groothoff, J. W., Strain, L., Weening, J. J., Davin, J. C.
RefTitle        Posttransplantation cytomegalovirus-induced recurrence of 
RefTitle        atypical hemolytic uremic syndrome associated with a 
RefTitle        factor H mutation: successful treatment with intensive 
RefTitle        plasma exchanges and ganciclovir.
RefLoc          Am J Kidney Dis:e12-15 (2005)
RefNumber       [2]
RefCrossRef     PUBMED; 16431247
RefAuthors      Davin, J. C., Olie, K. H., Verlaak, R., Horuz, F., 
RefAuthors      Florquin, S., Weening, J. J., Groothoff, J. W., Strain, 
RefAuthors      L., Goodship, T. H.
RefTitle        Complement factor H-associated atypical hemolytic uremic 
RefTitle        syndrome in monozygotic twins: concordant presentation, 
RefTitle        discordant response to treatment.
RefLoc          Am J Kidney Dis:e27-30 (2006)
RefNumber       [3]
RefCrossRef     PUBMED; 18483746
RefAuthors      Davin, J. C., Strain, L., Goodship, T. H.
RefTitle        Plasma therapy in atypical haemolytic uremic syndrome: 
RefTitle        lessons from a family with a factor H mutation.
RefLoc          Pediatr Nephrol:1517-1521 (2008)
RefCrossRef     PUBMED; 15696434
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             4.5
Sex             XX
Relative        CFHbase; H0098; twin
Relative        CFHbase; H0100; sister
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms        Other clinical features: hemolysis without renal failure,
Symptoms        respiratory tract infection
Treatment       plasma exchange, steroid and antihistamine therapy
//
ID              S1191L(3c),=; standard; MUTATION; SUSHI20,
Accession       H0100
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Original code   Older sister Ref. [2]
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            30-Jun-2010 (Rel. 1, Created)
Date            30-Jun-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15300478
RefAuthors      Olie, K. H., Florquin, S., Groothoff, J. W., Verlaak, R., 
RefAuthors      Strain, L., Goodship, T. H., Weening, J. J., Davin, J. C.
RefTitle        Atypical relapse of hemolytic uremic syndrome after 
RefTitle        transplantation.
RefLoc          Pediatr Nephrol:1173-1176 (2004)
RefNumber       [2]
RefCrossRef     PUBMED; 18483746
RefAuthors      Davin, J. C., Strain, L., Goodship, T. H.
RefTitle        Plasma therapy in atypical haemolytic uremic syndrome: 
RefTitle        lessons from a family with a factor H mutation.
RefLoc          Pediatr Nephrol:1517-1521 (2008)
RefCrossRef     PUBMED; 15696434
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             3
Sex             XX
Relative        CFHbase; H0098; sister
Relative        CFHbase; H0099; sister
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Chronic renal failure
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Treatment       Peritoneal Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive
Treatment          Further information: transplantation was done
Treatment          second time
Treatment          after 6 years of the first one.
Treatment       Other treatment: plasma exchange, azathioprine,
Treatment       cyclosporine, prednisone
//
ID              S1191L(4),=; standard; MUTATION; SUSHI20,
Accession       H0104
Systematic name Allele 1: g.125619C>T, c.3572C>T, r.3572c>u,
Systematic name p.Ser1191Leu
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            01-Jul-2010 (Rel. 1, Created)
Date            01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 19005013
RefAuthors      Saland, J. M., Shneider, B. L., Bromberg, J. S., Shi, P. 
RefAuthors      A., Ward, S. C., Magid, M. S., Benchimol, C., Seikaly, M. 
RefAuthors      G., Emre, S. H., Bresin, E., Remuzzi, G.
RefTitle        Successful split liver-kidney transplant for factor H 
RefTitle        associated hemolytic uremic syndrome.
RefLoc          Clin J Am Soc Nephrol:201-206 (2009)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125619
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3645
Feature           /codon: tcg -> ttg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> L
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             0.75
Sex             XY
Parents         Non-consanguineous
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Symptoms        Other clinical features: hepatosplenomegaly
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive and well
Treatment          Further information: The weight and height of the
Treatment          patient is half of the normal for the age.
Treatment       Other treatment: plasma exchange
//
ID              S1191W(1),=; standard; MUTATION; SUSHI20
Accession       H0071
Systematic name Allele 1: g.125619C>G, c.3572C>G, r.3572c>g,
Systematic name p.Ser1191Trp
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            03-Jan-2006 (Rel. 1, Created)
Date            03-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15163532
RefAuthors      Rodriguez de Cordoba, S., Esparza-Gordillo, J., Goicoechea 
RefAuthors      de Jorge, E., Lopez-Trascasa, M., Sanchez-Corral, P.
RefTitle        The human complement factor H: functional roles, genetic 
RefTitle        variations and disease associations.
RefLoc          Mol Immunol 41:355-367 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125619
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3645
Feature           /codon: tcg -> tgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1191
Feature           /change: S -> W
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
//
ID              G1194D(1a),=; standard; MUTATION; SUSHI20
Accession       H0048
Systematic name Allele 1: g.125628G>A, c.3581G>A, r.3581g>a,
Systematic name p.Gly1194Asp
Original code   F169#130
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125628
Feature           /change: g -> a
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3654
Feature           /codon: ggt -> gat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1194
Feature           /change: G -> D
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Relative        CFHbase; H0049;
//
ID              G1194D(1b),=; standard; MUTATION; SUSHI20
Accession       H0049
Systematic name Allele 1: g.125628G>A, c.3581G>A, r.3581g>a,
Systematic name p.Gly1194Asp
Original code   F170#130
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125628
Feature           /change: g -> a
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3654
Feature           /codon: ggt -> gat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1194
Feature           /change: G -> D
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Relative        CFHbase; H0048;
//
ID              V1197A(1),=; standard; MUTATION; SUSHI20
Accession       H0050
Systematic name Allele 1: g.125637T>C, c.3590T>C, r.3590u>c,
Systematic name p.Val1197Ala
Original code   052(Ref[2])
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
RefNumber       [2]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              V1197A(2),=; standard; MUTATION; SUSHI20
Accession       H0051
Systematic name Allele 1: g.125637T>C, c.3590T>C, r.3590u>c,
Systematic name p.Val1197Ala
Original code   R062#056
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125637
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3663
Feature           /codon: gtt -> gct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1197
Feature           /change: V -> A
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              E1198A(1),=; standard; MUTATION; SUSHI20
Accession       H0052
Systematic name Allele 1: g.125640A>C, c.3593A>C, r.3593a>c,
Systematic name p.Glu1198Ala
Original code   R088#152
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125640
Feature           /change: a -> c
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3666
Feature           /codon: gaa -> gca; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1198
Feature           /change: E -> A
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              F1199S(1),=; standard; MUTATION; SUSHI20
Accession       H0038
Systematic name Allele 1: g.125643T>C, c.3596T>C, r.3596u>c,
Systematic name p.Phe1199Ser
Original code   Patient 13
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            27-Dec-2004 (Rel. 1, Created)
Date            27-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14978182
RefAuthors      Dragon-Durey, M. A., Fremeaux-Bacchi, V., Loirat, C., 
RefAuthors      Blouin, J., Niaudet, P., Deschenes, G., Coppo, P., Herman 
RefAuthors      Fridman, W., Weiss, L.
RefTitle        Heterozygous and homozygous factor h deficiencies 
RefTitle        associated with hemolytic uremic syndrome or 
RefTitle        membranoproliferative glomerulonephritis: report and 
RefTitle        genetic analysis of 16 cases.
RefLoc          J Am Soc Nephrol 15:787-795 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125643
Feature           /change: t -> c
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3669
Feature           /codon: ttt -> tct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1199
Feature           /change: F -> S
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XX
Ethnic origin   Caucasoid
//
ID              R1210C(1a),=; standard; MUTATION; SUSHI20
Accession       H0013
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code   F106#24
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Sex             XY
Age             3
Ethnic origin   Caucasoid; Italy
Parents         Non-consanguineous
Relative        CFHbase; H0014; brother
Comment         -!-Unaffected father carries the same mutation
//
ID              R1210C(1b),=; standard; MUTATION; SUSHI20
Accession       H0014
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code   F108#24
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Sex             XY
Age             3,5
Ethnic origin   Caucasoid; Italy
Parents         Non-consanguineous
Relative        CFHbase; H0013; brother
Comment         -!-Unaffected father carries the same mutation
//
ID              R1210C(2),=; standard; MUTATION; SUSHI20
Accession       H0015
Systematic name Allele 1: g.125675C>T, c.3701C>T, p.R1210C
Original code   R16
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Serum factor H levels within the normal range
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Chronic renal failure
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          Outcome: Alive and bad
Treatment          Further information: Graft function deteriorated 
Treatment          acutely on day 7 posttransplantation, and allograft 
Treatment          biopsy showed recurrent HUS. A partial improvement was 
Treatment          achieved with plasma exchange, but this was not 
Treatment          sustained and the graft failed 3 mo later.
Sex             XX
Age             31
Ethnic origin   Caucasoid; Italy
Parents         Non-consanguineous
Comment         -!-The mutation was also found in the father and two of 
Comment         -!-five healthy siblings
//
ID              R1210C(3),=; standard; MUTATION; SUSHI20
Accession       H0053
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Original code   S013#069
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            28-Dec-2004 (Rel. 1, Created)
Date            28-Dec-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14583443
RefAuthors      Caprioli, J., Castelletti, F., Bucchioni, S., Bettinaglio, 
RefAuthors      P., Bresin, E., Pianetti, G., Gamba, S., Brioschi, S., 
RefAuthors      Daina, E., Remuzzi, G., Noris, M.
RefTitle        Complement factor H mutations and gene polymorphisms in 
RefTitle        haemolytic uraemic syndrome: the C-257T, the A2089G and 
RefTitle        the G2881T polymorphisms are strongly associated with the 
RefTitle        disease.
RefLoc          Hum Mol Genet 12:3385-3395 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
//
ID              R1210C(4),=; standard; MUTATION; SUSHI20
Accession       H0065
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Original code   Case 12
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              R1210C(6),=; standard; MUTATION; SUSHI20,
Accession       H0105
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            01-Jul-2010 (Rel. 1, Created)
Date            01-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 19633317
RefAuthors      Hirt-Minkowski, P., Schaub, S., Mayr, M., Schifferli, J. 
RefAuthors      A., Dickenmann, M., Fremeaux-Bacchi, V., Steiger, J.
RefTitle        Haemolytic uraemic syndrome caused by factor H mutation: 
RefTitle        is single kidney transplantation under intensive 
RefTitle        plasmatherapy an option?
RefLoc          Nephrol Dial Transplant:3548-3551 (2009)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             23
Sex             XY
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Symptoms        Other clinical features: upper respiratory tract infection,
Symptoms        fever, nausea, asthenia
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment       Other treatment: plasma exchange
//
ID              R1210C(7),=; standard; MUTATION; SUSHI20,
Accession       H0106
Systematic name Allele 1: g.125675C>T, c.3628C>T, r.3628c>u,
Systematic name p.Arg1210Cys
Description     Allele 1: A point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20534299
RefAuthors      Albertazzi, V., Bonucchi, D., De Amicis, S., Americo, C., 
RefAuthors      Ghiandai, G., Cappelli, G.
RefTitle        A favorable 3-year outcome of kidney transplantation in 
RefTitle        atypical hemolytic uremic syndrome associated with a 
RefTitle        factor H mutation: case report.
RefLoc          Transplant Proc:1352-1354 (2010)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125675
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3701
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1210
Feature           /change: R -> C
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no mutation
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no mutation
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no mutation
Age             40
Sex             XX
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Acute renal failure
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment       Other treatment: plasmapheresis
//
ID              R1215G(1),=; standard; MUTATION; SUSHI20
Accession       H0018
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code   Patient 3
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            12-May-2003 (Rel. 1, Created)
Date            12-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11170896
RefAuthors      Richards, A., Buddles, M. R., Donne, R. L., Kaplan, B. S., 
RefAuthors      Kirk, E., Venning, M. C., Tielemans, C. L., Goodship, J. 
RefAuthors      A., Goodship, T. H.
RefTitle        Factor H mutations in hemolytic uremic syndrome cluster in 
RefTitle        exons 18-20, a domain important for host cell recognition.
RefLoc          Am J Hum Genet 68:485-490 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125690
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3716
Feature           /codon: cga -> gga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> G
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Protein exp.    Normal C3 and FH levels
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Sex             XX
Ethnic origin   Caucasoid; United Kingdom
Comment         -!-inherited from her father, who is unaffected
//
ID              R1215G(2a),=; standard; MUTATION; SUSHI20
Accession       H0020
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code   Family 2a; III
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9551389
RefAuthors      Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y., 
RefAuthors      Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle        Genetic studies into inherited and sporadic hemolytic 
RefTitle        uremic syndrome.
RefLoc          Kidney Int 53:836-844 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125690
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3716
Feature           /codon: cga -> gga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> G
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XY
Relative        CFHbase; H0021; brother
Relative        CFHbase; H0022; nephew
Comment         -!-It is likely that this family (2a) and family 2b 
Comment         -!-(accession H0023) are related to each other
//
ID              R1215G(2b),=; standard; MUTATION; SUSHI20
Accession       H0021
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code   Family 2a; III:16
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9551389
RefAuthors      Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y., 
RefAuthors      Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle        Genetic studies into inherited and sporadic hemolytic 
RefTitle        uremic syndrome.
RefLoc          Kidney Int 53:836-844 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125690
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3716
Feature           /codon: cga -> gga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> G
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XY
Relative        CFHbase; H0020; brother
Relative        CFHbase; H0022; daughter
Comment         -!-It is likely that this family (2a) and family 2b 
Comment         -!-(accession H0023) are related to each other
//
ID              R1215G(2c),=; standard; MUTATION; SUSHI20
Accession       H0022
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code   Family 2a; IV:12
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9551389
RefAuthors      Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y., 
RefAuthors      Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle        Genetic studies into inherited and sporadic hemolytic 
RefTitle        uremic syndrome.
RefLoc          Kidney Int 53:836-844 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125690
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3716
Feature           /codon: cga -> gga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> G
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XX
Relative        CFHbase; H0020; uncle
Relative        CFHbase; H0021; father
Comment         -!-It is likely that this family (2a) and family 2b 
Comment         -!-(accession H0023) are related to each other
//
ID              R1215G(3),=; standard; MUTATION; SUSHI20
Accession       H0023
Systematic name Allele 1: g.125690C>G, c.3716C>G, p.R1215G
Original code   Family 2b; IV:2
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            13-May-2003 (Rel. 1, Created)
Date            13-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9551389
RefAuthors      Warwicker, P., Goodship, T. H., Donne, R. L., Pirson, Y., 
RefAuthors      Nicholls, A., Ward, R. M., Turnpenny, P., Goodship, J. A.
RefTitle        Genetic studies into inherited and sporadic hemolytic 
RefTitle        uremic syndrome.
RefLoc          Kidney Int 53:836-844 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125690
Feature           /change: c -> g
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3716
Feature           /codon: cga -> gga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> G
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Sex             XX
Comment         -!-It is likely that this family 2b and family 2a 
Comment         -!-(accessions H0020, H0021 and H0022) are related to each 
Comment         -!-other
//
ID              R1215Q(1),=; standard; MUTATION; SUSHI20
Accession       H0010
Systematic name Allele 1: g.125691G>A, c.3717G>A, p.R1215Q
Original code   F34#1
Description     Allele 1: point mutation in the exon 22 leading to 
Description     an amino acid change in the SUSHI20 domain
Date            09-May-2003 (Rel. 1, Created)
Date            09-May-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11158219
RefAuthors      Caprioli, J., Bettinaglio, P., Zipfel, P. F., Amadei, B., 
RefAuthors      Daina, E., Gamba, S., Skerka, C., Marziliano, N., Remuzzi, 
RefAuthors      G., Noris, M.
RefTitle        The molecular basis of familial hemolytic uremic syndrome: 
RefTitle        mutation analysis of factor H gene reveals a hot spot in 
RefTitle        short consensus repeat 20.
RefLoc          J Am Soc Nephrol 12:297-307 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125691
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3717
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> Q
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Symptoms           Hemolytic anemia
Symptoms           Thrombocytopenia
Symptoms        Other clinical features: upper respiratory track infection
Sex             XY
Age             1
Ethnic origin   Caucasoid; Italy
//
ID              R1215Q(2a),R1215R(1a); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0073
Systematic name Allele 1: g.125691G>A, c.3644G>A, r.3644g>a, p.Arg1215Gln
Systematic name Allele 2: g.125691G>G, c.3644G>G, r.3644g>g, p.Arg1215Arg
Original code   patient 1
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17973958
RefAuthors      Jalanko, H., Peltonen, S., Koskinen, A., Puntila, J., 
RefAuthors      Isoniemi, H., Holmberg, C., Pinomaki, A., Armstrong, E., 
RefAuthors      Koivusalo, A., Tukiainen, E., Makisalo, H., Saland, J., 
RefAuthors      Remuzzi, G., de Cordoba, S., Lassila, R., Meri, S., 
RefAuthors      Jokiranta, T. S.
RefTitle        Successful liver-kidney transplantation in two children 
RefTitle        with aHUS caused by a mutation in complement factor H.
RefLoc          Am J Transplant:216-221 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125691
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3717
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> Q
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125691
Feature           /change: g -> g
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3717
Feature           /codon: cga -> cga; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> R
Feature           /domain: SUSHI20
Protein level   Increased
Activity        Reduced
Age             1
Sex             XY
Ethnic origin   Caucasoid; Finland
Family history  Inherited
Relative        CFHbase; H0074aunt
Symptoms        Hemolytic and renal abnormalities
Symptoms           Acute renal failure
Symptoms           Proteinuria
Symptoms        Infections: mild
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
Treatment          Outcome: Alive and well
Treatment          Further information: Combined transplantation of kidney and
Treatment          liver.
//
ID              R1215Q(2b),R1215R(1b); standard; MUTATION; SUSHI20,SUSHI20
Accession       H0074
Systematic name Allele 1: g.125691G>A, c.3644G>A, r.3644g>a, p.Arg1215Gln
Systematic name Allele 2: g.125691G>G, c.3644G>G, r.3644g>g, p.Arg1215Arg
Original code   patient 2
Description     Allele 1: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Description     Allele 2: A point mutation in the exon 22 leading to an
Description     amino acid change in the SUSHI20 domain
Date            28-Apr-2008 (Rel. 1, Created)
Date            28-Apr-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17973958
RefAuthors      Jalanko, H., Peltonen, S., Koskinen, A., Puntila, J., 
RefAuthors      Isoniemi, H., Holmberg, C., Pinomaki, A., Armstrong, E., 
RefAuthors      Koivusalo, A., Tukiainen, E., Makisalo, H., Saland, J., 
RefAuthors      Remuzzi, G., de Cordoba, S., Lassila, R., Meri, S., 
RefAuthors      Jokiranta, T. S.
RefTitle        Successful liver-kidney transplantation in two children 
RefTitle        with aHUS caused by a mutation in complement factor H.
RefLoc          Am J Transplant:216-221 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125691
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3717
Feature           /codon: cga -> caa; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> Q
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 125691
Feature           /change: g -> g
Feature           /genomic_region: exon; 22
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 3717
Feature           /codon: cga -> cga; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 1215
Feature           /change: R -> R
Feature           /domain: SUSHI20
Protein level   Increased
Activity        Reduced
Age             16
Sex             XX
Ethnic origin   Caucasoid; Finland
Family history  Inherited
Relative        CFHbase; H0073nephew
Symptoms        Hemolytic and renal abnormalities
Symptoms              Typical HUS, associated with diarrhea
Symptoms           Proteinuria
Symptoms        Infections: none
Treatment       Dialysis
Treatment       Renal transplantation: Yes
Treatment          : Yes
Treatment          Outcome: Alive and well
Treatment          Further information: Combined transplantation of kidney and
Treatment          liver.
//
ID              #T1216-1(1),=; standard; MUTATION; SUSHI20
Accession       H0066
Systematic name Allele 1: g.125693_125695delACA, c.3646_3648delACA,
Systematic name r.3646_3648delaca, p.Thr1216del
Original code   Case 13
Description     Allele 1: an inframe deletion in the exon 22 leading
Description     to an amino acid change in the SUSHI20 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 125693..125695
Feature           /change: -aca
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0040: 3719..3721
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1216
Feature           /change: -T
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              P1226S(1),=; standard; MUTATION; SUSHI20
Accession       H0067
Systematic name Allele 1: g.125723C>T, c.3676C>T, r.3676c>u,
Systematic name p.Pro1226Ser
Original code   Case 14
Description     Allele 1: a point mutation in the exon 22 leading to
Description     an amino acid change in the SUSHI20 domain
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 125723
Feature           /change: c -> t
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0040: 3749
Feature           /codon: cca -> tca; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1226
Feature           /change: P -> S
Feature           /domain: SUSHI20
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              #X1232X1269(1),=; standard; MUTATION;
Accession       H0068
Systematic name Allele 1: g.125742_125745delAGAA, c.3695_3698delAGAA,
Systematic name r.3695_3698delagaa, p.1232fsX37
Original code   Case 15
Description     Allele 1: a terminator deletion mutation in the exon
Description     22 leading to a elongation of the amino acid sequence
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0040: 125742..125745
Feature           /change: -agaa
Feature           /genomic_region: exon; 22
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: terminator; frameshift
Feature           /loc: IDRefSeq: C0040: 3768..3771
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; elongation
Feature           /loc: UniProt: P08603; CFAH_HUMAN: 1232..1233
Feature           /change: XN -> FNHKVHTFIQ NFSIKSVLNF IFYVLFYSFL FIRKILDX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
ID              Intron 3(4),Intron 3(4); standard; MUTATION;
Accession       H0096
Systematic name Allele 1 and 2: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Original code   D
Description     Allele 1 and 2: A point mutation in the intron 3 leading to
Description     an amino acid change
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Age             54
Sex             XY
Family history  Inherited
Treatment          
//
ID              Intron 3(5),R567G(1); standard; MUTATION;
Accession       H0097
Systematic name Allele 1: g.IVS3+6T>G, c.350+6T>G, r.350+6u>g
Systematic name Allele 2: g.103553A>G, c.1699A>G, r.1699a>g, p.Arg567Gly
Original code   E
Description     Allele 1: A point mutation in the intron 3 leading to an
Description     amino acid change
Description     Allele 2: A point mutation in the exon 12 leading to an
Description     amino acid change
Date            23-May-2008 (Rel. 1, Created)
Date            23-May-2008 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18252232
RefAuthors      Boon, C. J., Klevering, B. J., Hoyng, C. B., Zonneveld-
RefAuthors      Vrieling, M. N., Nabuurs, S. B., Blokland, E., Cremers, F. 
RefAuthors      P., den Hollander, A. I.
RefTitle        Basal laminar drusen caused by compound heterozygous 
RefTitle        variants in the CFH gene.
RefLoc          Am J Hum Genet:516-523 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: EMBL: AL049744: 52398
Feature           /change: t -> g
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: +6
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: EMBL: AL049744: 103553
Feature           /change: a -> g
Feature           /genomic_region: exon; 12
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: EMBL: Y00716; GI:116131; : 1772
Feature           /codon: aga -> gga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: SWISSPROT: P08603; CFAH_HUMAN: 567
Feature           /change: R -> G
Age             54
Sex             XX
Family history  Inherited
Treatment          
//
ID              Intron 21(1),=; standard; MUTATION;
Accession       H0064
Systematic name Allele 1: g.IVS21+1G>A, c.3566+1G>A, r.3566+1g>a,
Original code   Case 10
Description     Allele 1: a point mutation in the intron 21 leading
Description     to aberrant splicing
Date            30-Dec-2005 (Rel. 1, Created)
Date            30-Dec-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12960213
RefAuthors      Neumann, H. P., Salzmann, M., Bohnert-Iwan, B., 
RefAuthors      Mannuelian, T., Skerka, C., Lenk, D., Bender, B. U., 
RefAuthors      Cybulla, M., Riegler, P., Konigsrainer, A., Neyer, U., 
RefAuthors      Bock, A., Widmer, U., Male, D. A., Franke, G., Zipfel, P. 
RefAuthors      F.
RefTitle        Haemolytic uraemic syndrome and mutations of the factor H 
RefTitle        gene: a registry-based study of german speaking countries.
RefLoc          J Med Genet 40:676-681 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0040: 124430
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: intron; 21
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: +1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: no change
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: no change
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: no change
Symptoms        Hemolytic and renal abnormalities
Symptoms           Hemolytic uremic syndrome
Symptoms              Atypical HUS, not associated with diarrhea
Ethnic origin   Caucasoid
Comment         -!-Sporadic. 
//
//