Database CTSCbase
Version 1.0
File ctscpub.html
Date 08-Mar-2012
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/CTSCbase/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF154.html
Gene CTSC
Disease Papillon-Lefevre syndrome
OMIM 602365
GDB 642234
Sequence IDRefSeq:D0022; IDRefSeq:C0022; UniProt:P53634
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID #L7X64(1),#L7X64(1); standard; MUTATION;
Accession C0136
Systematic name Allele 1 and 2: g.1119delG, c.21delG, r.21delg, p.Leu7fsX58
Description Allele 1 and 2: A frame shift deletion mutation in the exon
Description 1 leading to a premature stop codon
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20236208
RefAuthors Kurban, M., Cheng, T., Wajid, M., Kiuru, M., Shimomura,
RefAuthors Y., Christiano, A. M.
RefTitle A novel mutation in the cathepsin C gene in a pakistani
RefTitle family with papillon-lefevre syndrome.
RefLoc J Eur Acad Dermatol Venereol:L (2010)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 1119
Feature /change: -g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 119
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 7
Feature /change: L ->
Feature /change: FCSPPSCCFS PATAPCAATH LPTAPILTCW APGSSRWAPA
Feature /change: VPSAMSTARL WDHKKKKX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 1119
Feature /change: -g
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 119
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 7
Feature /change: L ->
Feature /change: FCSPPSCCFS PATAPCAATH LPTAPILTCW APGSSRWAPA
Feature /change: VPSAMSTARL WDHKKKKX
Diagnosis Papillon-Lefevre syndrome
Symptoms Thickening of skin in palms and soles, two episodes of
Symptoms severe gingivitis, postaxial polydactyly, loss of teeth
Age 35
Sex XY
Ethnic origin Pakistan
Parents Consanguineous
Comment Patient's brother and sister reported the same features.
//
ID C24X(1a),C24X(1a); standard; MUTATION;
Accession C0056
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code F1
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Morocco
Parents Consanguineous
Relative CTSCbase; C0057 brother
Relative CTSCbase; C0058 sister
Relative CTSCbase; C0059 sister
//
ID C24X(1b),C24X(1b); standard; MUTATION;
Accession C0057
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code F1
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Morocco
Parents Consanguineous
Relative CTSCbase; C0056 brother
Relative CTSCbase; C0058 sister
Relative CTSCbase; C0059 sister
//
ID C24X(1c),C24X(1c); standard; MUTATION;
Accession C0058
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code F1
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Morocco
Parents Consanguineous
Relative CTSCbase; C0056 brother
Relative CTSCbase; C0057 brother
Relative CTSCbase; C0059 sister
//
ID C24X(1d),C24X(1d); standard; MUTATION;
Accession C0059
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code F1
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Morocco
Parents Consanguineous
Relative CTSCbase; C0056 brother
Relative CTSCbase; C0057 brother
Relative CTSCbase; C0058 sister
//
ID C24X(2),C24X(2); standard; MUTATION;
Accession C0093
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code Family 2; II-11
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 08-Feb-2005 (Rel. 1, Created)
Date 08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12809647
RefAuthors Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle A genetic study of cathepsin C gene in two families with
RefTitle papillon-lefèvre syndrome.
RefLoc Mol Genet Metab 79:146-148 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Spain (Salamanca)
Parents Consanguineous
Family history Inherited
//
ID G139R(2a),C24X(3a); standard; MUTATION;
Accession C0098
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code Family 12; II-2
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Family history Inherited
Relative CTSCbase; C0099 brother
Relative CTSCbase; C0100 sister
Relative CTSCbase; C0101 son
//
ID G139R(2b),C24X(3b); standard; MUTATION;
Accession C0099
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code Family 12; II-3
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Family history Inherited
Relative CTSCbase; C0098 sister
Relative CTSCbase; C0100 sister
Relative CTSCbase; C0101 nephew
//
ID G139R(2c),C24X(3c); standard; MUTATION;
Accession C0100
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code Family 12; II-6
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1170
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 170
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 24
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Family history Inherited
Relative CTSCbase; C0098 sister
Relative CTSCbase; C0099 brother
Relative CTSCbase; C0101 nephew
//
ID C30X(1),C30X(1); standard; MUTATION;
Accession C0112
Systematic name Allele 1 and 2: g.1188C>A, c.90C>A, r.90c>a, p.Cys30X
Original code 5-year-old Thai male
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 10-Aug-2005 (Rel. 1, Created)
Date 10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15857086
RefAuthors Nitta, H., Wara-Aswapati, N., Lertsirivorakul, J.,
RefAuthors Nakamura, T., Yamamoto, M., Izumi, Y., Nakamura, T.,
RefAuthors Ishikawa, I.
RefTitle A novel mutation of the cathepsin C gene in a thai family
RefTitle with papillon-lefevre syndrome.
RefLoc J Periodontol 76:492-496 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1188
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 188
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 30
Feature /change: C -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1188
Feature /change: c -> a
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 188
Feature /codon: tgc -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 30
Feature /change: C -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Mongoloid; Thailand
Family history Inherited
//
ID Y32X(1),H127P(1); standard; MUTATION;
Accession C0069
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.26278A>C, c.380A>C, r.380a>c, p.His127Pro
Original code F7
Description Allele 1: a point mutation in the exon 1 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 3 leading to an
Description amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1194
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 194
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 32
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26278
Feature /change: a -> c
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 478
Feature /codon: cat -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 127
Feature /change: H -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; France
Parents Non-consanguineous
//
ID Y32X(2),Y32X(2); standard; MUTATION;
Accession C0074
Systematic name Allele 1 and 2: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Original code Family 1; II:3
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12112662
RefAuthors Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J.,
RefAuthors Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle Biochemical and mutational analyses of the cathepsin c
RefTitle gene (CTSC) in three north american families with papillon
RefTitle lefèvre syndrome.
RefLoc Hum Mutat 20:75 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1194
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 194
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 32
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1194
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 194
Feature /codon: tat -> tag; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 32
Feature /change: Y -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Mexico
Family history Inherited
//
ID Y32X(3),R272P(5); standard; MUTATION;
Accession C0075
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code Family 2; II:1
Description Allele 1: a point mutation in the exon 1 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 6 leading to an
Description amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12112662
RefAuthors Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J.,
RefAuthors Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle Biochemical and mutational analyses of the cathepsin c
RefTitle gene (CTSC) in three north american families with papillon
RefTitle lefèvre syndrome.
RefLoc Hum Mutat 20:75 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1194
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 194
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 32
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; North Carolina
Family history Inherited
//
ID Y32X(4),R272P(6); standard; MUTATION;
Accession C0089
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code Pt2
Description Allele 1: a point mutation in the exon 1 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 6 leading to an
Description amino acid change
Date 08-Feb-2005 (Rel. 1, Created)
Date 08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15585850
RefAuthors Pham, C. T., Ivanovich, J. L., Raptis, S. Z., Zehnbauer,
RefAuthors B., Ley, T. J.
RefTitle Papillon-lefevre syndrome: correlating the molecular,
RefTitle cellular, and clinical consequences of cathepsin
RefTitle c/dipeptidyl peptidase I deficiency in humans.
RefLoc J Immunol 173:7277-7281 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1194
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 194
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 32
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; North America
Parents Non-consanguineous
//
ID #T38X63(1),S284N(1); standard; MUTATION;
Accession C0124
Systematic name Allele 1: g.1211_1214delCCTG, c.113_116delCCTG,
Systematic name r.113_116delccug, p.Thr38fsX26
Systematic name Allele 2: g.42600G>A, c.851G>A, r.851g>a, p.Ser284Asn
Original code Patient 2
Description Allele 1: A frame shift deletion mutation in the exon 1
Description leading to a premature stop codon
Description Allele 2: A point mutation in the exon 6 leading to an
Description amino acid change
Date 27-Sep-2007 (Rel. 1, Created)
Date 27-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17652201
RefAuthors Yang, Y., Bai, X., Liu, H., Li, L., Cao, C., Ge, L.
RefTitle Novel mutations of cathepsin C gene in two chinese
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Dent Res:735-738 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 1211..1214
Feature /change: -cctg
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 211..214
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 38..39
Feature /change: TW -> RSSRWAPAVP SAMSTARLWD HKKKKX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42600
Feature /change: g -> a
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 949
Feature /codon: agc -> aac; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 284
Feature /change: S -> N
Diagnosis Papillon-Lefevre syndrome
Symptoms Early-onset periodontitis and severe, extensive
Symptoms hyperceratotic lesions, involving knuckles, knees,
Symptoms buttocks, and rump, in addition to palmoplantar
Symptoms hyperceratosis
Sex XY
Ethnic origin Mongoloid; China
Parents Non-consanguineous
Family history Inherited
//
ID W39S(1a),W39S(1a); standard; MUTATION;
Accession C0048
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code Family 1; I-2
Description Allele 1 and 2: a point mutation in the exon 1 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Puerto Rico
Parents Consanguineous
Relative CTSCbase; C0049 sister
Relative CTSCbase; C0050 sister
Relative CTSCbase; C0051 brother
//
ID W39S(1b),W39S(1b); standard; MUTATION;
Accession C0049
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code Family 1; I-3
Description Allele 1 and 2: a point mutation in the exon 1 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Puerto Rico
Parents Consanguineous
Relative CTSCbase; C0048 sister
Relative CTSCbase; C0050 sister
Relative CTSCbase; C0051 brother
//
ID W39S(1c),W39S(1c); standard; MUTATION;
Accession C0050
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code Family 1; I-4
Description Allele 1 and 2: a point mutation in the exon 1 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Puerto Rico
Parents Consanguineous
Relative CTSCbase; C0048 sister
Relative CTSCbase; C0049 sister
Relative CTSCbase; C0051 brother
//
ID W39S(1d),W39S(1d); standard; MUTATION;
Accession C0051
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code Family 1; I-5
Description Allele 1 and 2: a point mutation in the exon 1 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1214
Feature /change: g -> c
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 214
Feature /codon: tgg -> tcg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 39
Feature /change: W -> S
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Puerto Rico
Parents Consanguineous
Relative CTSCbase; C0048 sister
Relative CTSCbase; C0049 sister
Relative CTSCbase; C0050 sister
//
ID Q49X(1a),Q49X(1a); standard; MUTATION;
Accession C0084
Systematic name Allele 1 and 2: g.1243C>T, c.145C>T, r.145c>u, p.Gln49X
Original code IISC-PLS1; III-1
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 07-Feb-2005 (Rel. 1, Created)
Date 07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12857359
RefAuthors Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P.,
RefAuthors Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle Mutation analysis of the cathepsin C gene in indian
RefTitle families with papillon-lefèvre syndrome.
RefLoc BMC Med Genet 4:5 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1243
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 243
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 49
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1243
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 243
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 49
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Family history Inherited
Relative CTSCbase; C0085 sister
//
ID Q49X(1b),Q49X(1b); standard; MUTATION;
Accession C0085
Systematic name Allele 1 and 2: g.1243C>T, c.145C>T, r.145c>u, p.Gln49X
Original code IISC-PLS1; III-2
Description Allele 1 and 2: a point mutation in the exon 1 leading to a
Description premature stop codon
Date 07-Feb-2005 (Rel. 1, Created)
Date 07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12857359
RefAuthors Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P.,
RefAuthors Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle Mutation analysis of the cathepsin C gene in indian
RefTitle families with papillon-lefèvre syndrome.
RefLoc BMC Med Genet 4:5 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1243
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 243
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 49
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 1243
Feature /change: c -> t
Feature /genomic_region: exon; 1
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 243
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 49
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Family history Inherited
Relative CTSCbase; C0084 brother
//
ID #Y67-8(1),T153I(1); standard; MUTATION;
Accession C0034
Systematic name Allele 1: g.3715_3738delTACCTTCAGAAGCTGGATACAGCA,
Systematic name c.199_222delTACCTTCAGAAGCTGGATACAGCA,
Systematic name r.199_222deluaccuucagaagcuggauacagca, p.Tyr67_Tyr75del
Systematic name Allele 2: g.26356C>T, c.458C>T, r.458c>u, p.Thr153Ile
Description Allele 1: an inframe deletion in the exon 2 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 3 leading to an
Description amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 3715..3738
Feature /change: -taccttcaga agctggatac agca
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 297..320
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 67..74
Feature /change: -YLQKLDTA
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26356
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 556
Feature /codon: aca -> ata; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 153
Feature /change: T -> I
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Scotland
//
ID Q69X(1a),Q69X(1a); standard; MUTATION;
Accession C0086
Systematic name Allele 1 and 2: g.3721C>T, c.205C>T, r.205c>u, p.Gln69X
Original code IISC-PLS2; IV-3
Description Allele 1 and 2: a point mutation in the exon 2 leading to a
Description premature stop codon
Date 07-Feb-2005 (Rel. 1, Created)
Date 07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12857359
RefAuthors Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P.,
RefAuthors Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle Mutation analysis of the cathepsin C gene in indian
RefTitle families with papillon-lefèvre syndrome.
RefLoc BMC Med Genet 4:5 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 3721
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 303
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 69
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 3721
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 303
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 69
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0087 brother
//
ID Q69X(1b),Q69X(1b); standard; MUTATION;
Accession C0087
Systematic name Allele 1 and 2: g.3721C>T, c.205C>T, r.205c>u, p.Gln69X
Original code IISC-PLS2; IV-4
Description Allele 1 and 2: a point mutation in the exon 2 leading to a
Description premature stop codon
Date 07-Feb-2005 (Rel. 1, Created)
Date 07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12857359
RefAuthors Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P.,
RefAuthors Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle Mutation analysis of the cathepsin C gene in indian
RefTitle families with papillon-lefèvre syndrome.
RefLoc BMC Med Genet 4:5 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 3721
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 303
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 69
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 3721
Feature /change: c -> t
Feature /genomic_region: exon; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 303
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 69
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; India
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0086 sister
//
ID K108X(1),#S146X175(1); standard; MUTATION;
Accession C0127
Systematic name Allele 1: g.26220A>T, c.322A>T, r.322a>u, p.Lys108X
Systematic name Allele 2: g.26334delT, c.436delT, r.436delu, p.Ser146fsX30
Description Allele 1: A point mutation in the exon 3 leading to a
Description premature stop codon
Description Allele 2: A frame shift deletion mutation in the exon 3
Description leading to a premature stop codon
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26220
Feature /change: a -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 420
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 108
Feature /change: K -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 26334
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 534
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 146
Feature /change: S -> LRMCMSTQHT LRILRKSILI GSTSMITTLX
Diagnosis Papillon-Lefevre syndrome
Symptoms Agressive periodontitis
Ethnic origin Germany
Parents Non-consanguineous
//
ID K108X(2),Y168X(1); standard; MUTATION;
Accession C0137
Systematic name Allele 1: g.26220A>T, c.322A>T, r.322a>u, p.Lys108X
Systematic name Allele 2: g.29471C>G, c.504C>G, r.504c>g, p.Tyr168X
Description Allele 1: A point mutation in the exon 3 leading to a
Description premature stop codon
Description Allele 2: A point mutation in the exon 4 leading to a
Description premature stop codon
Date 13-Feb-2012 (Rel. 1, Created)
Date 13-Feb-2012 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (13-Feb-2012) to CTSCbase.
RefLoc Juan-Manuel Morillo-VelAnzquez; Department of
RefLoc Periodontology, Facultad de Odontologia, Lund University
RefLoc Sevilla, c/Avicena s/n, 41009 Sevilla, Spain; e-mail
RefLoc juanm.morillo@gmail.com
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26220
Feature /change: a -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 420
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 108
Feature /change: K -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29471
Feature /change: c -> g
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 602
Feature /codon: tac -> tag; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 168
Feature /change: Y -> X
Diagnosis Papillon-Lefevre syndrome
Symptoms The proband in this family was a 3 years-old boy with
Symptoms periodontal features in primary dentition and
Symptoms hyperkeratosis in the palmoplantar region and on his
Symptoms elbows. He also had a history of skin abscesses.
Age 3
Sex XY
Ethnic origin Caucasoid; Italy
Parents Non-consanguineous
Family history Inherited
Relative His father and brother were healthy. His mother showed mild
Relative hyperkeratosis in her palms with no signs of periodontitis.
Comment Both CTSC mutations are c322A>T (K108X) (420 in this
Comment website) and c504C>G (Y168X) (602 in this website),
Comment numbered according to reference cDNA sequence NM_001814.4
Comment and reference protein sequence NP_001805. One of these
Comment (c504C>G) is a novel mutation.
//
ID #T189X199(2),#T189X199(2); standard; MUTATION;
Accession C0128
Systematic name Allele 1 and 2: g.29533_29539delCATACAT,
Systematic name c.566_572delCATACAT, r.566_572delcauacau, p.Thr189fsX11
Description Allele 1 and 2: A frame shift deletion mutation in the exon
Description 4 leading to a premature stop codon
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29533..29539
Feature /change: -catacat
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature /change: TYM -> RNMRLLPWEI X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29533..29539
Feature /change: -catacat
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature /change: TYM -> RNMRLLPWEI X
Diagnosis Papillon-Lefevre syndrome
Symptoms Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms premature teeth loss
Ethnic origin Germany
Parents Consanguineous
//
ID #T189X199(3),R210X(3); standard; MUTATION;
Accession C0129
Systematic name Allele 1: g.29533_29539delCATACAT, c.566_572delCATACAT,
Systematic name r.566_572delcauacau, p.Thr189fsX11
Systematic name Allele 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Description Allele 1: A frame shift deletion mutation in the exon 4
Description leading to a premature stop codon
Description Allele 2: A point mutation in the exon 4 leading to a
Description premature stop codon
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29533..29539
Feature /change: -catacat
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature /change: TYM -> RNMRLLPWEI X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 726
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
Diagnosis Papillon-Lefevre syndrome
Symptoms palmoplantar hyperkeratosis, aggressive periodontitis
Ethnic origin Russia
//
ID @A253X282(1),@A253X282(1); standard; MUTATION;
Accession C0126
Systematic name Allele 1 and 2: g.38241G>A, c.756_757ins130,
Systematic name r.756_757ins, p.Ala253fsX30
Original code Patient 2
Description Allele 1 and 2: A point mutation in the exon 5 leading to
Description aberrant splicing and to a premature stop codon
Date 26-Oct-2007 (Rel. 1, Created)
Date 26-Oct-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17943190
RefAuthors Jouary, T., Goizet, C., Coupry, I., Redonnet-Vernhet, I.,
RefAuthors Levade, T., Burgelin, I., Toutain, A., Delaporte, E.,
RefAuthors Douillard, C., Lacombe, D., Taieb, A., Arveiler, B.
RefTitle Detection of an intragenic deletion expands the spectrum
RefTitle of CTSC mutations in papillon-lefèvre syndrome.
RefLoc J Invest Dermatol (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38241
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: splicing; gain of intron sequence
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 855
Feature /change: +agtaaaaaaa taagcctaag ttttttgtta atttgtttgg
Feature /change: aactatttat tgaacagttg ctctgtgtga tggatttcgg
Feature /change: ggatacctag atggaatggg catgatcccc tttttacaga
Feature /change: aatagaaaat
Feature /note: predicted effect, not confirmed
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 253
Feature /change: A -> SKKISLSFLL ICLELFIEQL LCVMDFGDTX
Feature /note: predicted effect, not confirmed
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38241
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: splicing; gain of intron sequence
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 855
Feature /change: +agtaaaaaaa taagcctaag ttttttgtta atttgtttgg
Feature /change: aactatttat tgaacagttg ctctgtgtga tggatttcgg
Feature /change: ggatacctag atggaatggg catgatcccc tttttacaga
Feature /change: aatagaaaat
Feature /note: predicted effect, not confirmed
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 253
Feature /change: A -> SKKISLSFLL ICLELFIEQL LCVMDFGDTX
Feature /note: predicted effect, not confirmed
Diagnosis Papillon-Lefevre syndrome
Symptoms Palmoplantar keratoderma, severe periodontitis
Sex XX
Ethnic origin Moroccan
Parents Consanguineous
//
ID R272P(8),R272P(8); standard; MUTATION;
Accession C0130
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Description Allele 1 and 2: A point mutation in the exon 6 leading to
Description an amino acid change
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Symptoms Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms premature tooth loss
Ethnic origin Turkey
//
ID P285L(1),P285L(1); standard; MUTATION;
Accession C0131
Systematic name Allele 1 and 2: g.42603C>T, c.854C>T, r.854c>u, p.Pro285Leu
Description Allele 1 and 2: A point mutation in the exon 6 leading to
Description an amino acid change
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42603
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 952
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 285
Feature /change: P -> L
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42603
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 952
Feature /codon: cct -> ctt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 285
Feature /change: P -> L
Diagnosis Papillon-Lefevre syndrome
Symptoms Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms premature tooth loss
Ethnic origin Morocco
Parents Consanguineous
//
ID G297V(1),G308E(1); standard; MUTATION;
Accession C0135
Systematic name Allele 1: g.44263G>T, c.890G>T, r.890g>u, p.Gly297Val
Systematic name Allele 2: g.44296G>A, c.923G>A, r.923g>a, p.Gly308Glu
Description Allele 1: A point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 7 leading to an
Description amino acid change
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44263
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 988
Feature /codon: ggc -> gtc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 297
Feature /change: G -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44296
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1021
Feature /codon: gga -> gaa; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 308
Feature /change: G -> E
Diagnosis Papillon-Lefevre syndrome
Symptoms Pyoderma, premature tooth loss, gingival inflammation and
Symptoms recession, tooth mobility, xerotic palmar skin, polymorphic
Symptoms scarring lessions on buttocks, thighs and calves
Age 24
Sex XX
Ethnic origin Italy
Parents Non-consanguineous
Comment Isotretinoin improved the skin infections and plantar
Comment keratoderma
//
ID G301S(4),G301S(4); standard; MUTATION;
Accession C0132
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Description Allele 1 and 2: A point mutation in the exon 7 leading to
Description an amino acid change
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Symptoms Palmoplantar hyperkeratosis, aggressive periodontitis
Ethnic origin Germany
Parents Non-consanguineous
//
ID G386R(1),Deletion(1); standard; MUTATION;
Accession C0125
Systematic name Allele 1: g.44529G>C, c.1156G>C, r.1156g>c, p.Gly386Arg
Original code Patient 1
Description Allele 1: A point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: A large intragenic deletion involving exons 3-7
Date 26-Oct-2007 (Rel. 1, Created)
Date 26-Oct-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17943190
RefAuthors Jouary, T., Goizet, C., Coupry, I., Redonnet-Vernhet, I.,
RefAuthors Levade, T., Burgelin, I., Toutain, A., Delaporte, E.,
RefAuthors Douillard, C., Lacombe, D., Taieb, A., Arveiler, B.
RefTitle Detection of an intragenic deletion expands the spectrum
RefTitle of CTSC mutations in papillon-lefèvre syndrome.
RefLoc J Invest Dermatol (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44529
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1254
Feature /codon: ggg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 386
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: unknown
Feature /note: a large deletion involving exons 3-7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms Severe periodontitis and keratoderma, multiple cutaneous
Symptoms abscesses
Sex XX
Ethnic origin Caucasoid
//
ID G139R(1),#L381X393(2); standard; MUTATION;
Accession C0076
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code Family 3; II:1
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a frame shift deletion in the exon 7 leading to a
Description premature stop codon
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12112662
RefAuthors Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J.,
RefAuthors Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle Biochemical and mutational analyses of the cathepsin c
RefTitle gene (CTSC) in three north american families with papillon
RefTitle lefèvre syndrome.
RefLoc Hum Mutat 20:75 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44514
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1239
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 381
Feature /change: L -> STTKRGSTTT LVX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Texas
Family history Inherited
//
ID G139R(2d),D236Y(1); standard; MUTATION;
Accession C0101
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.38190G>T, c.706G>T, r.706g>u, p.Asp236Tyr
Original code Family 12; III-1
Description Allele 1: a point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 5 leading to an
Description amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38190
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 804
Feature /codon: gac -> tac; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 236
Feature /change: D -> Y
Diagnosis Papillon-Lefevre syndrome
Sex XY
Family history Inherited
Relative CTSCbase; C0098 mother
Relative CTSCbase; C0099 uncle
Relative CTSCbase; C0100 aunt
//
ID G139R(3a),G139R(3a); standard; MUTATION;
Accession C0120
Systematic name Allele 1 and 2: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Original code Case 1
Description Allele 1 and 2: a point mutation in the exon 3 leading to
Description an amino acid change
Date 21-Jun-2006 (Rel. 1, Created)
Date 21-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16332247
RefAuthors Cagli, N. A., Hakki, S. S., Dursun, R., Toy, H., Gokalp,
RefAuthors A., Ryu, O. H., Hart, P. S., Hart, T. C.
RefTitle Clinical, genetic, and biochemical findings in two
RefTitle siblings with papillon-lefèvre syndrome.
RefLoc J Periodontol 76:2322-2329 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Relative CTSCbase; C0121 sister
Comment the patient is homozygous for the T153I polymorphism
//
ID G139R(3b),G139R(3b); standard; MUTATION;
Accession C0121
Systematic name Allele 1 and 2: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Original code Case 2
Description Allele 1 and 2: a point mutation in the exon 3 leading to
Description an amino acid change
Date 21-Jun-2006 (Rel. 1, Created)
Date 21-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16332247
RefAuthors Cagli, N. A., Hakki, S. S., Dursun, R., Toy, H., Gokalp,
RefAuthors A., Ryu, O. H., Hart, P. S., Hart, T. C.
RefTitle Clinical, genetic, and biochemical findings in two
RefTitle siblings with papillon-lefèvre syndrome.
RefLoc J Periodontol 76:2322-2329 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 513
Feature /codon: gga -> aga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Relative CTSCbase; C0120 sister
Comment the patient is homozygous for the T153I polymorphism
//
ID G139R(4),S260P(1); standard; MUTATION;
Accession C0123
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.42527T>C, c.778T>C, r.778u>c, p.Ser260Pro
Original code Patient 1
Description Allele 1: A point mutation in the exon 3 leading to an
Description amino acid change
Description Allele 2: A point mutation in the exon 6 leading to an
Description amino acid change
Date 27-Sep-2007 (Rel. 1, Created)
Date 27-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17652201
RefAuthors Yang, Y., Bai, X., Liu, H., Li, L., Cao, C., Ge, L.
RefTitle Novel mutations of cathepsin C gene in two chinese
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Dent Res:735-738 (2007)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26313
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 513
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 139
Feature /change: G -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42527
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 876
Feature /codon: tca -> cca; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 260
Feature /change: S -> P
Diagnosis Papillon-Lefevre syndrome
Symptoms Early-onset periodontitis and palmoplantar hyperceratosis,
Symptoms recurrent respiratory infections, indicating an increased
Symptoms susceptibility to bacterial infection
Sex XY
Ethnic origin Mongoloid; China
Parents Non-consanguineous
Family history Inherited
//
ID @V149X158(1),@V149X158(1); standard; MUTATION;
Accession C0036
Systematic name Allele 1 and 2: g.26342_26343insATGT, c.444_445insATGT,
Systematic name r.444_445insaugu, p.Val149fsX10
Description Allele 1 and 2: a frame shift insertion mutation in the
Description exon 3 leading to a premature stop codon
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0022: 26343
Feature /change: +atgt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 543
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 149
Feature /change: V -> MCVCQHSTPX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: insertion
Feature /loc: IDRefSeq: D0022: 26343
Feature /change: +atgt
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 543
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 149
Feature /change: V -> MCVCQHSTPX
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Bengali
Parents Consanguineous
//
ID T153I(2),T153I(2); standard; MUTATION;
Accession C0035
Systematic name Allele 1 and 2: g.26356C>T, c.458C>T, r.458c>u, p.Thr153Ile
Description Allele 1 and 2: a point mutation in the exon 3 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26356
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 556
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 153
Feature /change: T -> I
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26356
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 556
Feature /codon: aca -> ata; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 153
Feature /change: T -> I
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Egypt
Parents Consanguineous
//
ID W185X(1),W185X(1); standard; MUTATION;
Accession C0073
Systematic name Allele 1 and 2: g.29522G>A, c.555G>A, r.555g>a, p.Trp185X
Original code IV-2
Description Allele 1 and 2: a point mutation in the exon 4 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12083812
RefAuthors Hart, P. S., Pallos, D., Zhang, Y., Sanchez, J., Kavamura,
RefAuthors I., Brunoni, D., Hart, T. C.
RefTitle Identification of a novel cathepsin C mutation (p.W185X)
RefTitle in a brazilian kindred with papillon-lefèvre syndrome.
RefLoc Mol Genet Metab 76:145-147 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29522
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 653
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 185
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29522
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 653
Feature /codon: tgg -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 185
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Brazil
Parents Consanguineous
//
ID #T189X199(1),#T189X199(1); standard; MUTATION;
Accession C0082
Systematic name Allele 1 and 2: g.29533_29539delCATACAT,
Systematic name c.566_572delCATACAT, r.566_572delcauacau, p.Thr189fsX11
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 4 leading to a premature stop codon
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15111626
RefAuthors Noack, B., Gorgens, H., Hoffmann, T., Fanghanel, J.,
RefAuthors Kocher, T., Eickholz, P., Schackert, H. K.
RefTitle Novel mutations in the cathepsin C gene in patients with
RefTitle pre-pubertal aggressive periodontitis and papillon-
RefTitle lefèvre syndrome.
RefLoc J Dent Res 83:368-370 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29533..29539
Feature /change: -catacat
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 664..670
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature /change: TYM -> RNMRLLPWEI X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29533..29539
Feature /change: -catacat
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 664..670
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature /change: TYM -> RNMRLLPWEI X
Diagnosis Prepubertal periodontitis
Sex XX
Ethnic origin Caucasoid; German
Parents Consanguineous
//
ID L196P(1a),L196P(1a); standard; MUTATION;
Accession C0104
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code IV:5
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11922261
RefAuthors Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L.,
RefAuthors Loures, C. G., De, M. L.
RefTitle A novel mutation of the cathepsin C gene in papillon-
RefTitle lefèvre syndrome.
RefLoc J Periodontol 73:307-312 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Brazil
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0105 sister
Relative CTSCbase; C0106 brother
//
ID L196P(1b),L196P(1b); standard; MUTATION;
Accession C0105
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code IV:8
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11922261
RefAuthors Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L.,
RefAuthors Loures, C. G., De, M. L.
RefTitle A novel mutation of the cathepsin C gene in papillon-
RefTitle lefèvre syndrome.
RefLoc J Periodontol 73:307-312 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Brazil
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0104 sister
Relative CTSCbase; C0106 brother
//
ID L196P(1c),L196P(1c); standard; MUTATION;
Accession C0106
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code IV:9
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11922261
RefAuthors Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L.,
RefAuthors Loures, C. G., De, M. L.
RefTitle A novel mutation of the cathepsin C gene in papillon-
RefTitle lefèvre syndrome.
RefLoc J Periodontol 73:307-312 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Brazil
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0104 sister
Relative CTSCbase; C0105 sister
//
ID L196P(2),L196P(2); standard; MUTATION;
Accession C0107
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code II:1
Description Allele 1 and 2: a point mutation in the exon 4 leading to
Description an amino acid change
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15727652
RefAuthors Cury, V. F., Gomez, R. S., Costa, J. E., Friedman, E.,
RefAuthors Boson, W., De Marco, L.
RefTitle A homozygous cathepsin C mutation associated with haim-
RefTitle munk syndrome.
RefLoc Br J Dermatol 152:353-356 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29554
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 685
Feature /codon: ctt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 196
Feature /change: L -> P
Diagnosis Haim-Munk syndrome
Age 19
Sex XX
Ethnic origin Caucasoid; Brazil
Parents Consanguineous
Family history Inherited
//
ID @H208X223(1),@H208X223(1); standard; MUTATION;
Accession C0037
Systematic name Allele 1 and 2: g.29589dupC, c.622dupC, r.622dupc,
Systematic name p.His208fsX16
Description Allele 1 and 2: a frame shift duplication mutation in the
Description exon 4 leading to a premature stop codon
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0022: 29590
Feature /change: +c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 721
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 208
Feature /change: H -> PQSKNPKAQT CTTDCX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: duplication
Feature /loc: IDRefSeq: D0022: 29590
Feature /change: +c
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 721
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 208
Feature /change: H -> PQSKNPKAQT CTTDCX
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS with transgressions of the hyperkeratotic lesions on
Symptoms elbows/knees
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID R210X(1a),R210X(1a); standard; MUTATION;
Accession C0009
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code Family 7; II:1
Description Allele 1 and 2: a point mutation in the exon 4 leading to a
Description premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Relative CTSCbase; C0010 brother
//
ID R210X(1b),R210X(1b); standard; MUTATION;
Accession C0010
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code Family 7; II:2
Description Allele 1 and 2: a point mutation in the exon 4 leading to a
Description premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Relative CTSCbase; C0009 sister
//
ID R210X(2),R210X(2); standard; MUTATION;
Accession C0060
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code F2
Description Allele 1 and 2: a point mutation in the exon 4 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29595
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 726
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Algeria
Parents Consanguineous
//
ID #R210X222(1),#R210X222(1); standard; MUTATION;
Accession C0119
Systematic name Allele 1 and 2: g.29596_29597delGA, c.629_630delGA,
Systematic name r.629_630delga, p.Arg210fsX13
Original code Family 2
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 4 leading to a premature stop codon
Date 20-Jun-2006 (Rel. 1, Created)
Date 20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16460249
RefAuthors Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle Description of two new cathepsin C gene mutations in
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Periodontol 77:233-237 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29596..29597
Feature /change: -ga
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 727..728
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> QNPKAQTCTT DCX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 29596..29597
Feature /change: -ga
Feature /genomic_region: exon; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 727..728
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 210
Feature /change: R -> QNPKAQTCTT DCX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Indian
Parents Non-consanguineous
Family history Inherited
//
ID W235X(1),W235X(1); standard; MUTATION;
Accession C0038
Systematic name Allele 1 and 2: g.38188G>A, c.704G>A, r.704g>a, p.Trp235X
Description Allele 1 and 2: a point mutation in the exon 5 leading to a
Description premature stop codon
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38188
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 802
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 235
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38188
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 802
Feature /codon: tgg -> tag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 235
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Iran
Parents Consanguineous
//
ID D236Y(1),C291Y(1); standard; MUTATION;
Accession C0054
Systematic name Allele 1: g.38190G>T, c.706G>T, r.706g>u, p.Asp236Tyr
Systematic name Allele 2: g.42621G>A, c.872G>A, r.872g>a, p.Cys291Tyr
Original code Family 1, C
Description Allele 1: a point mutation in the exon 5 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 6 leading to an
Description amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180601
RefAuthors Allende, L. M., Garcia-Perez, M. A., Moreno, A., Corell,
RefAuthors A., Carasol, M., Martinez-Canut, P., Arnaiz-Villena, A.
RefTitle Cathepsin C gene: first compound heterozygous patient with
RefTitle papillon-lefèvre syndrome and a novel symptomless
RefTitle mutation.
RefLoc Hum Mutat 17:152-153 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38190
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 804
Feature /codon: gac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 236
Feature /change: D -> Y
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42621
Feature /change: g -> a
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 970
Feature /codon: tgt -> tat; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 291
Feature /change: C -> Y
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Spain
Parents Non-consanguineous
//
ID V249F(1),V249F(1); standard; MUTATION;
Accession C0004
Systematic name Allele 1 and 2: g.38229G>T, c.745G>T, r.745g>u, p.Val249Phe
Original code Family 4
Description Allele 1 and 2: a point mutation in the exon 5 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38229
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 843
Feature /codon: gtt -> ttt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 249
Feature /change: V -> F
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38229
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 843
Feature /codon: gtt -> ttt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 249
Feature /change: V -> F
Diagnosis Papillon-Lefevre syndrome
//
ID R250X(1),R250X(1); standard; MUTATION;
Accession C0039
Systematic name Allele 1 and 2: g.38232C>T, c.748C>T, r.748c>u, p.Arg250X
Description Allele 1 and 2: a point mutation in the exon 5 leading to a
Description premature stop codon
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38232
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 846
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 250
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38232
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 846
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 250
Feature /change: R -> X
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS with transgressions of the hyperkeratotic lesions on
Symptoms elbows/knees
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID R250X(2),?; standard; MUTATION;
Accession C0090
Systematic name Allele 1: g.38232C>T, c.748C>T, r.748c>u, p.Arg250X
Original code Pt3
Description Allele 1: a point mutation in the exon 5 leading to a
Description premature stop codon
Date 08-Feb-2005 (Rel. 1, Created)
Date 08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15585850
RefAuthors Pham, C. T., Ivanovich, J. L., Raptis, S. Z., Zehnbauer,
RefAuthors B., Ley, T. J.
RefTitle Papillon-lefevre syndrome: correlating the molecular,
RefTitle cellular, and clinical consequences of cathepsin
RefTitle c/dipeptidyl peptidase I deficiency in humans.
RefLoc J Immunol 173:7277-7281 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38232
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 846
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 250
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; North America
Parents Non-consanguineous
//
ID Q252L(1),Q252L(1); standard; MUTATION;
Accession C0001
Systematic name Allele 1 and 2: g.38239A>T, c.755A>T, r.755a>u, p.Gln252Leu
Original code Family 1
Description Allele 1 and 2: a point mutation in the exon 5 leading to
Description an amino acid change
Date 25-Jan-2005 (Rel. 1, Created)
Date 25-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38239
Feature /change: a -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 853
Feature /codon: caa -> cta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 252
Feature /change: Q -> L
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 38239
Feature /change: a -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 853
Feature /codon: caa -> cta; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 252
Feature /change: Q -> L
Diagnosis Papillon-Lefevre syndrome
//
ID R272H(1),Y412C(1); standard; MUTATION;
Accession C0102
Systematic name Allele 1: g.42564G>A, c.815G>A, r.815g>a, p.Arg272His
Systematic name Allele 2: g.44608A>G, c.1235A>G, r.1235a>g, p.Tyr412Cys
Original code PPP Family 1
Description Allele 1: a point mutation in the exon 6 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44608
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1333
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 412
Feature /change: Y -> C
Diagnosis Prepubertal periodontitis
Parents Consanguineous
//
ID R272P(1),R272P(1); standard; MUTATION;
Accession C0011
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code Family 8
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XY
//
ID R272P(2),R272P(2); standard; MUTATION;
Accession C0040
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID R272P(3a),R272P(3a); standard; MUTATION;
Accession C0061
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code F4
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Holland
Parents Consanguineous
Relative CTSCbase; C0062 brother
//
ID R272P(3b),R272P(3b); standard; MUTATION;
Accession C0062
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code F4
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Holland
Parents Consanguineous
Relative CTSCbase; C0061 sister
//
ID R272P(4a),#L381X393(1a); standard; MUTATION;
Accession C0070
Systematic name Allele 1: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code F8
Description Allele 1: a point mutation in the exon 6 leading to an
Description amino acid change
Description Allele 2: a frame shift deletion in the exon 7 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44514
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1239
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 381
Feature /change: L -> STTKRGSTTT LVX
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; France
Parents Non-consanguineous
Relative CTSCbase; C0071 brother
//
ID R272P(4b),#L381X393(1b); standard; MUTATION;
Accession C0071
Systematic name Allele 1: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code F8
Description Allele 1: a point mutation in the exon 6 leading to an
Description amino acid change
Description Allele 2: a frame shift deletion in the exon 7 leading to a
Description premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44514
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1239
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 381
Feature /change: L -> STTKRGSTTT LVX
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; France
Parents Non-consanguineous
Relative CTSCbase; C0070 brother
//
ID R272P(7a),R272P(7a); standard; MUTATION;
Accession C0094
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code Family 1; II-1
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15108292
RefAuthors de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree,
RefAuthors H., Everts, V., Beertsen, W.
RefTitle Loss-of-function mutations in cathepsin C in two families
RefTitle with papillon-lefèvre syndrome are associated with
RefTitle deficiency of serine proteinases in PMNs.
RefLoc Hum Mutat 23:524 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Belgium
Parents Non-consanguineous
Family history Inherited
Relative CTSCbase; C0095 sister
//
ID R272P(7b),R272P(7b); standard; MUTATION;
Accession C0095
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code Family 1; II-2
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15108292
RefAuthors de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree,
RefAuthors H., Everts, V., Beertsen, W.
RefTitle Loss-of-function mutations in cathepsin C in two families
RefTitle with papillon-lefèvre syndrome are associated with
RefTitle deficiency of serine proteinases in PMNs.
RefLoc Hum Mutat 23:524 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42564
Feature /change: g -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 913
Feature /codon: cgt -> cct; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 272
Feature /change: R -> P
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Belgium
Parents Non-consanguineous
Family history Inherited
Relative CTSCbase; C0094 sister
//
ID Q286R(1a),Q286R(1a); standard; MUTATION;
Accession C0022
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 12
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Consanguineous
Relative CTSCbase; C0023 second cousin
Relative CTSCbase; C0024 second cousin
Relative CTSCbase; C0025 second cousin
Relative CTSCbase; C0026 second cousin
Relative CTSCbase; C0027 second cousin
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1b),Q286R(1b); standard; MUTATION;
Accession C0023
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 34
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XY
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin
Relative CTSCbase; C0024 sister
Relative CTSCbase; C0025 brother
Relative CTSCbase; C0026 sister
Relative CTSCbase; C0027 sister
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1c),Q286R(1c); standard; MUTATION;
Accession C0024
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 33
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin
Relative CTSCbase; C0023 brother
Relative CTSCbase; C0025 brother
Relative CTSCbase; C0026 sister
Relative CTSCbase; C0027 sister
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1d),Q286R(1d); standard; MUTATION;
Accession C0025
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 35
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XY
Parents Non-consanguineous
Parents Consanguineous
Relative CTSCbase; C0022 second cousin
Relative CTSCbase; C0023 brother
Relative CTSCbase; C0024 sister
Relative CTSCbase; C0026 sister
Relative CTSCbase; C0027 sister
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1e),Q286R(1e); standard; MUTATION;
Accession C0026
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 36
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin
Relative CTSCbase; C0023 brother
Relative CTSCbase; C0024 sister
Relative CTSCbase; C0025 brother
Relative CTSCbase; C0027 sister
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1f),Q286R(1f); standard; MUTATION;
Accession C0027
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 55
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin
Relative CTSCbase; C0023 brother
Relative CTSCbase; C0024 sister
Relative CTSCbase; C0025 brother
Relative CTSCbase; C0026 sister
Relative CTSCbase; C0028 second cousin once removed
Relative CTSCbase; C0029 second cousin once removed
Relative CTSCbase; C0030 second cousin once removed
Relative CTSCbase; C0031 second cousin once removed
//
ID Q286R(1g),Q286R(1g); standard; MUTATION;
Accession C0028
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 25
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin once removed
Relative CTSCbase; C0023 second cousin once removed
Relative CTSCbase; C0024 second cousin once removed
Relative CTSCbase; C0025 second cousin once removed
Relative CTSCbase; C0026 second cousin once removed
Relative CTSCbase; C0027 second cousin once removed
Relative CTSCbase; C0029 brother
Relative CTSCbase; C0030 cousin
Relative CTSCbase; C0031 cousin
//
ID Q286R(1h),Q286R(1h); standard; MUTATION;
Accession C0029
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 2
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XY
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Relative CTSCbase; C0022 second cousin once removed
Relative CTSCbase; C0023 second cousin once removed
Relative CTSCbase; C0024 second cousin once removed
Relative CTSCbase; C0025 second cousin once removed
Relative CTSCbase; C0026 second cousin once removed
Relative CTSCbase; C0027 second cousin once removed
Relative CTSCbase; C0028 sister
Relative CTSCbase; C0030 cousin
Relative CTSCbase; C0031 cousin
//
ID Q286R(1i),Q286R(1i); standard; MUTATION;
Accession C0030
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 17
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Consanguineous
Relative CTSCbase; C0022 second cousin once removed
Relative CTSCbase; C0023 second cousin once removed
Relative CTSCbase; C0024 second cousin once removed
Relative CTSCbase; C0025 second cousin once removed
Relative CTSCbase; C0026 second cousin once removed
Relative CTSCbase; C0027 second cousin once removed
Relative CTSCbase; C0028 cousin
Relative CTSCbase; C0029 cousin
Relative CTSCbase; C0031 sister
//
ID Q286R(1j),Q286R(1j); standard; MUTATION;
Accession C0031
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 16
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Haim-Munk syndrome
Sex XX
Ethnic origin Caucasoid; India
Parents Consanguineous
Relative CTSCbase; C0022 second cousin once removed
Relative CTSCbase; C0023 second cousin once removed
Relative CTSCbase; C0024 second cousin once removed
Relative CTSCbase; C0025 second cousin once removed
Relative CTSCbase; C0026 second cousin once removed
Relative CTSCbase; C0027 second cousin once removed
Relative CTSCbase; C0028 cousin
Relative CTSCbase; C0029 cousin
Relative CTSCbase; C0030 sister
//
ID Q286R(2a),Q286R(2a); standard; MUTATION;
Accession C0032
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 75
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CTSCbase; C0033 niece/cousin
//
ID Q286R(2b),Q286R(2b); standard; MUTATION;
Accession C0033
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code 78
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662807
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski,
RefAuthors A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle Haim-munk syndrome and papillon-lefèvre syndrome are
RefTitle allelic mutations in cathepsin C.
RefLoc J Med Genet 37:88-94 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CTSCbase; C0032 uncle
//
ID Q286R(3),Q286R(3); standard; MUTATION;
Accession C0055
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code Family 2, A
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180601
RefAuthors Allende, L. M., Garcia-Perez, M. A., Moreno, A., Corell,
RefAuthors A., Carasol, M., Martinez-Canut, P., Arnaiz-Villena, A.
RefTitle Cathepsin C gene: first compound heterozygous patient with
RefTitle papillon-lefèvre syndrome and a novel symptomless
RefTitle mutation.
RefLoc Hum Mutat 17:152-153 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42606
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 955
Feature /codon: cag -> cgg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> R
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Spain
Parents Consanguineous
//
ID Q286X(1a),Q286X(1a); standard; MUTATION;
Accession C0012
Systematic name Allele 1 and 2: g.42605C>T, c.856C>T, r.856c>u, p.Gln286X
Original code Patient 21
Description Allele 1 and 2: a point mutation in the exon 6 leading to a
Description premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42605
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 954
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42605
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 954
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CTSCbase; C0013 brother
//
ID Q286X(1b),Q286X(1b); standard; MUTATION;
Accession C0013
Systematic name Allele 1 and 2: g.42605C>T, c.856C>T, r.856c>u, p.Gln286X
Original code Patient 29
Description Allele 1 and 2: a point mutation in the exon 6 leading to a
Description premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42605
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 954
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42605
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 954
Feature /codon: cag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 286
Feature /change: Q -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
Relative CTSCbase; C0012 sister
//
ID Y294H(1a),Y294H(1a); standard; MUTATION;
Accession C0091
Systematic name Allele 1 and 2: g.42629T>C, c.880T>C, r.880u>c, p.Tyr294His
Original code Family 1; II-2
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 08-Feb-2005 (Rel. 1, Created)
Date 08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12809647
RefAuthors Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle A genetic study of cathepsin C gene in two families with
RefTitle papillon-lefèvre syndrome.
RefLoc Mol Genet Metab 79:146-148 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42629
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 978
Feature /codon: tat -> cat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 294
Feature /change: Y -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42629
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 978
Feature /codon: tat -> cat; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 294
Feature /change: Y -> H
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Spain (Salamanca)
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0092 brother
//
ID Y294H(1b),Y294H(1b); standard; MUTATION;
Accession C0092
Systematic name Allele 1 and 2: g.42629T>C, c.880T>C, r.880u>c, p.Tyr294His
Original code Family 1; II-3
Description Allele 1 and 2: a point mutation in the exon 6 leading to
Description an amino acid change
Date 08-Feb-2005 (Rel. 1, Created)
Date 08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12809647
RefAuthors Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle A genetic study of cathepsin C gene in two families with
RefTitle papillon-lefèvre syndrome.
RefLoc Mol Genet Metab 79:146-148 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42629
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 978
Feature /codon: tat -> cat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 294
Feature /change: Y -> H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 42629
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 978
Feature /codon: tat -> cat; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 294
Feature /change: Y -> H
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Spain (Salamanca)
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0091 brother
//
ID G300S(1),E447G(1); standard; MUTATION;
Accession C0041
Systematic name Allele 1: g.44271G>A, c.898G>A, r.898g>a, p.Gly300Ser
Systematic name Allele 2: g.44713A>G, c.1340A>G, r.1340a>g, p.Glu447Gly
Description Allele 1: a point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44271
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 996
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 300
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44713
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1438
Feature /codon: gag -> ggg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 447
Feature /change: E -> G
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Mongoloid; Vietnam
Parents Non-consanguineous
//
ID G301S(1a),G301S(1a); standard; MUTATION;
Accession C0006
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code Family 6; IV:2
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Sex XX
Relative CTSCbase; C0007 brother
Relative CTSCbase; C0008 nephew
//
ID G301S(1b),G301S(1b); standard; MUTATION;
Accession C0007
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code Family 6; IV:4
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Sex XY
Relative CTSCbase; C0006 sister
Relative CTSCbase; C0008 son
//
ID G301S(1c),G301S(1c); standard; MUTATION;
Accession C0008
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code Family 6; V:1
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Sex XY
Relative CTSCbase; C0006 aunt
Relative CTSCbase; C0007 father
//
ID G301S(2),G301S(2); standard; MUTATION;
Accession C0043
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Iran
Parents Consanguineous
//
ID G301S(3a),G301S(3a); standard; MUTATION;
Accession C0052
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code Family 2; II-2
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Mongoloid; Japan
Parents Consanguineous
Relative CTSCbase; C0053 brother
//
ID G301S(3b),G301S(3b); standard; MUTATION;
Accession C0053
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code Family 2; II-3
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 01-Feb-2005 (Rel. 1, Created)
Date 01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11180012
RefAuthors Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S.,
RefAuthors Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle Papillon-lefèvre syndrome: mutations and polymorphisms in
RefTitle the cathepsin C gene.
RefLoc J Invest Dermatol 116:339-343 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44274
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 999
Feature /codon: ggc -> agc; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> S
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Mongoloid; Japan
Parents Consanguineous
Relative CTSCbase; C0052 sister
//
ID G301V(1),G301V(1); standard; MUTATION;
Accession C0042
Systematic name Allele 1 and 2: g.44275G>T, c.902G>T, r.902g>u, p.Gly301Val
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44275
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1000
Feature /codon: ggc -> gtc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44275
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1000
Feature /codon: ggc -> gtc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 301
Feature /change: G -> V
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS with transgressions of the hyperkeratotic lesions on
Symptoms elbows/knees
Ethnic origin Caucasoid; Iran
Parents Consanguineous
//
ID Y304N(1),Y304N(1); standard; MUTATION;
Accession C0044
Systematic name Allele 1 and 2: g.44283T>A, c.910T>A, r.910u>a, p.Tyr304Asn
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44283
Feature /change: t -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1008
Feature /codon: tac -> aac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 304
Feature /change: Y -> N
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44283
Feature /change: t -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1008
Feature /codon: tac -> aac; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 304
Feature /change: Y -> N
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS and retinitis pigmentosa
Ethnic origin Caucasoid; Panama
Parents Consanguineous
//
ID Y304X(1),Y304X(1); standard; MUTATION;
Accession C0088
Systematic name Allele 1 and 2: g.44285C>A, c.912C>A, r.912c>a, p.Tyr304X
Original code IISC-PLS3; II-2
Description Allele 1 and 2: a point mutation in the exon 7 leading to a
Description premature stop codon
Date 07-Feb-2005 (Rel. 1, Created)
Date 07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12857359
RefAuthors Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P.,
RefAuthors Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle Mutation analysis of the cathepsin C gene in indian
RefTitle families with papillon-lefèvre syndrome.
RefLoc BMC Med Genet 4:5 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44285
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1010
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 304
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44285
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1010
Feature /codon: tac -> taa; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 304
Feature /change: Y -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; India
Parents Non-consanguineous
Family history Not known
//
ID Q312R(1),Q312R(1); standard; MUTATION;
Accession C0103
Systematic name Allele 1 and 2: g.44308A>G, c.935A>G, r.935a>g, p.Gln312Arg
Original code Family 19
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 14-Feb-2005 (Rel. 1, Created)
Date 14-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14974080
RefAuthors Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern,
RefAuthors I., Wallace, I., Southern, L., Zhang, L., Howard, R.,
RefAuthors Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh,
RefAuthors L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P.,
RefAuthors Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M.,
RefAuthors Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes,
RefAuthors C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle The role of cathepsin C in papillon-lefèvre syndrome,
RefTitle prepubertal periodontitis, and aggressive periodontitis.
RefLoc Hum Mutat 23:222-228 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44308
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1033
Feature /codon: caa -> cga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 312
Feature /change: Q -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44308
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1033
Feature /codon: caa -> cga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 312
Feature /change: Q -> R
Diagnosis Papillon-Lefevre syndrome
//
ID L316R(1),W423S(1); standard; MUTATION;
Accession C0083
Systematic name Allele 1: g.44320T>G, c.947T>G, r.947u>g, p.Leu316Arg
Systematic name Allele 2: g.44641G>C, c.1268G>C, r.1268g>c, p.Trp423Ser
Description Allele 1: a point mutation in the exon 7 leading to an
Description amino acid change
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15111626
RefAuthors Noack, B., Gorgens, H., Hoffmann, T., Fanghanel, J.,
RefAuthors Kocher, T., Eickholz, P., Schackert, H. K.
RefTitle Novel mutations in the cathepsin C gene in patients with
RefTitle pre-pubertal aggressive periodontitis and papillon-
RefTitle lefèvre syndrome.
RefLoc J Dent Res 83:368-370 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44320
Feature /change: t -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1045
Feature /codon: ctg -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 316
Feature /change: L -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44641
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1366
Feature /codon: tgg -> tcg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 423
Feature /change: W -> S
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; German
Parents Non-consanguineous
//
ID E319G(1),E319G(1); standard; MUTATION;
Accession C0045
Systematic name Allele 1 and 2: g.44329A>G, c.956A>G, r.956a>g, p.Glu319Gly
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44329
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1054
Feature /codon: gaa -> gga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 319
Feature /change: E -> G
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44329
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1054
Feature /codon: gaa -> gga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 319
Feature /change: E -> G
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Iran
Parents Consanguineous
//
ID #D328X331(1),#D328X331(1); standard; MUTATION;
Accession C0068
Systematic name Allele 1 and 2: g.44357_44363delTTCTCCA,
Systematic name c.984_990delTTCTCCA, r.984_990deluucucca, p.Ser329fsX3
Original code F6
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 7 leading to a premature stop codon
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44357..44363
Feature /change: -ttctcca
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1082..1088
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 328..330
Feature /change: DSP -> DAKX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44357..44363
Feature /change: -ttctcca
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1082..1088
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 328..330
Feature /change: DSP -> DAKX
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; France, Ile d'Yeu
Parents Consanguineous
//
ID R339C(1),R339C(1); standard; MUTATION;
Accession C0002
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code Family 2
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XY
//
ID R339C(2),R339C(2); standard; MUTATION;
Accession C0046
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Egypt
Parents Consanguineous
//
ID R339C(3a),R339C(3a); standard; MUTATION;
Accession C0063
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code F5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Martinique
Parents Consanguineous
Relative CTSCbase; C0064 twinsister
Relative CTSCbase; C0065 sister
Relative CTSCbase; C0066 sister
Relative CTSCbase; C0067 sister
//
ID R339C(3b),R339C(3b); standard; MUTATION;
Accession C0064
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code F5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Martinique
Parents Consanguineous
Relative CTSCbase; C0063 twinbrother
Relative CTSCbase; C0065 sister
Relative CTSCbase; C0066 sister
Relative CTSCbase; C0067 sister
//
ID R339C(3c),R339C(3c); standard; MUTATION;
Accession C0065
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code F5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Martinique
Parents Consanguineous
Relative CTSCbase; C0063 brother
Relative CTSCbase; C0064 sister
Relative CTSCbase; C0066 sister
Relative CTSCbase; C0067 sister
//
ID R339C(3d),R339C(3d); standard; MUTATION;
Accession C0066
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code F5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Martinique
Parents Consanguineous
Relative CTSCbase; C0063 brother
Relative CTSCbase; C0064 sister
Relative CTSCbase; C0065 sister
Relative CTSCbase; C0067 sister
//
ID R339C(3e),R339C(3e); standard; MUTATION;
Accession C0067
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code F5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44388
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1113
Feature /codon: cgt -> tgt; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 339
Feature /change: R -> C
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Martinique
Parents Consanguineous
Relative CTSCbase; C0063 brother
Relative CTSCbase; C0064 sister
Relative CTSCbase; C0065 sister
Relative CTSCbase; C0066 sister
//
ID S343X(1),S343X(1); standard; MUTATION;
Accession C0015
Systematic name Allele 1 and 2: g.44401_44402delCT, c.1028_1029delCT,
Systematic name r.1028_1029delcu, p.Ser343X
Original code Patient 19
Description Allele 1 and 2: a deletion mutation in the exon 7 leading
Description to a premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44401..44402
Feature /change: -ct
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1126..1127
Feature /codon: tct -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 343
Feature /change: S -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44401..44402
Feature /change: -ct
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1126..1127
Feature /codon: tct -> tga; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 343
Feature /change: S -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID Y347C(1),Y347C(1); standard; MUTATION;
Accession C0005
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code Family 5
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
Diagnosis Papillon-Lefevre syndrome
//
ID Y347C(2a),Y347C(2a); standard; MUTATION;
Accession C0018
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code IV3
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662808
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M.,
RefAuthors Walker, S.
RefTitle Localisation of a gene for prepubertal periodontitis to
RefTitle chromosome 11q14 and identification of a cathepsin C gene
RefTitle mutation.
RefLoc J Med Genet 37:95-101 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
Diagnosis Prepubertal periodontitis
Sex XY
Parents Consanguineous
Relative CTSCbase; C0019 sister
Relative CTSCbase; C0020 cousin
Relative CTSCbase; C0021 cousin
//
ID Y347C(2b),Y347C(2b); standard; MUTATION;
Accession C0019
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code IV4
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662808
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M.,
RefAuthors Walker, S.
RefTitle Localisation of a gene for prepubertal periodontitis to
RefTitle chromosome 11q14 and identification of a cathepsin C gene
RefTitle mutation.
RefLoc J Med Genet 37:95-101 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
Diagnosis Prepubertal periodontitis
Sex XX
Parents Consanguineous
Relative CTSCbase; C0018 brother
Relative CTSCbase; C0020 cousin
Relative CTSCbase; C0021 cousin
//
ID Y347C(2c),Y347C(2c); standard; MUTATION;
Accession C0020
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code IV9
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662808
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M.,
RefAuthors Walker, S.
RefTitle Localisation of a gene for prepubertal periodontitis to
RefTitle chromosome 11q14 and identification of a cathepsin C gene
RefTitle mutation.
RefLoc J Med Genet 37:95-101 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
Diagnosis Prepubertal periodontitis
Sex XX
Parents Consanguineous
Relative CTSCbase; C0018 cousin
Relative CTSCbase; C0019 cousin
Relative CTSCbase; C0021 sister
//
ID Y347C(2d),Y347C(2d); standard; MUTATION;
Accession C0021
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code IV10
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 28-Jan-2005 (Rel. 1, Created)
Date 28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10662808
RefAuthors Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y.,
RefAuthors Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M.,
RefAuthors Walker, S.
RefTitle Localisation of a gene for prepubertal periodontitis to
RefTitle chromosome 11q14 and identification of a cathepsin C gene
RefTitle mutation.
RefLoc J Med Genet 37:95-101 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44413
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1138
Feature /codon: tat -> tgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 347
Feature /change: Y -> C
Diagnosis Prepubertal periodontitis
Sex XX
Parents Consanguineous
Relative CTSCbase; C0018 cousin
Relative CTSCbase; C0019 cousin
Relative CTSCbase; C0020 sister
//
ID #G349X359(1),#G349X359(1); standard; MUTATION;
Accession C0014
Systematic name Allele 1 and 2: g.44420delA, c.1047delA, r.1047dela,
Systematic name p.Gly350fsX10
Original code Patient 5
Description Allele 1 and 2: a frame shift deletion mutation in the exon
Description 7 leading to a premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44420
Feature /change: -a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1145
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 349
Feature /change: G -> GVSMEAAMKP X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44420
Feature /change: -a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: frameshift
Feature /loc: IDRefSeq: C0022: 1145
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 349
Feature /change: G -> GVSMEAAMKP X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID Y352X(1),W429C(1); standard; MUTATION;
Accession C0072
Systematic name Allele 1: g.44429delT, c.1056delT, r.1056delu, p.Tyr352X
Systematic name Allele 2: g.44660G>C, c.1287G>C, r.1287g>c, p.Trp429Cys
Original code F9
Description Allele 1: a deletion mutation in the exon 7 leading to a
Description premature stop codon
Description Allele 2: a point mutation in the exon 7 leading to an
Description amino acid change
Date 03-Feb-2005 (Rel. 1, Created)
Date 03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11886537
RefAuthors Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar,
RefAuthors B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J.
RefAuthors F., Fischer, J.
RefTitle Novel point mutations, deletions, and polymorphisms in the
RefTitle cathepsin C gene in nine families from europe and north
RefTitle africa with papillon-lefèvre syndrome.
RefLoc J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44429
Feature /change: -t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1154
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 352
Feature /change: Y -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44660
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1385
Feature /codon: tgg -> tgc; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> C
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; France
Parents Non-consanguineous
//
ID H405N(1a),H405N(1a); standard; MUTATION;
Accession C0096
Systematic name Allele 1 and 2: g.44586C>A, c.1213C>A, r.1213c>a,
Systematic name p.His405Asn
Original code Family 2; II-1
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15108292
RefAuthors de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree,
RefAuthors H., Everts, V., Beertsen, W.
RefTitle Loss-of-function mutations in cathepsin C in two families
RefTitle with papillon-lefèvre syndrome are associated with
RefTitle deficiency of serine proteinases in PMNs.
RefLoc Hum Mutat 23:524 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44586
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1311
Feature /codon: cat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> N
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44586
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1311
Feature /codon: cat -> aat; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> N
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Pakistan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0097 sister
//
ID H405N(1b),H405N(1b); standard; MUTATION;
Accession C0097
Systematic name Allele 1 and 2: g.44586C>A, c.1213C>A, r.1213c>a,
Systematic name p.His405Asn
Original code Family 2; II-2
Description Allele 1 and 2: a point mutation in the exon 7 leading to
Description an amino acid change
Date 09-Feb-2005 (Rel. 1, Created)
Date 09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15108292
RefAuthors de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree,
RefAuthors H., Everts, V., Beertsen, W.
RefTitle Loss-of-function mutations in cathepsin C in two families
RefTitle with papillon-lefèvre syndrome are associated with
RefTitle deficiency of serine proteinases in PMNs.
RefLoc Hum Mutat 23:524 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44586
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1311
Feature /codon: cat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> N
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44586
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1311
Feature /codon: cat -> aat; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> N
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Pakistan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0096 sister
//
ID H405R(1),H405R(1); standard; MUTATION;
Accession C0122
Systematic name Allele 1 and 2: g.44587A>G, c.1214A>G, r.1214a>g,
Systematic name p.His405Arg
Description Allele 1 and 2: A point mutation in the exon 7 leading to
Description an amino acid change
Date 04-Aug-2006 (Rel. 1, Created)
Date 04-Aug-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15991336
RefAuthors de Haar, S., Mir, M., Nguyen, M., Kazemi, B., Ramezani,
RefAuthors G.H., Everts, V., Beertsen, W.
RefTitle Gene symbol: CTSC. disease: papillon-lefevre syndrome.
RefLoc Hum Genet 116:545 (2005)
RefLoc Erratum in: Hum Genet 118:533 (2005).
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44587
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1312
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44587
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022: 1312
Feature /codon: cat -> cgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> R
Diagnosis Papillon-Lefevre syndrome
//
ID H405R(2),H405R(2); standard; MUTATION;
Accession C0133
Systematic name Allele 1 and 2: g.44587A>G, c.1214A>G, r.1214a>g,
Systematic name p.His405Arg
Description Allele 1 and 2: A point mutation in the exon 7 leading to
Description an amino acid change
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44587
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1312
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> R
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44587
Feature /change: a -> g
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1312
Feature /codon: cat -> cgt; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: H -> R
Diagnosis Papillon-Lefevre syndrome
Symptoms palmoplantar hyperkeratosis, aggressive periodontosis,
Symptoms premature tooth loss
Ethnic origin Iran
Parents Consanguineous
//
ID #H405-1(1a),#H405-1(1a); standard; MUTATION;
Accession C0116
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code Family 1.1
Description Allele 1 and 2: an inframe deletion in the exon 7 leading
Description to an amino acid change
Date 20-Jun-2006 (Rel. 1, Created)
Date 20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16460249
RefAuthors Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle Description of two new cathepsin C gene mutations in
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Periodontol 77:233-237 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Indian
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0117 brother
Relative CTSCbase; C0118 sister
//
ID #H405-1(1b),#H405-1(1b); standard; MUTATION;
Accession C0117
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code Family 1.2
Description Allele 1 and 2: an inframe deletion in the exon 7 leading
Description to an amino acid change
Date 20-Jun-2006 (Rel. 1, Created)
Date 20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16460249
RefAuthors Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle Description of two new cathepsin C gene mutations in
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Periodontol 77:233-237 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Indian
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0116 brother
Relative CTSCbase; C0118 sister
//
ID #H405-1(1c),#H405-1(1c); standard; MUTATION;
Accession C0118
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code Family 1.3
Description Allele 1 and 2: an inframe deletion in the exon 7 leading
Description to an amino acid change
Date 20-Jun-2006 (Rel. 1, Created)
Date 20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16460249
RefAuthors Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle Description of two new cathepsin C gene mutations in
RefTitle patients with papillon-lefèvre syndrome.
RefLoc J Periodontol 77:233-237 (2006)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44586..44588
Feature /change: -cat
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0022: 1311..1313
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: P53634; CATC_HUMAN: 405
Feature /change: -H
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Indian
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0116 brother
Relative CTSCbase; C0117 brother
//
ID W423X(1),W423X(1); standard; MUTATION;
Accession C0134
Systematic name Allele 1 and 2: g.44642G>A, c.1269G>A, r.1269g>a, p.Trp423X
Description Allele 1 and 2: A point mutation in the exon 7 leading to a
Description premature stop codon
Date 05-Jul-2010 (Rel. 1, Created)
Date 05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18294227
RefAuthors Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz,
RefAuthors P., Hoffmann, T., Schackert, H. K.
RefTitle Functional cathepsin C mutations cause different papillon-
RefTitle lefèvre syndrome phenotypes.
RefLoc J Clin Periodontol:311-316 (2008)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44642
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1367
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 423
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44642
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1367
Feature /codon: tgg -> tga; 3
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 423
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Symptoms mild skin findings
Ethnic origin Sri Lanka
Parents Consanguineous
//
ID W429X(1),W429X(1); standard; MUTATION;
Accession C0016
Systematic name Allele 1 and 2: g.44659delG, c.1286delG, r.1286delg,
Systematic name p.Trp429X
Original code Patient 7
Description Allele 1 and 2: a deletion mutation in the exon 7 leading
Description to a premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID W429X(2),W429X(2); standard; MUTATION;
Accession C0017
Systematic name Allele 1 and 2: g.44659delG, c.1286delG, r.1286delg,
Systematic name p.Trp429X
Original code Patient 22
Description Allele 1 and 2: a deletion mutation in the exon 7 leading
Description to a premature stop codon
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10593994
RefAuthors Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D.,
RefAuthors Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle Mutations of the cathepsin C gene are responsible for
RefTitle papillon-lefèvre syndrome.
RefLoc J Med Genet 36:881-887 (1999)
RefNumber [2]
RefCrossRef PUBMED; 9741471
RefAuthors Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W.,
RefAuthors Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle Sublocalization of the papillon-lefevre syndrome locus on
RefTitle 11q14-q21.
RefLoc Am J Med Genet 79:134-139 (1998)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID W429X(3),W429X(3); standard; MUTATION;
Accession C0047
Systematic name Allele 1 and 2: g.44659G>A, c.1286G>A, r.1286g>a, p.Trp429X
Description Allele 1 and 2: a point mutation in the exon 7 leading to a
Description premature stop codon
Date 31-Jan-2005 (Rel. 1, Created)
Date 31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11106356
RefAuthors Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar,
RefAuthors M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J.,
RefAuthors Seow, W. K., Marshall, R., Williams, D., Reed, J. B.,
RefAuthors Wright, J. T., Hart, T. C.
RefTitle Identification of cathepsin C mutations in ethnically
RefTitle diverse papillon-lefèvre syndrome patients.
RefLoc J Med Genet 37:927-932 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 44659
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0022: 1384
Feature /codon: tgg -> tag; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 429
Feature /change: W -> X
Diagnosis Papillon-Lefevre syndrome
Ethnic origin Caucasoid; Turkey
Parents Consanguineous
//
ID Intron 2(1),Intron 2(1); standard; MUTATION;
Accession C0108
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code Family 1, II:3
Description Allele 1 and 2: a point mutation in the intron 2 leading to
Description aberrant splicing
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15606524
RefAuthors Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar,
RefAuthors K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A.,
RefAuthors Thakker, N. S.
RefTitle Coinheritance of two rare genodermatoses (papillon-
RefTitle lefèvre syndrome and oculocutaneous albinism type 1) in
RefTitle two families: a genetic study.
RefLoc Br J Dermatol 151:1261-1265 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms Typical PLS and OCA1 albinism
Sex XX
Ethnic origin Caucasoid; Egypt
Parents Consanguineous
Family history Inherited
Comment Patient has also a homozygous mutation in OCA1 gene TYR,
Comment NP000363.1:c.817G>C, p.Trp272C
//
ID Intron 2(2a),Intron 2(2a); standard; MUTATION;
Accession C0109
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code Family 2, II:1
Description Allele 1 and 2: a point mutation in the intron 2 leading to
Description aberrant splicing
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15606524
RefAuthors Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar,
RefAuthors K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A.,
RefAuthors Thakker, N. S.
RefTitle Coinheritance of two rare genodermatoses (papillon-
RefTitle lefèvre syndrome and oculocutaneous albinism type 1) in
RefTitle two families: a genetic study.
RefLoc Br J Dermatol 151:1261-1265 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms Typical PLS and OCA1 albinism
Age 20
Sex XY
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0110; brother
Relative CTSCbase; C0111; sister
Comment Patient has also a homozygous mutation in OCA1 gene TYR,
Comment NP000363.1:c.817G>C, p.Trp272C
//
ID Intron 2(2b),Intron 2(2b); standard; MUTATION;
Accession C0110
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code Family 2, II:2
Description Allele 1 and 2: a point mutation in the intron 2 leading to
Description aberrant splicing
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15606524
RefAuthors Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar,
RefAuthors K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A.,
RefAuthors Thakker, N. S.
RefTitle Coinheritance of two rare genodermatoses (papillon-
RefTitle lefèvre syndrome and oculocutaneous albinism type 1) in
RefTitle two families: a genetic study.
RefLoc Br J Dermatol 151:1261-1265 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms Typical PLS and OCA1 albinism
Sex XY
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0109; brother
Relative CTSCbase; C0111; sister
Comment Patient has also a homozygous mutation in OCA1 gene TYR,
Comment NP000363.1:c.817G>C, p.Trp272C
//
ID Intron 2(2c),Intron 2(2c); standard; MUTATION;
Accession C0111
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code Family 2, II:3
Description Allele 1 and 2: a point mutation in the intron 2 leading to
Description aberrant splicing
Date 14-Apr-2005 (Rel. 1, Created)
Date 14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15606524
RefAuthors Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar,
RefAuthors K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A.,
RefAuthors Thakker, N. S.
RefTitle Coinheritance of two rare genodermatoses (papillon-
RefTitle lefèvre syndrome and oculocutaneous albinism type 1) in
RefTitle two families: a genetic study.
RefLoc Br J Dermatol 151:1261-1265 (2004)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 26216
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms Typical PLS
Sex XX
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0109; brother
Relative CTSCbase; C0110; brother
//
ID Intron 3(1),Intron 3(1); standard; MUTATION;
Accession C0003
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code Family 3
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 26-Jan-2005 (Rel. 1, Created)
Date 26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10581027
RefAuthors Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick,
RefAuthors D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E.,
RefAuthors Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar,
RefAuthors K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A.,
RefAuthors Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker,
RefAuthors N. S.
RefTitle Loss-of-function mutations in the cathepsin C gene result
RefTitle in periodontal disease and palmoplantar keratosis.
RefLoc Nat Genet 23:421-424 (1999)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
//
ID Intron 3(2a),Intron 3(2a); standard; MUTATION;
Accession C0077
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code III-1
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11914041
RefAuthors Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P.
RefAuthors S.
RefTitle Demonstration of altered splicing with the IVS3-1G -->
RefTitle a mutation of cathepsin C.
RefLoc Mol Genet Metab 75:280-283 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
Diagnosis Papillon-Lefevre syndrome
Sex XY
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0078 cousin
Relative CTSCbase; C0079 cousin
Relative CTSCbase; C0080 cousin
Relative CTSCbase; C0081 cousin
//
ID Intron 3(2b),Intron 3(2b); standard; MUTATION;
Accession C0078
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code III-3
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11914041
RefAuthors Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P.
RefAuthors S.
RefTitle Demonstration of altered splicing with the IVS3-1G -->
RefTitle a mutation of cathepsin C.
RefLoc Mol Genet Metab 75:280-283 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0077 cousin
Relative CTSCbase; C0079 sister
Relative CTSCbase; C0080 sister
Relative CTSCbase; C0081 sister
//
ID Intron 3(2c),Intron 3(2c); standard; MUTATION;
Accession C0079
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code III-4
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11914041
RefAuthors Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P.
RefAuthors S.
RefTitle Demonstration of altered splicing with the IVS3-1G -->
RefTitle a mutation of cathepsin C.
RefLoc Mol Genet Metab 75:280-283 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0077 cousin
Relative CTSCbase; C0078 sister
Relative CTSCbase; C0080 sister
Relative CTSCbase; C0081 sister
//
ID Intron 3(2d),Intron 3(2d); standard; MUTATION;
Accession C0080
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code III-7
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11914041
RefAuthors Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P.
RefAuthors S.
RefTitle Demonstration of altered splicing with the IVS3-1G -->
RefTitle a mutation of cathepsin C.
RefLoc Mol Genet Metab 75:280-283 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0077 cousin
Relative CTSCbase; C0078 sister
Relative CTSCbase; C0079 sister
Relative CTSCbase; C0081 sister
//
ID Intron 3(2e),Intron 3(2e); standard; MUTATION;
Accession C0081
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code III-10
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 04-Feb-2005 (Rel. 1, Created)
Date 04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11914041
RefAuthors Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P.
RefAuthors S.
RefTitle Demonstration of altered splicing with the IVS3-1G -->
RefTitle a mutation of cathepsin C.
RefLoc Mol Genet Metab 75:280-283 (2002)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0022: 417..583
Feature /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature /change: agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature /change: ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature /change: gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature /change: aggaaaa
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature /change: ENVYVNTAHL KNSQEK
Feature /change: ->
Feature /change: VFX
Diagnosis Papillon-Lefevre syndrome
Sex XX
Ethnic origin Caucasoid; Jordan
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0077 cousin
Relative CTSCbase; C0078 sister
Relative CTSCbase; C0079 sister
Relative CTSCbase; C0080 sister
//
ID Intron 3(3a),Intron 3(3a); standard; MUTATION;
Accession C0113
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code Case 1
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 11-Jan-2006 (Rel. 1, Created)
Date 11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16301152
RefAuthors Hattab, F. N., Amin, W. M.
RefTitle Papillon-lefèvre syndrome with albinism: a review of the
RefTitle literature and report of 2 brothers.
RefLoc Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc 100:709-716 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS and OCA1
Sex XY
Ethnic origin Caucasoid; Jordania
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0114; brother
Relative CTSCbase; C0115; sister
Comment Patient has also a homozygous c.817G>C/p.W272C mutation in
Comment tyrosinase gene
//
ID Intron 3(3b),Intron 3(3b); standard; MUTATION;
Accession C0114
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code Case 2
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 11-Jan-2006 (Rel. 1, Created)
Date 11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16301152
RefAuthors Hattab, F. N., Amin, W. M.
RefTitle Papillon-lefèvre syndrome with albinism: a review of the
RefTitle literature and report of 2 brothers.
RefLoc Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc 100:709-716 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS and OCA1
Sex XY
Ethnic origin Caucasoid; Jordania
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0113; brother
Relative CTSCbase; C0115; sister
Comment Patient has also a homozygous c.817G>C/p.W272C mutation in
Comment tyrosinase gene
//
ID Intron 3(3c),Intron 3(3c); standard; MUTATION;
Accession C0115
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Description Allele 1 and 2: a point mutation in the intron 3 leading to
Description an amino acid change
Date 11-Jan-2006 (Rel. 1, Created)
Date 11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16301152
RefAuthors Hattab, F. N., Amin, W. M.
RefTitle Papillon-lefèvre syndrome with albinism: a review of the
RefTitle literature and report of 2 brothers.
RefLoc Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc 100:709-716 (2005)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0022: 29452
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Diagnosis Papillon-Lefevre syndrome
Symptoms PLS
Sex XX
Ethnic origin Caucasoid; Jordania
Parents Consanguineous
Family history Inherited
Relative CTSCbase; C0113; brother
Relative CTSCbase; C0114; brother
Comment Patient has also a heterozygous c.817G>C/p.W272C mutation
Comment in tyrosinase gene
//
//
|
