ID-bases-logo
- databases for immunodeficiency-causing variations

   CTSCbase
   Variation registry for  Papillon-Lefevre syndrome


Database        CTSCbase
Version         1.0
File            ctscpub.html
Date            08-Mar-2012
Curator         Mauno Vihinen
Address         Protein Structure and Bioinformatics 
Address         Lund University, BMC D10, SE-22184 Lund, Sweden
Phone           +46 72 526 0022
Fax             +46 46 222 9328
Email           Mauno Vihinen
URL             http://structure.bmc.lu.se/idbase/CTSCbase/
IDR factfile    http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF154.html
Gene            CTSC
Disease         Papillon-Lefevre syndrome 
OMIM            602365
GDB             642234
Sequence        IDRefSeq:D0022; IDRefSeq:C0022; UniProt:P53634 
Numbering       start of the entry
Funding         Tampere University Hospital Medical Research Fund
Funding         European Union
Comments        sequence entry reference in every entry
//
ID              #L7X64(1),#L7X64(1); standard; MUTATION;
Accession       C0136
Systematic name Allele 1 and 2: g.1119delG, c.21delG, r.21delg, p.Leu7fsX58
Description     Allele 1 and 2: A frame shift deletion mutation in the exon
Description     1 leading to a premature stop codon
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 20236208
RefAuthors      Kurban, M., Cheng, T., Wajid, M., Kiuru, M., Shimomura, 
RefAuthors      Y., Christiano, A. M.
RefTitle        A novel mutation in the cathepsin C gene in a pakistani 
RefTitle        family with papillon-lefevre syndrome.
RefLoc          J Eur Acad Dermatol Venereol:L (2010)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 1119
Feature           /change: -g
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 119
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 7
Feature           /change: L -> 
Feature           /change: FCSPPSCCFS PATAPCAATH LPTAPILTCW APGSSRWAPA
Feature           /change: VPSAMSTARL WDHKKKKX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 1119
Feature           /change: -g
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 119
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 7
Feature           /change: L -> 
Feature           /change: FCSPPSCCFS PATAPCAATH LPTAPILTCW APGSSRWAPA
Feature           /change: VPSAMSTARL WDHKKKKX
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Thickening of skin in palms and soles, two episodes of
Symptoms        severe gingivitis, postaxial polydactyly, loss of teeth
Age             35
Sex             XY
Ethnic origin   Pakistan
Parents         Consanguineous
Comment         Patient's brother and sister reported the same features.
//
ID              C24X(1a),C24X(1a); standard; MUTATION;
Accession       C0056
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   F1
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Morocco
Parents         Consanguineous
Relative        CTSCbase; C0057 brother
Relative        CTSCbase; C0058 sister
Relative        CTSCbase; C0059 sister
//
ID              C24X(1b),C24X(1b); standard; MUTATION;
Accession       C0057
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   F1
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Morocco
Parents         Consanguineous
Relative        CTSCbase; C0056 brother
Relative        CTSCbase; C0058 sister
Relative        CTSCbase; C0059 sister
//
ID              C24X(1c),C24X(1c); standard; MUTATION;
Accession       C0058
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   F1
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Morocco
Parents         Consanguineous
Relative        CTSCbase; C0056 brother
Relative        CTSCbase; C0057 brother
Relative        CTSCbase; C0059 sister
//
ID              C24X(1d),C24X(1d); standard; MUTATION;
Accession       C0059
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   F1
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Morocco
Parents         Consanguineous
Relative        CTSCbase; C0056 brother
Relative        CTSCbase; C0057 brother
Relative        CTSCbase; C0058 sister
//
ID              C24X(2),C24X(2); standard; MUTATION;
Accession       C0093
Systematic name Allele 1 and 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   Family 2; II-11
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            08-Feb-2005 (Rel. 1, Created)
Date            08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12809647
RefAuthors      Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle        A genetic study of cathepsin C gene in two families with 
RefTitle        papillon-lefèvre syndrome.
RefLoc          Mol Genet Metab 79:146-148 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Spain (Salamanca)
Parents         Consanguineous
Family history  Inherited
//
ID              G139R(2a),C24X(3a); standard; MUTATION;
Accession       C0098
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   Family 12; II-2
Description     Allele 1: a point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Family history  Inherited
Relative        CTSCbase; C0099 brother
Relative        CTSCbase; C0100 sister
Relative        CTSCbase; C0101 son
//
ID              G139R(2b),C24X(3b); standard; MUTATION;
Accession       C0099
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   Family 12; II-3
Description     Allele 1: a point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Family history  Inherited
Relative        CTSCbase; C0098 sister
Relative        CTSCbase; C0100 sister
Relative        CTSCbase; C0101 nephew
//
ID              G139R(2c),C24X(3c); standard; MUTATION;
Accession       C0100
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.1170C>A, c.72C>A, r.72c>a, p.Cys24X
Original code   Family 12; II-6
Description     Allele 1: a point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1170
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 170
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 24
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Family history  Inherited
Relative        CTSCbase; C0098 sister
Relative        CTSCbase; C0099 brother
Relative        CTSCbase; C0101 nephew
//
ID              C30X(1),C30X(1); standard; MUTATION;
Accession       C0112
Systematic name Allele 1 and 2: g.1188C>A, c.90C>A, r.90c>a, p.Cys30X
Original code   5-year-old Thai male
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            10-Aug-2005 (Rel. 1, Created)
Date            10-Aug-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15857086
RefAuthors      Nitta, H., Wara-Aswapati, N., Lertsirivorakul, J., 
RefAuthors      Nakamura, T., Yamamoto, M., Izumi, Y., Nakamura, T., 
RefAuthors      Ishikawa, I.
RefTitle        A novel mutation of the cathepsin C gene in a thai family 
RefTitle        with papillon-lefevre syndrome.
RefLoc          J Periodontol 76:492-496 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1188
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 188
Feature           /codon: tgc -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 30
Feature           /change: C -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1188
Feature           /change: c -> a
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 188
Feature           /codon: tgc -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 30
Feature           /change: C -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Mongoloid; Thailand
Family history  Inherited
//
ID              Y32X(1),H127P(1); standard; MUTATION;
Accession       C0069
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.26278A>C, c.380A>C, r.380a>c, p.His127Pro
Original code   F7
Description     Allele 1: a point mutation in the exon 1 leading to a
Description     premature stop codon
Description     Allele 2: a point mutation in the exon 3 leading to an
Description     amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1194
Feature           /change: t -> g
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 194
Feature           /codon: tat -> tag; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 32
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26278
Feature           /change: a -> c
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 478
Feature           /codon: cat -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 127
Feature           /change: H -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; France
Parents         Non-consanguineous
//
ID              Y32X(2),Y32X(2); standard; MUTATION;
Accession       C0074
Systematic name Allele 1 and 2: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Original code   Family 1; II:3
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12112662
RefAuthors      Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J., 
RefAuthors      Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle        Biochemical and mutational analyses of the cathepsin c 
RefTitle        gene (CTSC) in three north american families with papillon 
RefTitle        lefèvre syndrome.
RefLoc          Hum Mutat 20:75 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1194
Feature           /change: t -> g
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 194
Feature           /codon: tat -> tag; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 32
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1194
Feature           /change: t -> g
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 194
Feature           /codon: tat -> tag; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 32
Feature           /change: Y -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Mexico
Family history  Inherited
//
ID              Y32X(3),R272P(5); standard; MUTATION;
Accession       C0075
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   Family 2; II:1
Description     Allele 1: a point mutation in the exon 1 leading to a
Description     premature stop codon
Description     Allele 2: a point mutation in the exon 6 leading to an
Description     amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12112662
RefAuthors      Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J., 
RefAuthors      Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle        Biochemical and mutational analyses of the cathepsin c 
RefTitle        gene (CTSC) in three north american families with papillon 
RefTitle        lefèvre syndrome.
RefLoc          Hum Mutat 20:75 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1194
Feature           /change: t -> g
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 194
Feature           /codon: tat -> tag; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 32
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; North Carolina
Family history  Inherited
//
ID              Y32X(4),R272P(6); standard; MUTATION;
Accession       C0089
Systematic name Allele 1: g.1194T>G, c.96T>G, r.96u>g, p.Tyr32X
Systematic name Allele 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   Pt2
Description     Allele 1: a point mutation in the exon 1 leading to a
Description     premature stop codon
Description     Allele 2: a point mutation in the exon 6 leading to an
Description     amino acid change
Date            08-Feb-2005 (Rel. 1, Created)
Date            08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15585850
RefAuthors      Pham, C. T., Ivanovich, J. L., Raptis, S. Z., Zehnbauer, 
RefAuthors      B., Ley, T. J.
RefTitle        Papillon-lefevre syndrome: correlating the molecular, 
RefTitle        cellular, and clinical consequences of cathepsin 
RefTitle        c/dipeptidyl peptidase I deficiency in humans.
RefLoc          J Immunol 173:7277-7281 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1194
Feature           /change: t -> g
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 194
Feature           /codon: tat -> tag; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 32
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; North America
Parents         Non-consanguineous
//
ID              #T38X63(1),S284N(1); standard; MUTATION;
Accession       C0124
Systematic name Allele 1: g.1211_1214delCCTG, c.113_116delCCTG,
Systematic name r.113_116delccug, p.Thr38fsX26
Systematic name Allele 2: g.42600G>A, c.851G>A, r.851g>a, p.Ser284Asn
Original code   Patient 2
Description     Allele 1: A frame shift deletion mutation in the exon 1
Description     leading to a premature stop codon
Description     Allele 2: A point mutation in the exon 6 leading to an
Description     amino acid change
Date            27-Sep-2007 (Rel. 1, Created)
Date            27-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17652201
RefAuthors      Yang, Y., Bai, X., Liu, H., Li, L., Cao, C., Ge, L.
RefTitle        Novel mutations of cathepsin C gene in two chinese 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Dent Res:735-738 (2007)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 1211..1214
Feature           /change: -cctg
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 211..214
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 38..39
Feature           /change: TW -> RSSRWAPAVP SAMSTARLWD HKKKKX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42600
Feature           /change: g -> a
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 949
Feature           /codon: agc -> aac; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 284
Feature           /change: S -> N
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Early-onset periodontitis and severe, extensive
Symptoms        hyperceratotic lesions, involving knuckles, knees,
Symptoms        buttocks, and rump, in addition to palmoplantar
Symptoms        hyperceratosis
Sex             XY
Ethnic origin   Mongoloid; China
Parents         Non-consanguineous
Family history  Inherited
//
ID              W39S(1a),W39S(1a); standard; MUTATION;
Accession       C0048
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code   Family 1; I-2
Description     Allele 1 and 2: a point mutation in the exon 1 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Puerto Rico
Parents         Consanguineous
Relative        CTSCbase; C0049 sister
Relative        CTSCbase; C0050 sister
Relative        CTSCbase; C0051 brother
//
ID              W39S(1b),W39S(1b); standard; MUTATION;
Accession       C0049
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code   Family 1; I-3
Description     Allele 1 and 2: a point mutation in the exon 1 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Puerto Rico
Parents         Consanguineous
Relative        CTSCbase; C0048 sister
Relative        CTSCbase; C0050 sister
Relative        CTSCbase; C0051 brother
//
ID              W39S(1c),W39S(1c); standard; MUTATION;
Accession       C0050
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code   Family 1; I-4
Description     Allele 1 and 2: a point mutation in the exon 1 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Puerto Rico
Parents         Consanguineous
Relative        CTSCbase; C0048 sister
Relative        CTSCbase; C0049 sister
Relative        CTSCbase; C0051 brother
//
ID              W39S(1d),W39S(1d); standard; MUTATION;
Accession       C0051
Systematic name Allele 1 and 2: g.1214G>C, c.116G>C, r.116g>c, p.Trp39Ser
Original code   Family 1; I-5
Description     Allele 1 and 2: a point mutation in the exon 1 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1214
Feature           /change: g -> c
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 214
Feature           /codon: tgg -> tcg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 39
Feature           /change: W -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Puerto Rico
Parents         Consanguineous
Relative        CTSCbase; C0048 sister
Relative        CTSCbase; C0049 sister
Relative        CTSCbase; C0050 sister
//
ID              Q49X(1a),Q49X(1a); standard; MUTATION;
Accession       C0084
Systematic name Allele 1 and 2: g.1243C>T, c.145C>T, r.145c>u, p.Gln49X
Original code   IISC-PLS1; III-1
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            07-Feb-2005 (Rel. 1, Created)
Date            07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12857359
RefAuthors      Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P., 
RefAuthors      Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle        Mutation analysis of the cathepsin C gene in indian 
RefTitle        families with papillon-lefèvre syndrome.
RefLoc          BMC Med Genet 4:5 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1243
Feature           /change: c -> t
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 243
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 49
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1243
Feature           /change: c -> t
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 243
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 49
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Family history  Inherited
Relative        CTSCbase; C0085 sister
//
ID              Q49X(1b),Q49X(1b); standard; MUTATION;
Accession       C0085
Systematic name Allele 1 and 2: g.1243C>T, c.145C>T, r.145c>u, p.Gln49X
Original code   IISC-PLS1; III-2
Description     Allele 1 and 2: a point mutation in the exon 1 leading to a
Description     premature stop codon
Date            07-Feb-2005 (Rel. 1, Created)
Date            07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12857359
RefAuthors      Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P., 
RefAuthors      Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle        Mutation analysis of the cathepsin C gene in indian 
RefTitle        families with papillon-lefèvre syndrome.
RefLoc          BMC Med Genet 4:5 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1243
Feature           /change: c -> t
Feature           /genomic_region: exon; 1
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 243
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 49
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 1243
Feature           /change: c -> t
Feature           /genomic_region: exon; 1
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 243
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 49
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Family history  Inherited
Relative        CTSCbase; C0084 brother
//
ID              #Y67-8(1),T153I(1); standard; MUTATION;
Accession       C0034
Systematic name Allele 1: g.3715_3738delTACCTTCAGAAGCTGGATACAGCA,
Systematic name c.199_222delTACCTTCAGAAGCTGGATACAGCA,
Systematic name r.199_222deluaccuucagaagcuggauacagca, p.Tyr67_Tyr75del
Systematic name Allele 2: g.26356C>T, c.458C>T, r.458c>u, p.Thr153Ile
Description     Allele 1: an inframe deletion in the exon 2 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 3 leading to an
Description     amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 3715..3738
Feature           /change: -taccttcaga agctggatac agca
Feature           /genomic_region: exon; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 297..320
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 67..74
Feature           /change: -YLQKLDTA
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26356
Feature           /change: c -> t
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 556
Feature           /codon: aca -> ata; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 153
Feature           /change: T -> I
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Scotland
//
ID              Q69X(1a),Q69X(1a); standard; MUTATION;
Accession       C0086
Systematic name Allele 1 and 2: g.3721C>T, c.205C>T, r.205c>u, p.Gln69X
Original code   IISC-PLS2; IV-3
Description     Allele 1 and 2: a point mutation in the exon 2 leading to a
Description     premature stop codon
Date            07-Feb-2005 (Rel. 1, Created)
Date            07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12857359
RefAuthors      Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P., 
RefAuthors      Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle        Mutation analysis of the cathepsin C gene in indian 
RefTitle        families with papillon-lefèvre syndrome.
RefLoc          BMC Med Genet 4:5 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 3721
Feature           /change: c -> t
Feature           /genomic_region: exon; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 303
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 69
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 3721
Feature           /change: c -> t
Feature           /genomic_region: exon; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 303
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 69
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0087 brother
//
ID              Q69X(1b),Q69X(1b); standard; MUTATION;
Accession       C0087
Systematic name Allele 1 and 2: g.3721C>T, c.205C>T, r.205c>u, p.Gln69X
Original code   IISC-PLS2; IV-4
Description     Allele 1 and 2: a point mutation in the exon 2 leading to a
Description     premature stop codon
Date            07-Feb-2005 (Rel. 1, Created)
Date            07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12857359
RefAuthors      Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P., 
RefAuthors      Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle        Mutation analysis of the cathepsin C gene in indian 
RefTitle        families with papillon-lefèvre syndrome.
RefLoc          BMC Med Genet 4:5 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 3721
Feature           /change: c -> t
Feature           /genomic_region: exon; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 303
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 69
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 3721
Feature           /change: c -> t
Feature           /genomic_region: exon; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 303
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 69
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; India
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0086 sister
//
ID              K108X(1),#S146X175(1); standard; MUTATION;
Accession       C0127
Systematic name Allele 1: g.26220A>T, c.322A>T, r.322a>u, p.Lys108X
Systematic name Allele 2: g.26334delT, c.436delT, r.436delu, p.Ser146fsX30
Description     Allele 1: A point mutation in the exon 3 leading to a
Description     premature stop codon
Description     Allele 2: A frame shift deletion mutation in the exon 3
Description     leading to a premature stop codon
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26220
Feature           /change: a -> t
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 420
Feature           /codon: aaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 108
Feature           /change: K -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 26334
Feature           /change: -t
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 534
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 146
Feature           /change: S -> LRMCMSTQHT LRILRKSILI GSTSMITTLX
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Agressive periodontitis
Ethnic origin   Germany
Parents         Non-consanguineous
//
ID              K108X(2),Y168X(1); standard; MUTATION;
Accession       C0137
Systematic name Allele 1: g.26220A>T, c.322A>T, r.322a>u, p.Lys108X
Systematic name Allele 2: g.29471C>G, c.504C>G, r.504c>g, p.Tyr168X
Description     Allele 1: A point mutation in the exon 3 leading to a
Description     premature stop codon
Description     Allele 2: A point mutation in the exon 4 leading to a
Description     premature stop codon
Date            13-Feb-2012 (Rel. 1, Created)
Date            13-Feb-2012 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefLoc          Submitted (13-Feb-2012) to CTSCbase.
RefLoc          Juan-Manuel Morillo-VelAnzquez; Department of
RefLoc          Periodontology, Facultad de Odontologia, Lund University
RefLoc          Sevilla, c/Avicena s/n, 41009 Sevilla, Spain; e-mail
RefLoc          juanm.morillo@gmail.com
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26220
Feature           /change: a -> t
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 420
Feature           /codon: aaa -> taa; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 108
Feature           /change: K -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29471
Feature           /change: c -> g
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 602
Feature           /codon: tac -> tag; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 168
Feature           /change: Y -> X
Diagnosis       Papillon-Lefevre syndrome
Symptoms        The proband in this family was a 3 years-old boy with
Symptoms        periodontal features in primary dentition and
Symptoms        hyperkeratosis in the palmoplantar region and on his
Symptoms        elbows. He also had a history of skin abscesses.
Age             3
Sex             XY
Ethnic origin   Caucasoid; Italy
Parents         Non-consanguineous
Family history  Inherited
Relative        His father and brother were healthy. His mother showed mild
Relative        hyperkeratosis in her palms with no signs of periodontitis.
Comment         Both CTSC mutations are c322A>T (K108X) (420 in this
Comment         website) and c504C>G (Y168X) (602 in this website),
Comment         numbered according to reference cDNA sequence NM_001814.4
Comment         and reference protein sequence NP_001805. One of these
Comment         (c504C>G) is a novel mutation.
//
ID              #T189X199(2),#T189X199(2); standard; MUTATION;
Accession       C0128
Systematic name Allele 1 and 2: g.29533_29539delCATACAT,
Systematic name c.566_572delCATACAT, r.566_572delcauacau, p.Thr189fsX11
Description     Allele 1 and 2: A frame shift deletion mutation in the exon
Description     4 leading to a premature stop codon
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29533..29539
Feature           /change: -catacat
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature           /change: TYM -> RNMRLLPWEI X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29533..29539
Feature           /change: -catacat
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature           /change: TYM -> RNMRLLPWEI X
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms        premature teeth loss
Ethnic origin   Germany
Parents         Consanguineous
//
ID              #T189X199(3),R210X(3); standard; MUTATION;
Accession       C0129
Systematic name Allele 1: g.29533_29539delCATACAT, c.566_572delCATACAT,
Systematic name r.566_572delcauacau, p.Thr189fsX11
Systematic name Allele 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Description     Allele 1: A frame shift deletion mutation in the exon 4
Description     leading to a premature stop codon
Description     Allele 2: A point mutation in the exon 4 leading to a
Description     premature stop codon
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29533..29539
Feature           /change: -catacat
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 664..670
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature           /change: TYM -> RNMRLLPWEI X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
Diagnosis       Papillon-Lefevre syndrome
Symptoms        palmoplantar hyperkeratosis, aggressive periodontitis
Ethnic origin   Russia
//
ID              @A253X282(1),@A253X282(1); standard; MUTATION;
Accession       C0126
Systematic name Allele 1 and 2: g.38241G>A, c.756_757ins130,
Systematic name r.756_757ins, p.Ala253fsX30
Original code   Patient 2
Description     Allele 1 and 2: A point mutation in the exon 5 leading to 
Description     aberrant splicing and to a premature stop codon
Date            26-Oct-2007 (Rel. 1, Created)
Date            26-Oct-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17943190
RefAuthors      Jouary, T., Goizet, C., Coupry, I., Redonnet-Vernhet, I., 
RefAuthors      Levade, T., Burgelin, I., Toutain, A., Delaporte, E., 
RefAuthors      Douillard, C., Lacombe, D., Taieb, A., Arveiler, B.
RefTitle        Detection of an intragenic deletion expands the spectrum 
RefTitle        of CTSC mutations in papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol (2007)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38241
Feature           /change: g -> a
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: splicing; gain of intron sequence
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 855
Feature           /change: +agtaaaaaaa taagcctaag ttttttgtta atttgtttgg
Feature           /change:  aactatttat tgaacagttg ctctgtgtga tggatttcgg
Feature           /change:  ggatacctag atggaatggg catgatcccc tttttacaga
Feature           /change:  aatagaaaat
Feature           /note:  predicted effect, not confirmed
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 253
Feature           /change: A -> SKKISLSFLL ICLELFIEQL LCVMDFGDTX
Feature           /note:  predicted effect, not confirmed
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38241
Feature           /change: g -> a
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: splicing; gain of intron sequence
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 855
Feature           /change: +agtaaaaaaa taagcctaag ttttttgtta atttgtttgg
Feature           /change:  aactatttat tgaacagttg ctctgtgtga tggatttcgg
Feature           /change:  ggatacctag atggaatggg catgatcccc tttttacaga
Feature           /change:  aatagaaaat
Feature           /note:  predicted effect, not confirmed
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 253
Feature           /change: A -> SKKISLSFLL ICLELFIEQL LCVMDFGDTX
Feature           /note:  predicted effect, not confirmed
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Palmoplantar keratoderma, severe periodontitis
Sex             XX
Ethnic origin   Moroccan
Parents         Consanguineous
//
ID              R272P(8),R272P(8); standard; MUTATION;
Accession       C0130
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Description     Allele 1 and 2: A point mutation in the exon 6 leading to
Description     an amino acid change
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms        premature tooth loss
Ethnic origin   Turkey
//
ID              P285L(1),P285L(1); standard; MUTATION;
Accession       C0131
Systematic name Allele 1 and 2: g.42603C>T, c.854C>T, r.854c>u, p.Pro285Leu
Description     Allele 1 and 2: A point mutation in the exon 6 leading to
Description     an amino acid change
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42603
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 952
Feature           /codon: cct -> ctt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 285
Feature           /change: P -> L
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42603
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 952
Feature           /codon: cct -> ctt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 285
Feature           /change: P -> L
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Palmoplantar hyperkeratosis, aggressive periodontitis,
Symptoms        premature tooth loss
Ethnic origin   Morocco
Parents         Consanguineous
//
ID              G297V(1),G308E(1); standard; MUTATION;
Accession       C0135
Systematic name Allele 1: g.44263G>T, c.890G>T, r.890g>u, p.Gly297Val
Systematic name Allele 2: g.44296G>A, c.923G>A, r.923g>a, p.Gly308Glu
Description     Allele 1: A point mutation in the exon 7 leading to an
Description     amino acid change
Description     Allele 2: A point mutation in the exon 7 leading to an
Description     amino acid change
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44263
Feature           /change: g -> t
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 988
Feature           /codon: ggc -> gtc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 297
Feature           /change: G -> V
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44296
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1021
Feature           /codon: gga -> gaa; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 308
Feature           /change: G -> E
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Pyoderma, premature tooth loss, gingival inflammation and
Symptoms        recession, tooth mobility, xerotic palmar skin, polymorphic
Symptoms        scarring lessions on buttocks, thighs and calves
Age             24
Sex             XX
Ethnic origin   Italy
Parents         Non-consanguineous
Comment         Isotretinoin improved the skin infections and plantar
Comment         keratoderma
//
ID              G301S(4),G301S(4); standard; MUTATION;
Accession       C0132
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Description     Allele 1 and 2: A point mutation in the exon 7 leading to
Description     an amino acid change
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Palmoplantar hyperkeratosis, aggressive periodontitis
Ethnic origin   Germany
Parents         Non-consanguineous
//
ID              G386R(1),Deletion(1); standard; MUTATION;
Accession       C0125
Systematic name Allele 1: g.44529G>C, c.1156G>C, r.1156g>c, p.Gly386Arg
Original code   Patient 1
Description     Allele 1: A point mutation in the exon 7 leading to an
Description     amino acid change
Description     Allele 2: A large intragenic deletion involving exons 3-7 
Date            26-Oct-2007 (Rel. 1, Created)
Date            26-Oct-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17943190
RefAuthors      Jouary, T., Goizet, C., Coupry, I., Redonnet-Vernhet, I., 
RefAuthors      Levade, T., Burgelin, I., Toutain, A., Delaporte, E., 
RefAuthors      Douillard, C., Lacombe, D., Taieb, A., Arveiler, B.
RefTitle        Detection of an intragenic deletion expands the spectrum 
RefTitle        of CTSC mutations in papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol (2007)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44529
Feature           /change: g -> c
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1254
Feature           /codon: ggg -> cgg; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 386
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: unknown
Feature           /note: a large deletion involving exons 3-7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Severe periodontitis and keratoderma, multiple cutaneous
Symptoms        abscesses
Sex             XX
Ethnic origin   Caucasoid
//
ID              G139R(1),#L381X393(2); standard; MUTATION;
Accession       C0076
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code   Family 3; II:1
Description     Allele 1: a point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: a frame shift deletion in the exon 7 leading to a
Description     premature stop codon
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12112662
RefAuthors      Zhang, Y., Hart, P. S., Moretti, A. J., Bouwsma, O. J., 
RefAuthors      Fisher, E. M., Dudlicek, L., Pettenati, M. J., Hart, T. C.
RefTitle        Biochemical and mutational analyses of the cathepsin c 
RefTitle        gene (CTSC) in three north american families with papillon 
RefTitle        lefèvre syndrome.
RefLoc          Hum Mutat 20:75 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44514
Feature           /change: -c
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1239
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 381
Feature           /change: L -> STTKRGSTTT LVX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Texas
Family history  Inherited
//
ID              G139R(2d),D236Y(1); standard; MUTATION;
Accession       C0101
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.38190G>T, c.706G>T, r.706g>u, p.Asp236Tyr
Original code   Family 12; III-1
Description     Allele 1: a point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 5 leading to an
Description     amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38190
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 804
Feature           /codon: gac -> tac; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 236
Feature           /change: D -> Y
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Family history  Inherited
Relative        CTSCbase; C0098 mother
Relative        CTSCbase; C0099 uncle
Relative        CTSCbase; C0100 aunt
//
ID              G139R(3a),G139R(3a); standard; MUTATION;
Accession       C0120
Systematic name Allele 1 and 2: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Original code   Case 1
Description     Allele 1 and 2: a point mutation in the exon 3 leading to
Description     an amino acid change
Date            21-Jun-2006 (Rel. 1, Created)
Date            21-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16332247
RefAuthors      Cagli, N. A., Hakki, S. S., Dursun, R., Toy, H., Gokalp, 
RefAuthors      A., Ryu, O. H., Hart, P. S., Hart, T. C.
RefTitle        Clinical, genetic, and biochemical findings in two 
RefTitle        siblings with papillon-lefèvre syndrome.
RefLoc          J Periodontol 76:2322-2329 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Relative        CTSCbase; C0121 sister
Comment         the patient is homozygous for the T153I polymorphism
//
ID              G139R(3b),G139R(3b); standard; MUTATION;
Accession       C0121
Systematic name Allele 1 and 2: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Original code   Case 2
Description     Allele 1 and 2: a point mutation in the exon 3 leading to
Description     an amino acid change
Date            21-Jun-2006 (Rel. 1, Created)
Date            21-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16332247
RefAuthors      Cagli, N. A., Hakki, S. S., Dursun, R., Toy, H., Gokalp, 
RefAuthors      A., Ryu, O. H., Hart, P. S., Hart, T. C.
RefTitle        Clinical, genetic, and biochemical findings in two 
RefTitle        siblings with papillon-lefèvre syndrome.
RefLoc          J Periodontol 76:2322-2329 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Relative        CTSCbase; C0120 sister
Comment         the patient is homozygous for the T153I polymorphism
//
ID              G139R(4),S260P(1); standard; MUTATION;
Accession       C0123
Systematic name Allele 1: g.26313G>A, c.415G>A, r.415g>a, p.Gly139Arg
Systematic name Allele 2: g.42527T>C, c.778T>C, r.778u>c, p.Ser260Pro
Original code   Patient 1
Description     Allele 1: A point mutation in the exon 3 leading to an
Description     amino acid change
Description     Allele 2: A point mutation in the exon 6 leading to an
Description     amino acid change
Date            27-Sep-2007 (Rel. 1, Created)
Date            27-Sep-2007 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 17652201
RefAuthors      Yang, Y., Bai, X., Liu, H., Li, L., Cao, C., Ge, L.
RefTitle        Novel mutations of cathepsin C gene in two chinese 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Dent Res:735-738 (2007)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26313
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 513
Feature           /codon: gga -> aga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 139
Feature           /change: G -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42527
Feature           /change: t -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 876
Feature           /codon: tca -> cca; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 260
Feature           /change: S -> P
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Early-onset periodontitis and palmoplantar hyperceratosis,
Symptoms        recurrent respiratory infections, indicating an increased
Symptoms        susceptibility to bacterial infection
Sex             XY
Ethnic origin   Mongoloid; China
Parents         Non-consanguineous
Family history  Inherited
//
ID              @V149X158(1),@V149X158(1); standard; MUTATION;
Accession       C0036
Systematic name Allele 1 and 2: g.26342_26343insATGT, c.444_445insATGT,
Systematic name r.444_445insaugu, p.Val149fsX10
Description     Allele 1 and 2: a frame shift insertion mutation in the
Description     exon 3 leading to a premature stop codon
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: insertion
Feature           /loc: IDRefSeq: D0022: 26343
Feature           /change: +atgt
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 543
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 149
Feature           /change: V -> MCVCQHSTPX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: insertion
Feature           /loc: IDRefSeq: D0022: 26343
Feature           /change: +atgt
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 543
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 149
Feature           /change: V -> MCVCQHSTPX
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Bengali
Parents         Consanguineous
//
ID              T153I(2),T153I(2); standard; MUTATION;
Accession       C0035
Systematic name Allele 1 and 2: g.26356C>T, c.458C>T, r.458c>u, p.Thr153Ile
Description     Allele 1 and 2: a point mutation in the exon 3 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26356
Feature           /change: c -> t
Feature           /genomic_region: exon; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 556
Feature           /codon: aca -> ata; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 153
Feature           /change: T -> I
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26356
Feature           /change: c -> t
Feature           /genomic_region: exon; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 556
Feature           /codon: aca -> ata; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 153
Feature           /change: T -> I
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Egypt
Parents         Consanguineous
//
ID              W185X(1),W185X(1); standard; MUTATION;
Accession       C0073
Systematic name Allele 1 and 2: g.29522G>A, c.555G>A, r.555g>a, p.Trp185X
Original code   IV-2
Description     Allele 1 and 2: a point mutation in the exon 4 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12083812
RefAuthors      Hart, P. S., Pallos, D., Zhang, Y., Sanchez, J., Kavamura, 
RefAuthors      I., Brunoni, D., Hart, T. C.
RefTitle        Identification of a novel cathepsin C mutation (p.W185X) 
RefTitle        in a brazilian kindred with papillon-lefèvre syndrome.
RefLoc          Mol Genet Metab 76:145-147 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29522
Feature           /change: g -> a
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 653
Feature           /codon: tgg -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 185
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29522
Feature           /change: g -> a
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 653
Feature           /codon: tgg -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 185
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Brazil
Parents         Consanguineous
//
ID              #T189X199(1),#T189X199(1); standard; MUTATION;
Accession       C0082
Systematic name Allele 1 and 2: g.29533_29539delCATACAT,
Systematic name c.566_572delCATACAT, r.566_572delcauacau, p.Thr189fsX11
Description     Allele 1 and 2: a frame shift deletion mutation in the exon
Description     4 leading to a premature stop codon
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15111626
RefAuthors      Noack, B., Gorgens, H., Hoffmann, T., Fanghanel, J., 
RefAuthors      Kocher, T., Eickholz, P., Schackert, H. K.
RefTitle        Novel mutations in the cathepsin C gene in patients with 
RefTitle        pre-pubertal aggressive periodontitis and papillon-
RefTitle        lefèvre syndrome.
RefLoc          J Dent Res 83:368-370 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29533..29539
Feature           /change: -catacat
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 664..670
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature           /change: TYM -> RNMRLLPWEI X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29533..29539
Feature           /change: -catacat
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 664..670
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 189..191
Feature           /change: TYM -> RNMRLLPWEI X
Diagnosis       Prepubertal periodontitis
Sex             XX
Ethnic origin   Caucasoid; German
Parents         Consanguineous
//
ID              L196P(1a),L196P(1a); standard; MUTATION;
Accession       C0104
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code   IV:5
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11922261
RefAuthors      Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L., 
RefAuthors      Loures, C. G., De, M. L.
RefTitle        A novel mutation of the cathepsin C gene in papillon-
RefTitle        lefèvre syndrome.
RefLoc          J Periodontol 73:307-312 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Brazil
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0105 sister
Relative        CTSCbase; C0106 brother
//
ID              L196P(1b),L196P(1b); standard; MUTATION;
Accession       C0105
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code   IV:8
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11922261
RefAuthors      Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L., 
RefAuthors      Loures, C. G., De, M. L.
RefTitle        A novel mutation of the cathepsin C gene in papillon-
RefTitle        lefèvre syndrome.
RefLoc          J Periodontol 73:307-312 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Brazil
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0104 sister
Relative        CTSCbase; C0106 brother
//
ID              L196P(1c),L196P(1c); standard; MUTATION;
Accession       C0106
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code   IV:9
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11922261
RefAuthors      Cury, V. F., Costa, J. E., Gomez, R. S., Boson, W. L., 
RefAuthors      Loures, C. G., De, M. L.
RefTitle        A novel mutation of the cathepsin C gene in papillon-
RefTitle        lefèvre syndrome.
RefLoc          J Periodontol 73:307-312 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Brazil
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0104 sister
Relative        CTSCbase; C0105 sister
//
ID              L196P(2),L196P(2); standard; MUTATION;
Accession       C0107
Systematic name Allele 1 and 2: g.29554T>C, c.587T>C, r.587u>c, p.Leu196Pro
Original code   II:1
Description     Allele 1 and 2: a point mutation in the exon 4 leading to
Description     an amino acid change
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15727652
RefAuthors      Cury, V. F., Gomez, R. S., Costa, J. E., Friedman, E., 
RefAuthors      Boson, W., De Marco, L.
RefTitle        A homozygous cathepsin C mutation associated with haim-
RefTitle        munk syndrome.
RefLoc          Br J Dermatol 152:353-356 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29554
Feature           /change: t -> c
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 685
Feature           /codon: ctt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 196
Feature           /change: L -> P
Diagnosis       Haim-Munk syndrome
Age             19
Sex             XX
Ethnic origin   Caucasoid; Brazil
Parents         Consanguineous
Family history  Inherited
//
ID              @H208X223(1),@H208X223(1); standard; MUTATION;
Accession       C0037
Systematic name Allele 1 and 2: g.29589dupC, c.622dupC, r.622dupc,
Systematic name p.His208fsX16
Description     Allele 1 and 2: a frame shift duplication mutation in the
Description     exon 4 leading to a premature stop codon
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: duplication
Feature           /loc: IDRefSeq: D0022: 29590
Feature           /change: +c
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 721
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 208
Feature           /change: H -> PQSKNPKAQT CTTDCX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: duplication
Feature           /loc: IDRefSeq: D0022: 29590
Feature           /change: +c
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 721
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 208
Feature           /change: H -> PQSKNPKAQT CTTDCX
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS with transgressions of the hyperkeratotic lesions on
Symptoms        elbows/knees
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              R210X(1a),R210X(1a); standard; MUTATION;
Accession       C0009
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code   Family 7; II:1
Description     Allele 1 and 2: a point mutation in the exon 4 leading to a
Description     premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Relative        CTSCbase; C0010 brother
//
ID              R210X(1b),R210X(1b); standard; MUTATION;
Accession       C0010
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code   Family 7; II:2
Description     Allele 1 and 2: a point mutation in the exon 4 leading to a
Description     premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Relative        CTSCbase; C0009 sister
//
ID              R210X(2),R210X(2); standard; MUTATION;
Accession       C0060
Systematic name Allele 1 and 2: g.29595C>T, c.628C>T, r.628c>u, p.Arg210X
Original code   F2
Description     Allele 1 and 2: a point mutation in the exon 4 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29595
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 726
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Algeria
Parents         Consanguineous
//
ID              #R210X222(1),#R210X222(1); standard; MUTATION;
Accession       C0119
Systematic name Allele 1 and 2: g.29596_29597delGA, c.629_630delGA,
Systematic name r.629_630delga, p.Arg210fsX13
Original code   Family 2
Description     Allele 1 and 2: a frame shift deletion mutation in the exon
Description     4 leading to a premature stop codon
Date            20-Jun-2006 (Rel. 1, Created)
Date            20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16460249
RefAuthors      Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle        Description of two new cathepsin C gene mutations in 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Periodontol 77:233-237 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29596..29597
Feature           /change: -ga
Feature           /genomic_region: exon; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 727..728
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> QNPKAQTCTT DCX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 29596..29597
Feature           /change: -ga
Feature           /genomic_region: exon; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 727..728
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 210
Feature           /change: R -> QNPKAQTCTT DCX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Indian
Parents         Non-consanguineous
Family history  Inherited
//
ID              W235X(1),W235X(1); standard; MUTATION;
Accession       C0038
Systematic name Allele 1 and 2: g.38188G>A, c.704G>A, r.704g>a, p.Trp235X
Description     Allele 1 and 2: a point mutation in the exon 5 leading to a
Description     premature stop codon
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38188
Feature           /change: g -> a
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 802
Feature           /codon: tgg -> tag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 235
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38188
Feature           /change: g -> a
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 802
Feature           /codon: tgg -> tag; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 235
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Iran
Parents         Consanguineous
//
ID              D236Y(1),C291Y(1); standard; MUTATION;
Accession       C0054
Systematic name Allele 1: g.38190G>T, c.706G>T, r.706g>u, p.Asp236Tyr
Systematic name Allele 2: g.42621G>A, c.872G>A, r.872g>a, p.Cys291Tyr
Original code   Family 1, C
Description     Allele 1: a point mutation in the exon 5 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 6 leading to an
Description     amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180601
RefAuthors      Allende, L. M., Garcia-Perez, M. A., Moreno, A., Corell, 
RefAuthors      A., Carasol, M., Martinez-Canut, P., Arnaiz-Villena, A.
RefTitle        Cathepsin C gene: first compound heterozygous patient with 
RefTitle        papillon-lefèvre syndrome and a novel symptomless 
RefTitle        mutation.
RefLoc          Hum Mutat 17:152-153 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38190
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 804
Feature           /codon: gac -> tac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 236
Feature           /change: D -> Y
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42621
Feature           /change: g -> a
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 970
Feature           /codon: tgt -> tat; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 291
Feature           /change: C -> Y
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Spain
Parents         Non-consanguineous
//
ID              V249F(1),V249F(1); standard; MUTATION;
Accession       C0004
Systematic name Allele 1 and 2: g.38229G>T, c.745G>T, r.745g>u, p.Val249Phe
Original code   Family 4
Description     Allele 1 and 2: a point mutation in the exon 5 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38229
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 843
Feature           /codon: gtt -> ttt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 249
Feature           /change: V -> F
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38229
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 843
Feature           /codon: gtt -> ttt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 249
Feature           /change: V -> F
Diagnosis       Papillon-Lefevre syndrome
//
ID              R250X(1),R250X(1); standard; MUTATION;
Accession       C0039
Systematic name Allele 1 and 2: g.38232C>T, c.748C>T, r.748c>u, p.Arg250X
Description     Allele 1 and 2: a point mutation in the exon 5 leading to a
Description     premature stop codon
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38232
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 846
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 250
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38232
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 846
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 250
Feature           /change: R -> X
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS with transgressions of the hyperkeratotic lesions on
Symptoms        elbows/knees
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              R250X(2),?; standard; MUTATION;
Accession       C0090
Systematic name Allele 1: g.38232C>T, c.748C>T, r.748c>u, p.Arg250X
Original code   Pt3
Description     Allele 1: a point mutation in the exon 5 leading to a
Description     premature stop codon
Date            08-Feb-2005 (Rel. 1, Created)
Date            08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15585850
RefAuthors      Pham, C. T., Ivanovich, J. L., Raptis, S. Z., Zehnbauer, 
RefAuthors      B., Ley, T. J.
RefTitle        Papillon-lefevre syndrome: correlating the molecular, 
RefTitle        cellular, and clinical consequences of cathepsin 
RefTitle        c/dipeptidyl peptidase I deficiency in humans.
RefLoc          J Immunol 173:7277-7281 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38232
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 846
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 250
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: unknown
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; North America
Parents         Non-consanguineous
//
ID              Q252L(1),Q252L(1); standard; MUTATION;
Accession       C0001
Systematic name Allele 1 and 2: g.38239A>T, c.755A>T, r.755a>u, p.Gln252Leu
Original code   Family 1
Description     Allele 1 and 2: a point mutation in the exon 5 leading to
Description     an amino acid change
Date            25-Jan-2005 (Rel. 1, Created)
Date            25-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38239
Feature           /change: a -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 853
Feature           /codon: caa -> cta; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 252
Feature           /change: Q -> L
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 38239
Feature           /change: a -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 853
Feature           /codon: caa -> cta; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 252
Feature           /change: Q -> L
Diagnosis       Papillon-Lefevre syndrome
//
ID              R272H(1),Y412C(1); standard; MUTATION;
Accession       C0102
Systematic name Allele 1: g.42564G>A, c.815G>A, r.815g>a, p.Arg272His
Systematic name Allele 2: g.44608A>G, c.1235A>G, r.1235a>g, p.Tyr412Cys
Original code   PPP Family 1
Description     Allele 1: a point mutation in the exon 6 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 7 leading to an
Description     amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cat; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44608
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1333
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 412
Feature           /change: Y -> C
Diagnosis       Prepubertal periodontitis
Parents         Consanguineous
//
ID              R272P(1),R272P(1); standard; MUTATION;
Accession       C0011
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   Family 8
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
//
ID              R272P(2),R272P(2); standard; MUTATION;
Accession       C0040
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              R272P(3a),R272P(3a); standard; MUTATION;
Accession       C0061
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   F4
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Holland
Parents         Consanguineous
Relative        CTSCbase; C0062 brother
//
ID              R272P(3b),R272P(3b); standard; MUTATION;
Accession       C0062
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   F4
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Holland
Parents         Consanguineous
Relative        CTSCbase; C0061 sister
//
ID              R272P(4a),#L381X393(1a); standard; MUTATION;
Accession       C0070
Systematic name Allele 1: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code   F8
Description     Allele 1: a point mutation in the exon 6 leading to an
Description     amino acid change
Description     Allele 2: a frame shift deletion in the exon 7 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44514
Feature           /change: -c
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1239
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 381
Feature           /change: L -> STTKRGSTTT LVX
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; France
Parents         Non-consanguineous
Relative        CTSCbase; C0071 brother
//
ID              R272P(4b),#L381X393(1b); standard; MUTATION;
Accession       C0071
Systematic name Allele 1: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Systematic name Allele 2: g.44514delC, c.1141delC, r.1141delc,
Systematic name p.Leu381fsX13
Original code   F8
Description     Allele 1: a point mutation in the exon 6 leading to an
Description     amino acid change
Description     Allele 2: a frame shift deletion in the exon 7 leading to a
Description     premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44514
Feature           /change: -c
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1239
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 381
Feature           /change: L -> STTKRGSTTT LVX
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; France
Parents         Non-consanguineous
Relative        CTSCbase; C0070 brother
//
ID              R272P(7a),R272P(7a); standard; MUTATION;
Accession       C0094
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   Family 1; II-1
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15108292
RefAuthors      de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree, 
RefAuthors      H., Everts, V., Beertsen, W.
RefTitle        Loss-of-function mutations in cathepsin C in two families 
RefTitle        with papillon-lefèvre syndrome are associated with 
RefTitle        deficiency of serine proteinases in PMNs.
RefLoc          Hum Mutat 23:524 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Belgium
Parents         Non-consanguineous
Family history  Inherited
Relative        CTSCbase; C0095 sister
//
ID              R272P(7b),R272P(7b); standard; MUTATION;
Accession       C0095
Systematic name Allele 1 and 2: g.42564G>C, c.815G>C, r.815g>c, p.Arg272Pro
Original code   Family 1; II-2
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15108292
RefAuthors      de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree, 
RefAuthors      H., Everts, V., Beertsen, W.
RefTitle        Loss-of-function mutations in cathepsin C in two families 
RefTitle        with papillon-lefèvre syndrome are associated with 
RefTitle        deficiency of serine proteinases in PMNs.
RefLoc          Hum Mutat 23:524 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42564
Feature           /change: g -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 913
Feature           /codon: cgt -> cct; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 272
Feature           /change: R -> P
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Belgium
Parents         Non-consanguineous
Family history  Inherited
Relative        CTSCbase; C0094 sister
//
ID              Q286R(1a),Q286R(1a); standard; MUTATION;
Accession       C0022
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   12
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Consanguineous
Relative        CTSCbase; C0023 second cousin
Relative        CTSCbase; C0024 second cousin
Relative        CTSCbase; C0025 second cousin
Relative        CTSCbase; C0026 second cousin
Relative        CTSCbase; C0027 second cousin
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1b),Q286R(1b); standard; MUTATION;
Accession       C0023
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   34
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XY
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin
Relative        CTSCbase; C0024 sister
Relative        CTSCbase; C0025 brother
Relative        CTSCbase; C0026 sister
Relative        CTSCbase; C0027 sister
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1c),Q286R(1c); standard; MUTATION;
Accession       C0024
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   33
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin
Relative        CTSCbase; C0023 brother
Relative        CTSCbase; C0025 brother
Relative        CTSCbase; C0026 sister
Relative        CTSCbase; C0027 sister
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1d),Q286R(1d); standard; MUTATION;
Accession       C0025
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   35
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XY
Parents         Non-consanguineous
Parents         Consanguineous
Relative        CTSCbase; C0022 second cousin
Relative        CTSCbase; C0023 brother
Relative        CTSCbase; C0024 sister
Relative        CTSCbase; C0026 sister
Relative        CTSCbase; C0027 sister
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1e),Q286R(1e); standard; MUTATION;
Accession       C0026
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   36
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin
Relative        CTSCbase; C0023 brother
Relative        CTSCbase; C0024 sister
Relative        CTSCbase; C0025 brother
Relative        CTSCbase; C0027 sister
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1f),Q286R(1f); standard; MUTATION;
Accession       C0027
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   55
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin
Relative        CTSCbase; C0023 brother
Relative        CTSCbase; C0024 sister
Relative        CTSCbase; C0025 brother
Relative        CTSCbase; C0026 sister
Relative        CTSCbase; C0028 second cousin once removed
Relative        CTSCbase; C0029 second cousin once removed
Relative        CTSCbase; C0030 second cousin once removed
Relative        CTSCbase; C0031 second cousin once removed
//
ID              Q286R(1g),Q286R(1g); standard; MUTATION;
Accession       C0028
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   25
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin once removed
Relative        CTSCbase; C0023 second cousin once removed
Relative        CTSCbase; C0024 second cousin once removed
Relative        CTSCbase; C0025 second cousin once removed
Relative        CTSCbase; C0026 second cousin once removed
Relative        CTSCbase; C0027 second cousin once removed
Relative        CTSCbase; C0029 brother
Relative        CTSCbase; C0030 cousin
Relative        CTSCbase; C0031 cousin
//
ID              Q286R(1h),Q286R(1h); standard; MUTATION;
Accession       C0029
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   2
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XY
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Relative        CTSCbase; C0022 second cousin once removed
Relative        CTSCbase; C0023 second cousin once removed
Relative        CTSCbase; C0024 second cousin once removed
Relative        CTSCbase; C0025 second cousin once removed
Relative        CTSCbase; C0026 second cousin once removed
Relative        CTSCbase; C0027 second cousin once removed
Relative        CTSCbase; C0028 sister
Relative        CTSCbase; C0030 cousin
Relative        CTSCbase; C0031 cousin
//
ID              Q286R(1i),Q286R(1i); standard; MUTATION;
Accession       C0030
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   17
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Consanguineous
Relative        CTSCbase; C0022 second cousin once removed
Relative        CTSCbase; C0023 second cousin once removed
Relative        CTSCbase; C0024 second cousin once removed
Relative        CTSCbase; C0025 second cousin once removed
Relative        CTSCbase; C0026 second cousin once removed
Relative        CTSCbase; C0027 second cousin once removed
Relative        CTSCbase; C0028 cousin
Relative        CTSCbase; C0029 cousin
Relative        CTSCbase; C0031 sister
//
ID              Q286R(1j),Q286R(1j); standard; MUTATION;
Accession       C0031
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   16
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Haim-Munk syndrome
Sex             XX
Ethnic origin   Caucasoid; India
Parents         Consanguineous
Relative        CTSCbase; C0022 second cousin once removed
Relative        CTSCbase; C0023 second cousin once removed
Relative        CTSCbase; C0024 second cousin once removed
Relative        CTSCbase; C0025 second cousin once removed
Relative        CTSCbase; C0026 second cousin once removed
Relative        CTSCbase; C0027 second cousin once removed
Relative        CTSCbase; C0028 cousin
Relative        CTSCbase; C0029 cousin
Relative        CTSCbase; C0030 sister
//
ID              Q286R(2a),Q286R(2a); standard; MUTATION;
Accession       C0032
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   75
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CTSCbase; C0033 niece/cousin
//
ID              Q286R(2b),Q286R(2b); standard; MUTATION;
Accession       C0033
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   78
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662807
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Firatli, E., Van Dyke, T. E., Stabholz, A., Zlotogorski, 
RefAuthors      A., Shapira, L., Soskolne, W. A., Zlorogorski, A.
RefTitle        Haim-munk syndrome and papillon-lefèvre syndrome are 
RefTitle        allelic mutations in cathepsin C.
RefLoc          J Med Genet 37:88-94 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CTSCbase; C0032 uncle
//
ID              Q286R(3),Q286R(3); standard; MUTATION;
Accession       C0055
Systematic name Allele 1 and 2: g.42606A>G, c.857A>G, r.857a>g, p.Gln286Arg
Original code   Family 2, A
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180601
RefAuthors      Allende, L. M., Garcia-Perez, M. A., Moreno, A., Corell, 
RefAuthors      A., Carasol, M., Martinez-Canut, P., Arnaiz-Villena, A.
RefTitle        Cathepsin C gene: first compound heterozygous patient with 
RefTitle        papillon-lefèvre syndrome and a novel symptomless 
RefTitle        mutation.
RefLoc          Hum Mutat 17:152-153 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42606
Feature           /change: a -> g
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 955
Feature           /codon: cag -> cgg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> R
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Spain
Parents         Consanguineous
//
ID              Q286X(1a),Q286X(1a); standard; MUTATION;
Accession       C0012
Systematic name Allele 1 and 2: g.42605C>T, c.856C>T, r.856c>u, p.Gln286X
Original code   Patient 21
Description     Allele 1 and 2: a point mutation in the exon 6 leading to a
Description     premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42605
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 954
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42605
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 954
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CTSCbase; C0013 brother
//
ID              Q286X(1b),Q286X(1b); standard; MUTATION;
Accession       C0013
Systematic name Allele 1 and 2: g.42605C>T, c.856C>T, r.856c>u, p.Gln286X
Original code   Patient 29
Description     Allele 1 and 2: a point mutation in the exon 6 leading to a
Description     premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42605
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 954
Feature           /codon: cag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42605
Feature           /change: c -> t
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 954
Feature           /codon: cag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 286
Feature           /change: Q -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
Relative        CTSCbase; C0012 sister
//
ID              Y294H(1a),Y294H(1a); standard; MUTATION;
Accession       C0091
Systematic name Allele 1 and 2: g.42629T>C, c.880T>C, r.880u>c, p.Tyr294His
Original code   Family 1; II-2
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            08-Feb-2005 (Rel. 1, Created)
Date            08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12809647
RefAuthors      Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle        A genetic study of cathepsin C gene in two families with 
RefTitle        papillon-lefèvre syndrome.
RefLoc          Mol Genet Metab 79:146-148 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42629
Feature           /change: t -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 978
Feature           /codon: tat -> cat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 294
Feature           /change: Y -> H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42629
Feature           /change: t -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 978
Feature           /codon: tat -> cat; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 294
Feature           /change: Y -> H
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Spain (Salamanca)
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0092 brother
//
ID              Y294H(1b),Y294H(1b); standard; MUTATION;
Accession       C0092
Systematic name Allele 1 and 2: g.42629T>C, c.880T>C, r.880u>c, p.Tyr294His
Original code   Family 1; II-3
Description     Allele 1 and 2: a point mutation in the exon 6 leading to
Description     an amino acid change
Date            08-Feb-2005 (Rel. 1, Created)
Date            08-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12809647
RefAuthors      Allende, L. M., Moreno, A., de Unamuno, P.
RefTitle        A genetic study of cathepsin C gene in two families with 
RefTitle        papillon-lefèvre syndrome.
RefLoc          Mol Genet Metab 79:146-148 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42629
Feature           /change: t -> c
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 978
Feature           /codon: tat -> cat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 294
Feature           /change: Y -> H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 42629
Feature           /change: t -> c
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 978
Feature           /codon: tat -> cat; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 294
Feature           /change: Y -> H
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Spain (Salamanca)
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0091 brother
//
ID              G300S(1),E447G(1); standard; MUTATION;
Accession       C0041
Systematic name Allele 1: g.44271G>A, c.898G>A, r.898g>a, p.Gly300Ser
Systematic name Allele 2: g.44713A>G, c.1340A>G, r.1340a>g, p.Glu447Gly
Description     Allele 1: a point mutation in the exon 7 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 7 leading to an
Description     amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44271
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 996
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 300
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44713
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1438
Feature           /codon: gag -> ggg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 447
Feature           /change: E -> G
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Mongoloid; Vietnam
Parents         Non-consanguineous
//
ID              G301S(1a),G301S(1a); standard; MUTATION;
Accession       C0006
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code   Family 6; IV:2
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Relative        CTSCbase; C0007 brother
Relative        CTSCbase; C0008 nephew
//
ID              G301S(1b),G301S(1b); standard; MUTATION;
Accession       C0007
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code   Family 6; IV:4
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Relative        CTSCbase; C0006 sister
Relative        CTSCbase; C0008 son
//
ID              G301S(1c),G301S(1c); standard; MUTATION;
Accession       C0008
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code   Family 6; V:1
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Relative        CTSCbase; C0006 aunt
Relative        CTSCbase; C0007 father
//
ID              G301S(2),G301S(2); standard; MUTATION;
Accession       C0043
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Iran
Parents         Consanguineous
//
ID              G301S(3a),G301S(3a); standard; MUTATION;
Accession       C0052
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code   Family 2; II-2
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Mongoloid; Japan
Parents         Consanguineous
Relative        CTSCbase; C0053 brother
//
ID              G301S(3b),G301S(3b); standard; MUTATION;
Accession       C0053
Systematic name Allele 1 and 2: g.44274G>A, c.901G>A, r.901g>a, p.Gly301Ser
Original code   Family 2; II-3
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            01-Feb-2005 (Rel. 1, Created)
Date            01-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11180012
RefAuthors      Nakano, A., Nomura, K., Nakano, H., Ono, Y., LaForgia, S., 
RefAuthors      Pulkkinen, L., Hashimoto, I., Uitto, J.
RefTitle        Papillon-lefèvre syndrome: mutations and polymorphisms in 
RefTitle        the cathepsin C gene.
RefLoc          J Invest Dermatol 116:339-343 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44274
Feature           /change: g -> a
Feature           /CpG; 2
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 999
Feature           /codon: ggc -> agc; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> S
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Mongoloid; Japan
Parents         Consanguineous
Relative        CTSCbase; C0052 sister
//
ID              G301V(1),G301V(1); standard; MUTATION;
Accession       C0042
Systematic name Allele 1 and 2: g.44275G>T, c.902G>T, r.902g>u, p.Gly301Val
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44275
Feature           /change: g -> t
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1000
Feature           /codon: ggc -> gtc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> V
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44275
Feature           /change: g -> t
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1000
Feature           /codon: ggc -> gtc; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 301
Feature           /change: G -> V
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS with transgressions of the hyperkeratotic lesions on
Symptoms        elbows/knees
Ethnic origin   Caucasoid; Iran
Parents         Consanguineous
//
ID              Y304N(1),Y304N(1); standard; MUTATION;
Accession       C0044
Systematic name Allele 1 and 2: g.44283T>A, c.910T>A, r.910u>a, p.Tyr304Asn
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44283
Feature           /change: t -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1008
Feature           /codon: tac -> aac; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 304
Feature           /change: Y -> N
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44283
Feature           /change: t -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1008
Feature           /codon: tac -> aac; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 304
Feature           /change: Y -> N
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS and retinitis pigmentosa
Ethnic origin   Caucasoid; Panama
Parents         Consanguineous
//
ID              Y304X(1),Y304X(1); standard; MUTATION;
Accession       C0088
Systematic name Allele 1 and 2: g.44285C>A, c.912C>A, r.912c>a, p.Tyr304X
Original code   IISC-PLS3; II-2
Description     Allele 1 and 2: a point mutation in the exon 7 leading to a
Description     premature stop codon
Date            07-Feb-2005 (Rel. 1, Created)
Date            07-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 12857359
RefAuthors      Selvaraju, V., Markandaya, M., Prasad, P. V., Sathyan, P., 
RefAuthors      Sethuraman, G., Srivastava, S. C., Thakker, N., Kumar, A.
RefTitle        Mutation analysis of the cathepsin C gene in indian 
RefTitle        families with papillon-lefèvre syndrome.
RefLoc          BMC Med Genet 4:5 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44285
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1010
Feature           /codon: tac -> taa; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 304
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44285
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1010
Feature           /codon: tac -> taa; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 304
Feature           /change: Y -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; India
Parents         Non-consanguineous
Family history  Not known
//
ID              Q312R(1),Q312R(1); standard; MUTATION;
Accession       C0103
Systematic name Allele 1 and 2: g.44308A>G, c.935A>G, r.935a>g, p.Gln312Arg
Original code   Family 19
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            14-Feb-2005 (Rel. 1, Created)
Date            14-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14974080
RefAuthors      Hewitt, C., McCormick, D., Linden, G., Turk, D., Stern, 
RefAuthors      I., Wallace, I., Southern, L., Zhang, L., Howard, R., 
RefAuthors      Bullon, P., Wong, M., Widmer, R., Gaffar, K. A., Awawdeh, 
RefAuthors      L., Briggs, J., Yaghmai, R., Jabs, E. W., Hoeger, P., 
RefAuthors      Bleck, O., Rudiger, S. G., Petersilka, G., Battino, M., 
RefAuthors      Brett, P., Hattab, F., Al-Hamed, M., Sloan, P., Toomes, 
RefAuthors      C., Dixon, M., James, J., Read, A. P., Thakker, N.
RefTitle        The role of cathepsin C in papillon-lefèvre syndrome, 
RefTitle        prepubertal periodontitis, and aggressive periodontitis.
RefLoc          Hum Mutat 23:222-228 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44308
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1033
Feature           /codon: caa -> cga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 312
Feature           /change: Q -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44308
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1033
Feature           /codon: caa -> cga; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 312
Feature           /change: Q -> R
Diagnosis       Papillon-Lefevre syndrome
//
ID              L316R(1),W423S(1); standard; MUTATION;
Accession       C0083
Systematic name Allele 1: g.44320T>G, c.947T>G, r.947u>g, p.Leu316Arg
Systematic name Allele 2: g.44641G>C, c.1268G>C, r.1268g>c, p.Trp423Ser
Description     Allele 1: a point mutation in the exon 7 leading to an
Description     amino acid change
Description     Allele 2: a point mutation in the exon 7 leading to an
Description     amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15111626
RefAuthors      Noack, B., Gorgens, H., Hoffmann, T., Fanghanel, J., 
RefAuthors      Kocher, T., Eickholz, P., Schackert, H. K.
RefTitle        Novel mutations in the cathepsin C gene in patients with 
RefTitle        pre-pubertal aggressive periodontitis and papillon-
RefTitle        lefèvre syndrome.
RefLoc          J Dent Res 83:368-370 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44320
Feature           /change: t -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1045
Feature           /codon: ctg -> cgg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 316
Feature           /change: L -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44641
Feature           /change: g -> c
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1366
Feature           /codon: tgg -> tcg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 423
Feature           /change: W -> S
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; German
Parents         Non-consanguineous
//
ID              E319G(1),E319G(1); standard; MUTATION;
Accession       C0045
Systematic name Allele 1 and 2: g.44329A>G, c.956A>G, r.956a>g, p.Glu319Gly
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44329
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1054
Feature           /codon: gaa -> gga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 319
Feature           /change: E -> G
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44329
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1054
Feature           /codon: gaa -> gga; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 319
Feature           /change: E -> G
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Iran
Parents         Consanguineous
//
ID              #D328X331(1),#D328X331(1); standard; MUTATION;
Accession       C0068
Systematic name Allele 1 and 2: g.44357_44363delTTCTCCA,
Systematic name c.984_990delTTCTCCA, r.984_990deluucucca, p.Ser329fsX3
Original code   F6
Description     Allele 1 and 2: a frame shift deletion mutation in the exon
Description     7 leading to a premature stop codon
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44357..44363
Feature           /change: -ttctcca
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1082..1088
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 328..330
Feature           /change: DSP -> DAKX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44357..44363
Feature           /change: -ttctcca
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1082..1088
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 328..330
Feature           /change: DSP -> DAKX
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; France, Ile d'Yeu
Parents         Consanguineous
//
ID              R339C(1),R339C(1); standard; MUTATION;
Accession       C0002
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   Family 2
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
//
ID              R339C(2),R339C(2); standard; MUTATION;
Accession       C0046
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Egypt
Parents         Consanguineous
//
ID              R339C(3a),R339C(3a); standard; MUTATION;
Accession       C0063
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   F5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Martinique
Parents         Consanguineous
Relative        CTSCbase; C0064 twinsister
Relative        CTSCbase; C0065 sister
Relative        CTSCbase; C0066 sister
Relative        CTSCbase; C0067 sister
//
ID              R339C(3b),R339C(3b); standard; MUTATION;
Accession       C0064
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   F5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Martinique
Parents         Consanguineous
Relative        CTSCbase; C0063 twinbrother
Relative        CTSCbase; C0065 sister
Relative        CTSCbase; C0066 sister
Relative        CTSCbase; C0067 sister
//
ID              R339C(3c),R339C(3c); standard; MUTATION;
Accession       C0065
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   F5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Martinique
Parents         Consanguineous
Relative        CTSCbase; C0063 brother
Relative        CTSCbase; C0064 sister
Relative        CTSCbase; C0066 sister
Relative        CTSCbase; C0067 sister
//
ID              R339C(3d),R339C(3d); standard; MUTATION;
Accession       C0066
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   F5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Martinique
Parents         Consanguineous
Relative        CTSCbase; C0063 brother
Relative        CTSCbase; C0064 sister
Relative        CTSCbase; C0065 sister
Relative        CTSCbase; C0067 sister
//
ID              R339C(3e),R339C(3e); standard; MUTATION;
Accession       C0067
Systematic name Allele 1 and 2: g.44388C>T, c.1015C>T, r.1015c>u,
Systematic name p.Arg339Cys
Original code   F5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44388
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1113
Feature           /codon: cgt -> tgt; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 339
Feature           /change: R -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Martinique
Parents         Consanguineous
Relative        CTSCbase; C0063 brother
Relative        CTSCbase; C0064 sister
Relative        CTSCbase; C0065 sister
Relative        CTSCbase; C0066 sister
//
ID              S343X(1),S343X(1); standard; MUTATION;
Accession       C0015
Systematic name Allele 1 and 2: g.44401_44402delCT, c.1028_1029delCT,
Systematic name r.1028_1029delcu, p.Ser343X
Original code   Patient 19
Description     Allele 1 and 2: a deletion mutation in the exon 7 leading
Description     to a premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44401..44402
Feature           /change: -ct
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1126..1127
Feature           /codon: tct -> tga; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 343
Feature           /change: S -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44401..44402
Feature           /change: -ct
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1126..1127
Feature           /codon: tct -> tga; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 343
Feature           /change: S -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              Y347C(1),Y347C(1); standard; MUTATION;
Accession       C0005
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code   Family 5
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
Diagnosis       Papillon-Lefevre syndrome
//
ID              Y347C(2a),Y347C(2a); standard; MUTATION;
Accession       C0018
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code   IV3
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662808
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M., 
RefAuthors      Walker, S.
RefTitle        Localisation of a gene for prepubertal periodontitis to 
RefTitle        chromosome 11q14 and identification of a cathepsin C gene 
RefTitle        mutation.
RefLoc          J Med Genet 37:95-101 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
Diagnosis       Prepubertal periodontitis
Sex             XY
Parents         Consanguineous
Relative        CTSCbase; C0019 sister
Relative        CTSCbase; C0020 cousin
Relative        CTSCbase; C0021 cousin
//
ID              Y347C(2b),Y347C(2b); standard; MUTATION;
Accession       C0019
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code   IV4
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662808
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M., 
RefAuthors      Walker, S.
RefTitle        Localisation of a gene for prepubertal periodontitis to 
RefTitle        chromosome 11q14 and identification of a cathepsin C gene 
RefTitle        mutation.
RefLoc          J Med Genet 37:95-101 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
Diagnosis       Prepubertal periodontitis
Sex             XX
Parents         Consanguineous
Relative        CTSCbase; C0018 brother
Relative        CTSCbase; C0020 cousin
Relative        CTSCbase; C0021 cousin
//
ID              Y347C(2c),Y347C(2c); standard; MUTATION;
Accession       C0020
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code   IV9
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662808
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M., 
RefAuthors      Walker, S.
RefTitle        Localisation of a gene for prepubertal periodontitis to 
RefTitle        chromosome 11q14 and identification of a cathepsin C gene 
RefTitle        mutation.
RefLoc          J Med Genet 37:95-101 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
Diagnosis       Prepubertal periodontitis
Sex             XX
Parents         Consanguineous
Relative        CTSCbase; C0018 cousin
Relative        CTSCbase; C0019 cousin
Relative        CTSCbase; C0021 sister
//
ID              Y347C(2d),Y347C(2d); standard; MUTATION;
Accession       C0021
Systematic name Allele 1 and 2: g.44413A>G, c.1040A>G, r.1040a>g,
Systematic name p.Tyr347Cys
Original code   IV10
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            28-Jan-2005 (Rel. 1, Created)
Date            28-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10662808
RefAuthors      Hart, T. C., Hart, P. S., Michalec, M. D., Zhang, Y., 
RefAuthors      Marazita, M. L., Cooper, M., Yassin, O. M., Nusier, M., 
RefAuthors      Walker, S.
RefTitle        Localisation of a gene for prepubertal periodontitis to 
RefTitle        chromosome 11q14 and identification of a cathepsin C gene 
RefTitle        mutation.
RefLoc          J Med Genet 37:95-101 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44413
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1138
Feature           /codon: tat -> tgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 347
Feature           /change: Y -> C
Diagnosis       Prepubertal periodontitis
Sex             XX
Parents         Consanguineous
Relative        CTSCbase; C0018 cousin
Relative        CTSCbase; C0019 cousin
Relative        CTSCbase; C0020 sister
//
ID              #G349X359(1),#G349X359(1); standard; MUTATION;
Accession       C0014
Systematic name Allele 1 and 2: g.44420delA, c.1047delA, r.1047dela,
Systematic name p.Gly350fsX10
Original code   Patient 5
Description     Allele 1 and 2: a frame shift deletion mutation in the exon
Description     7 leading to a premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44420
Feature           /change: -a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1145
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 349
Feature           /change: G -> GVSMEAAMKP X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44420
Feature           /change: -a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0022: 1145
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 349
Feature           /change: G -> GVSMEAAMKP X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              Y352X(1),W429C(1); standard; MUTATION;
Accession       C0072
Systematic name Allele 1: g.44429delT, c.1056delT, r.1056delu, p.Tyr352X
Systematic name Allele 2: g.44660G>C, c.1287G>C, r.1287g>c, p.Trp429Cys
Original code   F9
Description     Allele 1: a deletion mutation in the exon 7 leading to a
Description     premature stop codon
Description     Allele 2: a point mutation in the exon 7 leading to an
Description     amino acid change
Date            03-Feb-2005 (Rel. 1, Created)
Date            03-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11886537
RefAuthors      Lefevre, C., Blanchet-Bardon, C., Jobard, F., Bouadjar, 
RefAuthors      B., Stalder, J. F., Cure, S., Hoffmann, A., Prud'Homme, J. 
RefAuthors      F., Fischer, J.
RefTitle        Novel point mutations, deletions, and polymorphisms in the 
RefTitle        cathepsin C gene in nine families from europe and north 
RefTitle        africa with papillon-lefèvre syndrome.
RefLoc          J Invest Dermatol 117:1657-1661 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44429
Feature           /change: -t
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1154
Feature           /codon: tat -> tag; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 352
Feature           /change: Y -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44660
Feature           /change: g -> c
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1385
Feature           /codon: tgg -> tgc; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> C
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; France
Parents         Non-consanguineous
//
ID              H405N(1a),H405N(1a); standard; MUTATION;
Accession       C0096
Systematic name Allele 1 and 2: g.44586C>A, c.1213C>A, r.1213c>a,
Systematic name p.His405Asn
Original code   Family 2; II-1
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15108292
RefAuthors      de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree, 
RefAuthors      H., Everts, V., Beertsen, W.
RefTitle        Loss-of-function mutations in cathepsin C in two families 
RefTitle        with papillon-lefèvre syndrome are associated with 
RefTitle        deficiency of serine proteinases in PMNs.
RefLoc          Hum Mutat 23:524 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44586
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1311
Feature           /codon: cat -> aat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> N
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44586
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1311
Feature           /codon: cat -> aat; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> N
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Pakistan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0097 sister
//
ID              H405N(1b),H405N(1b); standard; MUTATION;
Accession       C0097
Systematic name Allele 1 and 2: g.44586C>A, c.1213C>A, r.1213c>a,
Systematic name p.His405Asn
Original code   Family 2; II-2
Description     Allele 1 and 2: a point mutation in the exon 7 leading to
Description     an amino acid change
Date            09-Feb-2005 (Rel. 1, Created)
Date            09-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15108292
RefAuthors      de Haar, S. F., Jansen, D. C., Schoenmaker, T., De Vree, 
RefAuthors      H., Everts, V., Beertsen, W.
RefTitle        Loss-of-function mutations in cathepsin C in two families 
RefTitle        with papillon-lefèvre syndrome are associated with 
RefTitle        deficiency of serine proteinases in PMNs.
RefLoc          Hum Mutat 23:524 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44586
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1311
Feature           /codon: cat -> aat; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> N
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44586
Feature           /change: c -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1311
Feature           /codon: cat -> aat; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> N
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Pakistan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0096 sister
//
ID              H405R(1),H405R(1); standard; MUTATION;
Accession       C0122
Systematic name Allele 1 and 2: g.44587A>G, c.1214A>G, r.1214a>g,
Systematic name p.His405Arg
Description     Allele 1 and 2: A point mutation in the exon 7 leading to
Description     an amino acid change
Date            04-Aug-2006 (Rel. 1, Created)
Date            04-Aug-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15991336
RefAuthors      de Haar, S., Mir, M., Nguyen, M., Kazemi, B., Ramezani, 
RefAuthors      G.H., Everts, V., Beertsen, W.
RefTitle        Gene symbol: CTSC. disease: papillon-lefevre syndrome.
RefLoc          Hum Genet 116:545 (2005) 
RefLoc          Erratum in: Hum Genet 118:533 (2005).
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44587
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1312
Feature           /codon: cat -> cgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44587
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022: 1312
Feature           /codon: cat -> cgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> R
Diagnosis       Papillon-Lefevre syndrome
//
ID              H405R(2),H405R(2); standard; MUTATION;
Accession       C0133
Systematic name Allele 1 and 2: g.44587A>G, c.1214A>G, r.1214a>g,
Systematic name p.His405Arg
Description     Allele 1 and 2: A point mutation in the exon 7 leading to
Description     an amino acid change
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44587
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1312
Feature           /codon: cat -> cgt; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> R
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44587
Feature           /change: a -> g
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1312
Feature           /codon: cat -> cgt; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: H -> R
Diagnosis       Papillon-Lefevre syndrome
Symptoms        palmoplantar hyperkeratosis, aggressive periodontosis,
Symptoms        premature tooth loss
Ethnic origin   Iran
Parents         Consanguineous
//
ID              #H405-1(1a),#H405-1(1a); standard; MUTATION;
Accession       C0116
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code   Family 1.1
Description     Allele 1 and 2: an inframe deletion in the exon 7 leading
Description     to an amino acid change
Date            20-Jun-2006 (Rel. 1, Created)
Date            20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16460249
RefAuthors      Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle        Description of two new cathepsin C gene mutations in 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Periodontol 77:233-237 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Indian
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0117 brother
Relative        CTSCbase; C0118 sister
//
ID              #H405-1(1b),#H405-1(1b); standard; MUTATION;
Accession       C0117
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code   Family 1.2
Description     Allele 1 and 2: an inframe deletion in the exon 7 leading
Description     to an amino acid change
Date            20-Jun-2006 (Rel. 1, Created)
Date            20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16460249
RefAuthors      Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle        Description of two new cathepsin C gene mutations in 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Periodontol 77:233-237 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Indian
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0116 brother
Relative        CTSCbase; C0118 sister
//
ID              #H405-1(1c),#H405-1(1c); standard; MUTATION;
Accession       C0118
Systematic name Allele 1 and 2: g.44586_44588delCAT, c.1213_1215delCAT,
Systematic name r.1213_1215delcau, p.His405del
Original code   Family 1.3
Description     Allele 1 and 2: an inframe deletion in the exon 7 leading
Description     to an amino acid change
Date            20-Jun-2006 (Rel. 1, Created)
Date            20-Jun-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16460249
RefAuthors      Wani, A. A., Devkar, N., Patole, M. S., Shouche, Y. S.
RefTitle        Description of two new cathepsin C gene mutations in 
RefTitle        patients with papillon-lefèvre syndrome.
RefLoc          J Periodontol 77:233-237 (2006)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44586..44588
Feature           /change: -cat
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0022: 1311..1313
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: deletion; inframe
Feature           /loc: UniProt: P53634; CATC_HUMAN: 405
Feature           /change: -H
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Indian
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0116 brother
Relative        CTSCbase; C0117 brother
//
ID              W423X(1),W423X(1); standard; MUTATION;
Accession       C0134
Systematic name Allele 1 and 2: g.44642G>A, c.1269G>A, r.1269g>a, p.Trp423X
Description     Allele 1 and 2: A point mutation in the exon 7 leading to a
Description     premature stop codon
Date            05-Jul-2010 (Rel. 1, Created)
Date            05-Jul-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 18294227
RefAuthors      Noack, B., Gorgens, H., Schacher, B., Puklo, M., Eickholz, 
RefAuthors      P., Hoffmann, T., Schackert, H. K.
RefTitle        Functional cathepsin C mutations cause different papillon-
RefTitle        lefèvre syndrome phenotypes.
RefLoc          J Clin Periodontol:311-316 (2008)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44642
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1367
Feature           /codon: tgg -> tga; 3
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 423
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44642
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022; GI:22538438; CTSCC: 1367
Feature           /codon: tgg -> tga; 3
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 423
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Symptoms        mild skin findings
Ethnic origin   Sri Lanka
Parents         Consanguineous
//
ID              W429X(1),W429X(1); standard; MUTATION;
Accession       C0016
Systematic name Allele 1 and 2: g.44659delG, c.1286delG, r.1286delg,
Systematic name p.Trp429X
Original code   Patient 7
Description     Allele 1 and 2: a deletion mutation in the exon 7 leading
Description     to a premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              W429X(2),W429X(2); standard; MUTATION;
Accession       C0017
Systematic name Allele 1 and 2: g.44659delG, c.1286delG, r.1286delg,
Systematic name p.Trp429X
Original code   Patient 22
Description     Allele 1 and 2: a deletion mutation in the exon 7 leading
Description     to a premature stop codon
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10593994
RefAuthors      Hart, T. C., Hart, P. S., Bowden, D. W., Michalec, M. D., 
RefAuthors      Callison, S. A., Walker, S. J., Zhang, Y., Firatli, E.
RefTitle        Mutations of the cathepsin C gene are responsible for 
RefTitle        papillon-lefèvre syndrome.
RefLoc          J Med Genet 36:881-887 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 9741471
RefAuthors      Hart, T. C., Bowden, D. W., Ghaffar, K. A., Wang, W., 
RefAuthors      Cutler, C. W., Cebeci, I., Efeoglu, A., Firatli, E.
RefTitle        Sublocalization of the papillon-lefevre syndrome locus on 
RefTitle        11q14-q21.
RefLoc          Am J Med Genet 79:134-139 (1998)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              W429X(3),W429X(3); standard; MUTATION;
Accession       C0047
Systematic name Allele 1 and 2: g.44659G>A, c.1286G>A, r.1286g>a, p.Trp429X
Description     Allele 1 and 2: a point mutation in the exon 7 leading to a
Description     premature stop codon
Date            31-Jan-2005 (Rel. 1, Created)
Date            31-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11106356
RefAuthors      Hart, P. S., Zhang, Y., Firatli, E., Uygur, C., Lotfazar, 
RefAuthors      M., Michalec, M. D., Marks, J. J., Lu, X., Coates, B. J., 
RefAuthors      Seow, W. K., Marshall, R., Williams, D., Reed, J. B., 
RefAuthors      Wright, J. T., Hart, T. C.
RefTitle        Identification of cathepsin C mutations in ethnically 
RefTitle        diverse papillon-lefèvre syndrome patients.
RefLoc          J Med Genet 37:927-932 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 44659
Feature           /change: g -> a
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0022: 1384
Feature           /codon: tgg -> tag; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 429
Feature           /change: W -> X
Diagnosis       Papillon-Lefevre syndrome
Ethnic origin   Caucasoid; Turkey
Parents         Consanguineous
//
ID              Intron 2(1),Intron 2(1); standard; MUTATION;
Accession       C0108
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code   Family 1, II:3
Description     Allele 1 and 2: a point mutation in the intron 2 leading to
Description     aberrant splicing
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15606524
RefAuthors      Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar, 
RefAuthors      K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A., 
RefAuthors      Thakker, N. S.
RefTitle        Coinheritance of two rare genodermatoses (papillon-
RefTitle        lefèvre syndrome and oculocutaneous albinism type 1) in 
RefTitle        two families: a genetic study.
RefLoc          Br J Dermatol 151:1261-1265 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Typical PLS and OCA1 albinism
Sex             XX
Ethnic origin   Caucasoid; Egypt
Parents         Consanguineous
Family history  Inherited
Comment         Patient has also a homozygous mutation in OCA1 gene TYR,
Comment         NP000363.1:c.817G>C, p.Trp272C
//
ID              Intron 2(2a),Intron 2(2a); standard; MUTATION;
Accession       C0109
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code   Family 2, II:1
Description     Allele 1 and 2: a point mutation in the intron 2 leading to
Description     aberrant splicing
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15606524
RefAuthors      Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar, 
RefAuthors      K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A., 
RefAuthors      Thakker, N. S.
RefTitle        Coinheritance of two rare genodermatoses (papillon-
RefTitle        lefèvre syndrome and oculocutaneous albinism type 1) in 
RefTitle        two families: a genetic study.
RefLoc          Br J Dermatol 151:1261-1265 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Typical PLS and OCA1 albinism
Age             20
Sex             XY
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0110; brother
Relative        CTSCbase; C0111; sister
Comment         Patient has also a homozygous mutation in OCA1 gene TYR,
Comment         NP000363.1:c.817G>C, p.Trp272C
//
ID              Intron 2(2b),Intron 2(2b); standard; MUTATION;
Accession       C0110
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code   Family 2, II:2
Description     Allele 1 and 2: a point mutation in the intron 2 leading to
Description     aberrant splicing
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15606524
RefAuthors      Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar, 
RefAuthors      K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A., 
RefAuthors      Thakker, N. S.
RefTitle        Coinheritance of two rare genodermatoses (papillon-
RefTitle        lefèvre syndrome and oculocutaneous albinism type 1) in 
RefTitle        two families: a genetic study.
RefLoc          Br J Dermatol 151:1261-1265 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Typical PLS  and OCA1 albinism
Sex             XY
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0109; brother
Relative        CTSCbase; C0111; sister
Comment         Patient has also a homozygous mutation in OCA1 gene TYR,
Comment         NP000363.1:c.817G>C, p.Trp272C
//
ID              Intron 2(2c),Intron 2(2c); standard; MUTATION;
Accession       C0111
Systematic name Allele 1 and 2: g.IVS2-1G>A, c.319-1G>A, r.319-1g>a,
Original code   Family 2, II:3
Description     Allele 1 and 2: a point mutation in the intron 2 leading to
Description     aberrant splicing
Date            14-Apr-2005 (Rel. 1, Created)
Date            14-Apr-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 15606524
RefAuthors      Hewitt, C., Wu, C. L., Hattab, F. N., Amin, W., Ghaffar, 
RefAuthors      K. A., Toomes, C., Sloan, P., Read, A. P., James, J. A., 
RefAuthors      Thakker, N. S.
RefTitle        Coinheritance of two rare genodermatoses (papillon-
RefTitle        lefèvre syndrome and oculocutaneous albinism type 1) in 
RefTitle        two families: a genetic study.
RefLoc          Br J Dermatol 151:1261-1265 (2004)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 26216
Feature           /change: g -> a
Feature           /genomic_region: intron; 2
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        Typical PLS
Sex             XX
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0109; brother
Relative        CTSCbase; C0110; brother
//
ID              Intron 3(1),Intron 3(1); standard; MUTATION;
Accession       C0003
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   Family 3
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            26-Jan-2005 (Rel. 1, Created)
Date            26-Jan-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10581027
RefAuthors      Toomes, C., James, J., Wood, A. J., Wu, C. L., McCormick, 
RefAuthors      D., Lench, N., Hewitt, C., Moynihan, L., Roberts, E., 
RefAuthors      Woods, C. G., Markham, A., Wong, M., Widmer, R., Ghaffar, 
RefAuthors      K. A., Pemberton, M., Hussein, I. R., Temtamy, S. A., 
RefAuthors      Davies, R., Read, A. P., Sloan, P., Dixon, M. J., Thakker, 
RefAuthors      N. S.
RefTitle        Loss-of-function mutations in the cathepsin C gene result 
RefTitle        in periodontal disease and palmoplantar keratosis.
RefLoc          Nat Genet 23:421-424 (1999)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
//
ID              Intron 3(2a),Intron 3(2a); standard; MUTATION;
Accession       C0077
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   III-1
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11914041
RefAuthors      Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P. 
RefAuthors      S.
RefTitle        Demonstration of altered splicing with the IVS3-1G --> 
RefTitle        a mutation of cathepsin C.
RefLoc          Mol Genet Metab 75:280-283 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
Diagnosis       Papillon-Lefevre syndrome
Sex             XY
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0078 cousin
Relative        CTSCbase; C0079 cousin
Relative        CTSCbase; C0080 cousin
Relative        CTSCbase; C0081 cousin
//
ID              Intron 3(2b),Intron 3(2b); standard; MUTATION;
Accession       C0078
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   III-3
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11914041
RefAuthors      Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P. 
RefAuthors      S.
RefTitle        Demonstration of altered splicing with the IVS3-1G --> 
RefTitle        a mutation of cathepsin C.
RefLoc          Mol Genet Metab 75:280-283 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0077 cousin
Relative        CTSCbase; C0079 sister
Relative        CTSCbase; C0080 sister
Relative        CTSCbase; C0081 sister
//
ID              Intron 3(2c),Intron 3(2c); standard; MUTATION;
Accession       C0079
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   III-4
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11914041
RefAuthors      Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P. 
RefAuthors      S.
RefTitle        Demonstration of altered splicing with the IVS3-1G --> 
RefTitle        a mutation of cathepsin C.
RefLoc          Mol Genet Metab 75:280-283 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0077 cousin
Relative        CTSCbase; C0078 sister
Relative        CTSCbase; C0080 sister
Relative        CTSCbase; C0081 sister
//
ID              Intron 3(2d),Intron 3(2d); standard; MUTATION;
Accession       C0080
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   III-7
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11914041
RefAuthors      Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P. 
RefAuthors      S.
RefTitle        Demonstration of altered splicing with the IVS3-1G --> 
RefTitle        a mutation of cathepsin C.
RefLoc          Mol Genet Metab 75:280-283 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0077 cousin
Relative        CTSCbase; C0078 sister
Relative        CTSCbase; C0079 sister
Relative        CTSCbase; C0081 sister
//
ID              Intron 3(2e),Intron 3(2e); standard; MUTATION;
Accession       C0081
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   III-10
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            04-Feb-2005 (Rel. 1, Created)
Date            04-Feb-2005 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11914041
RefAuthors      Nusier, M., Zhang, Y., Yassin, O., Hart, T. C., Hart, P. 
RefAuthors      S.
RefTitle        Demonstration of altered splicing with the IVS3-1G --> 
RefTitle        a mutation of cathepsin C.
RefLoc          Mol Genet Metab 75:280-283 (2002)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0022: 417..583
Feature           /change: -tataaagaag agggcagcaa ggtgaccact tactgcaacg
Feature           /change:  agacaatgac tgggtgggtg catgatgtgt tgggccggaa
Feature           /change:  ctgggcttgt ttcaccggaa agaaggtggg aactgcctct
Feature           /change:  gagaatgtgt atgtcaacac agcacacctt aagaattctc
Feature           /change:  aggaaaa
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: P53634; CATC_HUMAN: 107..162
Feature           /change: YKEEGSKVTT YCNETMTGWV HDVLGRNWAC FTGKKVGTAS
Feature           /change: ENVYVNTAHL KNSQEK
Feature           /change:  -> 
Feature           /change: VFX
Diagnosis       Papillon-Lefevre syndrome
Sex             XX
Ethnic origin   Caucasoid; Jordan
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0077 cousin
Relative        CTSCbase; C0078 sister
Relative        CTSCbase; C0079 sister
Relative        CTSCbase; C0080 sister
//
ID              Intron 3(3a),Intron 3(3a); standard; MUTATION;
Accession       C0113
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   Case 1
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            11-Jan-2006 (Rel. 1, Created)
Date            11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16301152
RefAuthors      Hattab, F. N., Amin, W. M.
RefTitle        Papillon-lefèvre syndrome with albinism: a review of the 
RefTitle        literature and report of 2 brothers.
RefLoc          Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc          100:709-716 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS and OCA1
Sex             XY
Ethnic origin   Caucasoid; Jordania
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0114; brother
Relative        CTSCbase; C0115; sister
Comment         Patient has also a homozygous c.817G>C/p.W272C mutation in
Comment         tyrosinase gene
//
ID              Intron 3(3b),Intron 3(3b); standard; MUTATION;
Accession       C0114
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Original code   Case 2
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            11-Jan-2006 (Rel. 1, Created)
Date            11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16301152
RefAuthors      Hattab, F. N., Amin, W. M.
RefTitle        Papillon-lefèvre syndrome with albinism: a review of the 
RefTitle        literature and report of 2 brothers.
RefLoc          Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc          100:709-716 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS and OCA1
Sex             XY
Ethnic origin   Caucasoid; Jordania
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0113; brother
Relative        CTSCbase; C0115; sister
Comment         Patient has also a homozygous c.817G>C/p.W272C mutation in
Comment         tyrosinase gene
//
ID              Intron 3(3c),Intron 3(3c); standard; MUTATION;
Accession       C0115
Systematic name Allele 1 and 2: g.IVS3-1G>A, c.486-1G>A, r.486-1g>a,
Description     Allele 1 and 2: a point mutation in the intron 3 leading to
Description     an amino acid change
Date            11-Jan-2006 (Rel. 1, Created)
Date            11-Jan-2006 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 16301152
RefAuthors      Hattab, F. N., Amin, W. M.
RefTitle        Papillon-lefèvre syndrome with albinism: a review of the 
RefTitle        literature and report of 2 brothers.
RefLoc          Oral Surg Oral Med Oral Pathol Oral Radiol Endod
RefLoc          100:709-716 (2005)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0022: 29452
Feature           /change: g -> a
Feature           /genomic_region: intron; 3
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Diagnosis       Papillon-Lefevre syndrome
Symptoms        PLS
Sex             XX
Ethnic origin   Caucasoid; Jordania
Parents         Consanguineous
Family history  Inherited
Relative        CTSCbase; C0113; brother
Relative        CTSCbase; C0114; brother
Comment         Patient has also a heterozygous c.817G>C/p.W272C mutation
Comment         in tyrosinase gene
//
//