Database CYBBbase
Version 2.2
File cybbpub.html
Date 16-Dec-2015
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/CYBBbase/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF38.html
Gene CYBB
Disease X-linked chronic granulomatous disease
OMIM 306400
GDB 120513
Sequence IDRefSeq:D0025; IDRefSeq:C0025; GenBank:NP_000388
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID &Y30(1); standard; MUTATION; NTERM
Accession A0682
Systematic name g.3069_3071delinsGGT, c.90_92delinsGGT, r.90_92delinsggu,
Systematic name p.Tyr30fsX2
Description A complex mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12139950
RefAuthors Jirapongsananuruk, O., Niemela, J. E., Malech, H. L.,
RefAuthors Fleisher, T. A.
RefTitle CYBB mutation analysis in X-linked chronic granulomatous
RefTitle disease.
RefLoc Clin Immunol:73-76 (2002)
RefNumber [2]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 3069..3071
Feature /change: ccg -> ggt
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: complex
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 104..106
Feature aa; 3
Feature /rnalink: 2
Feature /name: complex
Feature /loc: GenBank: NP_000388: 30..31
Feature /change: YR -> XV
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID &L110(1); standard; MUTATION; NTERM
Accession A0819
Systematic name g.12985_12986delinsAT, c.330_331delinsAT,
Systematic name r.330_331delinsau, p.His111fsX
Description A complex mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 12985..12986
Feature /change: tc -> at
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: complex
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 344..345
Feature aa; 3
Feature /rnalink: 2
Feature /name: complex
Feature /loc: GenBank: NP_000388: 110..111
Feature /change: LH -> LY
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @R198X227(1); standard; MUTATION; NTERM
Accession A1415
Systematic name g.16991_16992ins, c.591_592ins41, r.591_592ins41,
Systematic name p.Arg198fsX30
Description A frame shift insertion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 15-Sep-2010 (Rel. 2, Created)
Date 15-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 16992
Feature /change: +accccctctt tgaataatcc taatcatccc tcacagacat c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 606
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 198
Feature /change: R -> TPSLNNPNHP SQTSGGLTLK SFGTHIISLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID &N470X501(1); standard; MUTATION; NADPHBR
Accession A1256
Systematic name g.27416_27423delinsTGTTGTA, c.1407_1414delinsTGTTGTA,
Systematic name r.1407_1414delinsuguugua, p.Asn470fsX31
Description An indel mutation in the exon 11 leading to an amino acid
Description change and premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 27416..27423
Feature /change: caatgccg -> tgttgta
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1421..1428
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /change: NNAG -> NV VASSATTSTS LAGMSLRPIT LLCTMMRRKM X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID M1K(1); standard; MUTATION; NTERM
Accession A0411
Systematic name g.1016T>A, c.2T>A, r.2u>a, p.Met1Lys
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1016
Feature /change: t -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 16
Feature /codon: atg -> aag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> K
Feature /domain: NTERM
Phenotype X91 -
Sex XY
Family history Inherited, mother is carrier
//
ID M1R(1); standard; MUTATION; NTERM
Accession A0412
Systematic name g.1016T>G, c.2T>G, r.2u>g, p.Met1Arg
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1016
Feature /change: t -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 16
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> R
Feature /domain: NTERM
Phenotype X91 -
Sex XY
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID M1V(1); standard; MUTATION; NTERM
Accession A0242
Systematic name g.1015A>G, c.1A>G, r.1a>g, p.Met1Val
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1015
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 15
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> V
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. Strongly decreased
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Italian)
//
ID M1V(2); standard; MUTATION; NTERM
Accession A0653
Systematic name g.1015A>G, c.1A>G, r.1a>g, p.Met1Val
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1015
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 15
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> V
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID M1V(3); standard; MUTATION; NTERM
Accession A0654
Systematic name g.1015A>G, c.1A>G, r.1a>g, p.Met1Val
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1015
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 15
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> V
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID M1V(4); standard; MUTATION; NTERM
Accession A0655
Systematic name g.1015A>G, c.1A>G, r.1a>g, p.Met1Val
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1015
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 15
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> V
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID M1V(5); standard; MUTATION; NTERM
Accession A1443
Systematic name g.1015A>G, c.1A>G, r.1a>g, p.Met1Val
Original code JMMR
Description A point mutation in the exon 1 leading to an amino acid
Description change in the NTERM domain
Date 09-Dec-2015 (Rel. 2, Created)
Date 09-Dec-2015 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (09-Dec-2015) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia-Planta
RefLoc sotano-Hospital Infantil-Hospital La Paz; Tel 917277238;
RefLoc Fax 917277095; e-mail antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1015
Feature /change: a -> g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 15
Feature /codon: atg -> gtg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 1
Feature /change: M -> V
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Low birth weight, pneumonia, ear infections, salmonellosis,
Symptoms sinusitis, urethral stricture.
Age 7,00
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier,brother died with
Relative CGD
//
ID @N3X8(1); standard; MUTATION; NTERM
Accession A0346
Systematic name g.1020dupG, c.6dupG, r.6dupg, p.Asn3fsX6
Description A frame shift duplication mutation in the exon 1 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 4)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
RefNumber [2]
RefCrossRef PUBMED; 15575848
RefAuthors Vieira, A. P., Vasconcelos, J., Fernandes, J. C., Antunes,
RefAuthors H., Basto, A. S., Macedo, C., Zaman, A., Santos, E., Melo,
RefAuthors J. C., Roos, D.
RefTitle Lymphadenopathy after BCG vaccination in a child with
RefTitle chronic granulomatous disease
RefLoc Pediatr Dermatol. 21:646-651 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 1021
Feature /change: +g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 21
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 3
Feature /change: N -> ELGCEX
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID @N3X8(2); standard; MUTATION; NTERM
Accession A0656
Systematic name g.1020dupG, c.6dupG, r.6dupg, p.Asn3fsX6
Description A frame shift duplication mutation in the exon 1 leading to
Description a premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 1021
Feature /change: +g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 21
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 3
Feature /change: N -> ELGCEX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @N3X8(3); standard; MUTATION; NTERM
Accession A0657
Systematic name g.1022dupA, c.8dupA, r.8dupa, p.Asn3fsX6
Description A frame shift duplication mutation in the exon 1 leading to
Description a premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 1023
Feature /change: +a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 23
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 3
Feature /change: N -> KLGCEX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W4X(1); standard; MUTATION; NTERM
Accession A0108
Systematic name g.1026G>A, c.12G>A, r.12g>a, p.Trp4X
Original code III-01 ref [2]
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1026
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 26
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID W4X(2); standard; MUTATION; NTERM
Accession A0260
Systematic name g.1025G>A, c.11G>A, r.11g>a, p.Trp4X
Original code VIII-01 ref [1]
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1025
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 25
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID W4X(3); standard; MUTATION; NTERM
Accession A0490
Systematic name g.1025G>A, c.11G>A, r.11g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1025
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 25
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Family history Inherited, mother carrier
Comment Prenatal: fetus is affected
//
ID W4X(4); standard; MUTATION; NTERM
Accession A0491
Systematic name g.1026G>A, c.12G>A, r.12g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1026
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 26
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID W4X(5a); standard; MUTATION; NTERM
Accession A0492
Systematic name g.1026G>A, c.12G>A, r.12g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1026
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 26
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0493 twin brother
//
ID W4X(5b); standard; MUTATION; NTERM
Accession A0493
Systematic name g.1026G>A, c.12G>A, r.12g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1026
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 26
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0492 twin brother
//
ID W4X(6); standard; MUTATION; NTERM
Accession A0658
Systematic name g.1025G>A, c.11G>A, r.11g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1025
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 25
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W4X(7); standard; MUTATION; NTERM
Accession A0659
Systematic name g.1026G>A, c.12G>A, r.12g>a, p.Trp4X
Description A point mutation in the exon 1 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1026
Feature /change: g -> a
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 26
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 4
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #A5X29(1); standard; MUTATION; NTERM
Accession A0305
Systematic name g.1028_1041delCTGTGAATGAGGGG, c.14_27delCTGTGAATGAGGGG,
Systematic name r.14_27delcugugaaugagggg, p.Val6fsX24
Description A frame shift deletion mutation in the exon 1 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 1028..1041
Feature /change: -ctgtgaatga gggg
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 28..41
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 5..9
Feature /change: AVNEG -> ALHFCHSGLA GVERLPLCLV LPGLX
Feature /domain: NTERM
Phenotype X91 0
//
ID #G9X21(1); standard; MUTATION; NTERM
Accession A0660
Systematic name g.1041delG, c.27delG, r.27delg, p.Leu10fsX12
Description A frame shift deletion mutation in the exon 1 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 1041
Feature /change: -g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 41
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 9
Feature /change: G -> GSPFLSFWFG WGX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @G9X35(1); standard; MUTATION; NTERM
Accession A0334
Systematic name g.1037_1040dup, c.23_26dup, r.23_26dup, p.Leu10fsX26
Description A frame shift duplication mutation in the exon 1 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 1041
Feature /change: +aggg
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 41
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 9
Feature /change: G -> GGALHFCHSG LAGVERLPLC LVLPGLX
Feature /domain: NTERM
//
ID @L10X34(1); standard; MUTATION; NTERM
Accession A0557
Systematic name g.1041dupG, c.27dupG, r.27dupg, p.Leu10fsX25
Original code Patient 3
Description A frame shift duplication mutation in the exon 1 leading to
Description a premature stop codon in the NTERM domain
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15082894
RefAuthors Oh, H. B., Park, J. S., Lee, W., Yoo, S. J., Yang, J. H.,
RefAuthors Oh, S. Y.
RefTitle Molecular analysis of X-linked chronic granulomatous
RefTitle disease in five unrelated korean patients.
RefLoc J Korean Med Sci:218-222 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 1042
Feature /change: +g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 42
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 10
Feature /change: L -> ALHFCHSGLA GVERLPLCLV LPGLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Tuberculosis, lymphadenitis, hepatitis, enteric fever,n
Symptoms meningitis, and Bechet's disease
Sex XY
Ethnic origin Mongoloid; Korea
//
ID #V14X21(1); standard; MUTATION; NTERM
Accession A0079
Systematic name g.1054delG, c.40delG, r.40delg, p.Val14fsX8
Original code N.B. ref [1];patient 1 ref [2]
Description A frame shift deletion mutation in the exon 1 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9794433
RefAuthors Dusi, S., Nadalini, K. A., Donini, M., Zentilin, L.,
RefAuthors Wientjes, F. B., Roos, D., Giacca, M., Rossi, F.
RefTitle Nicotinamide-adenine dinucleotide phosphate oxidase
RefTitle assembly and activation in EBV-transformed B
RefTitle lymphoblastoid cell lines of normal and chronic
RefTitle granulomatous disease patients.
RefLoc J Immunol 161:4968-4974 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 1054
Feature /change: -g
Feature /genomic_region: exon; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 54
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 14
Feature /change: V -> SFWFGWGX
Feature /domain: NTERM
mRNA level Present
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
//
ID #L16X21(1); standard; MUTATION; NTERM
Accession A0214
Systematic name g.3026delT, c.47delT, r.47delu, p.Leu16fsX6
Original code IV-27 ref [2]
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8167720
RefAuthors Roos, D., De Boer, M., De Klein, A., Bolscher, B. G.,
RefAuthors Weening, R. S.
RefTitle Chronic granulomatous disease: mutations in cytochrome
RefTitle b558.
RefLoc Immunodeficiency 4:289-301 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3026
Feature /change: -t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 61
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 16
Feature /change: L -> RFGWGX
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Chekish)
Family history Inherited, mother is carrier
Comment Brother prenatally normal
//
ID @L16X35(1); standard; MUTATION; NTERM
Accession A0619
Systematic name g.3024_3025insCATT, c.45_46insCATT, r.45_46inscauu,
Systematic name p.Leu16fsX20
Original code SA
Description A frame shift insertion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 07-Apr-2008 (Rel. 2, Created)
Date 07-Apr-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Apr-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza G.
RefLoc Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax +39
RefLoc 80 5592290; e-mail amaf1981@libero.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 3025
Feature /change: +catt
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 60
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 16
Feature /change: L -> HSGLAGVERL PLCLVLPGLX
Feature /domain: NTERM
mRNA level Normal
Protein level N.D.
Activity N.D.
Diagnosis Classical X-linked CGD
Symptoms hepatic abscess
Sex XY
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative Description of pedigree:mother carrier
//
ID #V17X21(1); standard; MUTATION; NTERM
Accession A0215
Systematic name g.3028delG, c.49delG, r.49delg, p.Val17fsX5
Original code IV-28 ref [1]
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3028
Feature /change: -g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 63
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 17
Feature /change: V -> FGWGX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
//
ID W18C(1); standard; MUTATION; NTERM
Accession A0083
Systematic name g.3033G>C, c.54G>C, r.54g>c, p.Trp18Cys
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 7750432
RefAuthors Glaser, J., Gahr, M., munnethal, A., Mann, O., von Eiff,
RefAuthors M., Pausch, J.
RefTitle [chronic granulomatosis: a rare differential diagnosis in
RefTitle liver granulomas in adulthood]
RefLoc Dtsch Med Wochenschr 120:646-648 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3033
Feature /change: g -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 68
Feature /codon: tgg -> tgc; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 18
Feature /change: W -> C
Feature /domain: NTERM
Phenotype X91 -
Heme level 10 %
Oxidase act. 0
NBT-slide 2,4% (40% weakly positive)
Symptoms Mild CGD
Sex XY
Ethnic origin Caucasian (German)
//
ID W18X(2); standard; MUTATION; NTERM
Accession A0672
Systematic name g.3032G>A, c.53G>A, r.53g>a, p.Trp18X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3032
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 67
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 18
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @W18X34(1); standard; MUTATION; NTERM
Accession A0349
Systematic name g.3031dupT, c.52dupT, r.52dupu, p.Trp18fsX17
Description A frame shift duplication mutation in the exon 2 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 3032
Feature /change: +t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 67
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 18
Feature /change: W -> LAGVERLPLC LVLPGLX
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID G20R(1); standard; MUTATION; NTERM
Accession A0136
Systematic name g.3037G>C, c.58G>C, r.58g>c, p.Gly20Arg
Original code VII-03? ref [2];IV-01 ref [3]
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8500277
RefAuthors Curnutte, J. T.
RefTitle Chronic granulomatous disease: the solving of a clinical
RefTitle riddle at the molecular level.
RefLoc Clin Immunol Immunopathol 67:S2-15 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3037
Feature /change: g -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 72
Feature /codon: ggg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 20
Feature /change: G -> R
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID G20R(2); standard; MUTATION; NTERM
Accession A0376
Systematic name g.3037G>C, c.58G>C, r.58g>c, p.Gly20Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3037
Feature /change: g -> c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 72
Feature /codon: ggg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 20
Feature /change: G -> R
Feature /domain: NTERM
Phenotype X9 0
Sex XY
Family history Inherited, mother is carrier
Comment Aunt and maternal grandmother are normal
//
ID G20R(3); standard; MUTATION; NTERM
Accession A0647
Systematic name g.3037G>A, c.58G>A, r.58g>a, p.Gly20Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3037
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 72
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 20
Feature /change: G -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID G20R(4); standard; MUTATION; NTERM
Accession A0673
Systematic name g.3037G>A, c.58G>A, r.58g>a, p.Gly20Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3037
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 72
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 20
Feature /change: G -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #N22X59(1); standard; MUTATION; NTERM
Accession A0674
Systematic name g.3045_3049delinsA, c.66_70delinsA, r.66_70delinsa,
Systematic name p.Asn22fsX38
Description A frame shift indel mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 3045..3049
Feature /change: cgtct -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 80..84
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 22..24
Feature /change: NVF -> KSSLSGITGF MIFHLSSFTQ ENFLGQHWHW PGPLQPAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @V23X35(1); standard; MUTATION; NTERM
Accession A0298
Systematic name g.3043_3046dup, c.64_67dup, r.64_67dup, p.Val23fsX13
Original code V-01 ref [1]
Description A frame shift duplication mutation in the exon 2 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 3047
Feature /change: +aacg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 82
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 23
Feature /change: V -> ERLPLCLVLP GLX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Italian)
//
ID #V27X59(1); standard; MUTATION; NTERM
Accession A0327
Systematic name g.3059_3062delTCTG, c.80_83delTCTG, r.80_83delucug,
Systematic name p.Val27fsX33
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3059..3062
Feature /change: -tctg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 94..97
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 27..28
Feature /change: VW -> GITGFMIFHL SSFTQENFLG QHWHWPGPLQ PAX
Feature /domain: NTERM
Sex XY
//
ID #V27X59(2); standard; MUTATION; NTERM
Accession A0328
Systematic name g.3059_3062delTCTG, c.80_83delTCTG, r.80_83delucug,
Systematic name p.Val27fsX33
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3059..3062
Feature /change: -tctg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 94..97
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 27..28
Feature /change: VW -> GITGFMIFHL SSFTQENFLG QHWHWPGPLQ PAX
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID #V27X59(3); standard; MUTATION; NTERM
Accession A0675
Systematic name g.3059_3062delTCTG, c.80_83delTCTG, r.80_83delucug,
Systematic name p.Val27fsX33
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3059..3062
Feature /change: -tctg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 94..97
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 27..28
Feature /change: VW -> GITGFMIFHL SSFTQENFLG QHWHWPGPLQ PAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #V27X59(4); standard; MUTATION; NTERM
Accession A0676
Systematic name g.3059_3062delTCTG, c.80_83delTCTG, r.80_83delucug,
Systematic name p.Val27fsX33
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3059..3062
Feature /change: -tctg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 94..97
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 27..28
Feature /change: VW -> GITGFMIFHL SSFTQENFLG QHWHWPGPLQ PAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #V27X59(5); standard; MUTATION; NTERM
Accession A0677
Systematic name g.3059_3062delTCTG, c.80_83delTCTG, r.80_83delucug,
Systematic name p.Val27fsX33
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3059..3062
Feature /change: -tctg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 94..97
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 27..28
Feature /change: VW -> GITGFMIFHL SSFTQENFLG QHWHWPGPLQ PAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W28X(1); standard; MUTATION; NTERM
Accession A0477
Systematic name g.3063G>A, c.84G>A, r.84g>a, p.Trp28X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Sex XY
//
ID W28X(2); standard; MUTATION; NTERM
Accession A0478
Systematic name g.3063G>A, c.84G>A, r.84g>a, p.Trp28X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Sex XY
//
ID W28X(3); standard; MUTATION; NTERM
Accession A0483
Systematic name g.3063G>A, c.84G>A, r.84g>a, p.Trp28X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Phenotype het
Sex XX
//
ID W28X(4); standard; MUTATION; NTERM
Accession A0563
Systematic name g.3063G>A, c.84G>A, r.84g>a, p.Trp28X
Original code P.1
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Liver granuloma, anal abscesses, gastric granuloma
Sex XY
//
ID W28X(5); standard; MUTATION; NTERM
Accession A0575
Systematic name g.3062G>A, c.83G>A, r.83g>a, p.Trp28X
Original code Patient J
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Bullous impetigo, pneumonia, diarrhea, skin infection,
Symptoms septic arthritis, otitis, cervical and perirectal
Symptoms abscesses, meningoencephalitis caused by Aspergillus
Symptoms fumigatus, inflammatory granuloma of the bowel
Sex XY
Ethnic origin Caucasoid/Negroid; Brazil
//
ID W28X(6); standard; MUTATION; NTERM
Accession A0678
Systematic name g.3062G>A, c.83G>A, r.83g>a, p.Trp28X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3062
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 97
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W28X(7); standard; MUTATION; NTERM
Accession A0679
Systematic name g.3063G>A, c.84G>A, r.84g>a, p.Trp28X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3063
Feature /change: g -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 98
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 28
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #Y29X60(1); standard; MUTATION; NTERM
Accession A0680
Systematic name g.3064delT, c.85delT, r.85delu, p.Tyr29fsX32
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3064
Feature /change: -t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 99
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 29
Feature /change: Y -> ITGFMIFHLS SFTQENFLGQ HWHWPGPLQP AX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y30X(1); standard; MUTATION; NTERM
Accession A0681
Systematic name g.3069C>A, c.90C>A, r.90c>a, p.Tyr30X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20228266
RefAuthors Hill, H. R., Augustine, N. H., Pryor, R. J., Reed, G. H.,
RefAuthors Bagnato, J. D., Tebo, A. E., Bender, J. M., Pasi, B. M.,
RefAuthors Chinen, J., Hanson, I. C., de Boer, M., Roos, D., Wittwer,
RefAuthors C. T.
RefTitle Rapid genetic analysis of x-linked chronic granulomatous
RefTitle disease by high-resolution melting.
RefLoc J Mol Diagn:368-376 (2010)
RefNumber [2]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3069
Feature /change: c -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 104
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 30
Feature /change: Y -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @R31X34(1); standard; MUTATION; NTERM
Accession A0683
Systematic name g.3071_3072insC, c.92_93insC, r.92_93insc, p.Val32fsX3
Original code BCH13 ref.[1]
Description A frame shift insertion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat:163 (2001)
RefNumber [2]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 3072
Feature /change: +c
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 107
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 31
Feature /change: R -> RGLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @V32X34(1); standard; MUTATION; NTERM
Accession A1425
Systematic name g.3073delinsGG, c.94delinsGG, r.94delinsgg, p.Val32fsX3
Original code AGS
Description A frame shift indel mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 07-Oct-2013 (Rel. 2, Created)
Date 07-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil.Hospital La Paz.Castellana
RefLoc 261.28046Madrid.Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 3073
Feature /change: g -> gg
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 108
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 32
Feature /change: V -> GLX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Age 3
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
//
ID @V32X34(2); standard; MUTATION; NTERM
Accession A1442
Systematic name g.3073dupG, c.94dupG, r.94dupg, p.Val32fsX3
Original code UGS
Description A frame shift duplication mutation in the exon 2 leading to
Description a premature stop codon in the NTERM domain
Date 09-Dec-2015 (Rel. 2, Created)
Date 09-Dec-2015 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (09-Dec-2015) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia-Planta
RefLoc sotano-Hospital Infantil-Hospital La Paz; Tel 917277238;
RefLoc Fax 917277095; e-mail antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 3074
Feature /change: +g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 109
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 32
Feature /change: V -> GLX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Brother CGD, Mother carrier
//
ID #V32X60(1); standard; MUTATION; NTERM
Accession A0684
Systematic name g.3073delG, c.94delG, r.94delg, p.Val32fsX29
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3073
Feature /change: -g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 108
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 32
Feature /change: V -> FMIFHLSSFT QENFLGQHWH WPGPLQPAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y33X(1); standard; MUTATION; NTERM
Accession A0024
Systematic name g.3078T>A, c.99T>A, r.99u>a, p.Tyr33X
Original code VIII-02 ref [1]
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3078
Feature /change: t -> a
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 113
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 33
Feature /change: Y -> X
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
Comment Sister is carrier
//
ID #I35X60(1); standard; MUTATION; NTERM
Accession A0685
Systematic name g.3084delT, c.105delT, r.105delu, p.Pro36fsX25
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3084
Feature /change: -t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 119
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 35
Feature /change: I -> IHLSSFTQEN FLGQHWHWPG PLQPAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID K38X(1); standard; MUTATION; NTERM
Accession A0686
Systematic name g.3091A>T, c.112A>T, r.112a>u, p.Lys38X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3091
Feature /change: a -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 126
Feature /codon: aag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 38
Feature /change: K -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y41D(1); standard; MUTATION; NTERM
Accession A0495
Systematic name g.3100T>G, c.121T>G, r.121u>g, p.Tyr41Asp
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3100
Feature /change: t -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 135
Feature /codon: tac -> gac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 41
Feature /change: Y -> D
Feature /domain: NTERM
//
ID Y41D(2); standard; MUTATION; NTERM
Accession A0544
Systematic name g.3100T>G, c.121T>G, r.121u>g, p.Tyr41Asp
Original code Ref. [1] X91- patient, Ref. [2] Patient 1
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 19-Oct-2006 (Rel. 2, Created)
Date 09-Apr-2008 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 12139950
RefAuthors Jirapongsananuruk, O., Niemela, J. E., Malech, H. L.,
RefAuthors Fleisher, T. A.
RefTitle CYBB mutation analysis in X-linked chronic granulomatous
RefTitle disease.
RefLoc Clin Immunol 104:73-76 (2002)
RefNumber [2]
RefCrossRef PUBMED; 12589359
RefAuthors Jirapongsananuruk, O., Malech, H. L., Kuhns, D. B.,
RefAuthors Niemela, J. E., Brown, M. R., Anderson-Cohen, M.,
RefAuthors Fleisher, T. A.
RefTitle Diagnostic paradigm for evaluation of male patients with
RefTitle chronic granulomatous disease, based on the
RefTitle dihydrorhodamine 123 assay.
RefLoc J Allergy Clin Immunol 111:374-379 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3100
Feature /change: t -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 135
Feature /codon: tac -> gac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 41
Feature /change: Y -> D
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #Y41X60(1); standard; MUTATION; NTERM
Accession A0018
Systematic name g.3100delT, c.121delT, r.121delu, p.Tyr41fsX20
Original code IV-29 ref [2]
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8167720
RefAuthors Roos, D., De Boer, M., De Klein, A., Bolscher, B. G.,
RefAuthors Weening, R. S.
RefTitle Chronic granulomatous disease: mutations in cytochrome
RefTitle b558.
RefLoc Immunodeficiency 4:289-301 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3100
Feature /change: -t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 135
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 41
Feature /change: Y -> TQENFLGQHW HWPGPLQPAX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
//
ID #Y41X60(2); standard; MUTATION; NTERM
Accession A0687
Systematic name g.3100delT, c.121delT, r.121delu, p.Tyr41fsX20
Description A frame shift deletion mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3100
Feature /change: -t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 135
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 41
Feature /change: Y -> TQENFLGQHW HWPGPLQPAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @Y41X102(1); standard; MUTATION; NTERM
Accession A0350
Systematic name g.3100_3101insT, c.135_136insT, p.Y41fsX102
Original code 91-2 ref [1]
Description Insertion in the exon 2 leading to a premature stop codon
Description in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 26-Jul-2002 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 3101
Feature /change: +t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 136
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 41
Feature /change: Y
Feature /change: -> LHKKTSWVST GTGQGPCSLP EFQLHADSLA SLSKSAVLPQ
Feature /change: GFQCVLLNKS SKTTGQESHL SX
Feature /domain: NTERM
Phenotype X91 0
//
ID T42R(1); standard; MUTATION; NTERM
Accession A0688
Systematic name g.3104C>G, c.125C>G, r.125c>g, p.Thr42Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3104
Feature /change: c -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 139
Feature /codon: aca -> aga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 42
Feature /change: T -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #T42X60(1); standard; MUTATION; NTERM
Accession A0689
Systematic name g.3105_3109delinsTTTC, c.126_130delinsTTTC,
Systematic name r.126_130delinsuuuc, p.Arg43fsX18
Description A frame shift indel mutation in the exon 2 leading to a
Description premature stop codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 3105..3109
Feature /change: aagaa -> tttc
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 140..144
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 42..44
Feature /change: TRK -> TFNFLGQHWH WPGPLQPAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R43X(1); standard; MUTATION; NTERM
Accession A0261
Systematic name g.3106A>T, c.127A>T, r.127a>u, p.Arg43X
Original code VIII-03 ref [1]
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3106
Feature /change: a -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 141
Feature /codon: aga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 43
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Italian)
//
ID R43X(2); standard; MUTATION; NTERM
Accession A0690
Systematic name g.3106A>T, c.127A>T, r.127a>u, p.Arg43X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3106
Feature /change: a -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 141
Feature /codon: aga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 43
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R43X(3); standard; MUTATION; NTERM
Accession A0691
Systematic name g.3106A>T, c.127A>T, r.127a>u, p.Arg43X
Description A point mutation in the exon 2 leading to a premature stop
Description codon in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3106
Feature /change: a -> t
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 141
Feature /codon: aga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 43
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID L45R(1); standard; MUTATION; NTERM
Accession A0692
Systematic name g.3113T>G, c.134T>G, r.134u>g, p.Leu45Arg
Description A point mutation in the exon 2 leading to an amino acid
Description change in the NTERM domain
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3113
Feature /change: t -> g
Feature /genomic_region: exon; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 148
Feature /codon: ctt -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 45
Feature /change: L -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S48X(1a); standard; MUTATION; NTERM
Accession A0712
Systematic name g.4428C>G, c.143C>G, r.143c>g, p.Ser48X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4428
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 157
Feature /codon: tca -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 48
Feature /change: S -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0713
//
ID S48X(1b); standard; MUTATION; NTERM
Accession A0713
Systematic name g.4428C>G, c.143C>G, r.143c>g, p.Ser48X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4428
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 157
Feature /codon: tca -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 48
Feature /change: S -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0712
//
ID #S48-1(1a); standard; MUTATION; NTERM
Accession A0599
Systematic name g.4427_4444delinsCCTGCCTGAATTTCT,
Systematic name c.142_159delinsCCTGCCTGAATTTCT,
Systematic name r.142_159delinsccugccugaauuucu,
Systematic name p.Ser48_Ala53delinsProAlaXIleSer
Original code MSM
Description An indel mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 05-Sep-2007 (Rel. 2, Created)
Date 05-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> cctgcctgaa tttct
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: complex; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> PAXIS
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Cervical adenitis, brain and pulmonary aspergillosis,
Symptoms granulomatous colitis
Age 0,5
Sex XY
Ethnic origin Spain
Family history Inherited
Relative Description of pedigree: Mother and two sisters carriers.
Relative Two nephews have Classical X-linked CGD.
Relative CYBBbase; A0600 nephew
Relative CYBBbase; A0601 nephew
//
ID #S48-1(1b); standard; MUTATION; NTERM
Accession A0600
Systematic name g.4427_4444delinsCCTGCCTGAATTTCT,
Systematic name c.142_159delinsCCTGCCTGAATTTCT,
Systematic name r.142_159delinsccugccugaauuucu,
Systematic name p.Ser48_Ala53delinsProAlaXIleSer
Original code NBS
Description An indel mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 05-Sep-2007 (Rel. 2, Created)
Date 05-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> cctgcctgaa tttct
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: complex; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> PAXIS
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, granulomatous colitis
Age 0,04
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree: Grandmother, mother and aunt
Relative carriers. Uncle and first cousin have Classical X-linked
Relative CGD.
Relative CYBBbase; A0599 uncle
Relative CYBBbase; A0601 cousin
//
ID #S48-1(1c); standard; MUTATION; NTERM
Accession A0601
Systematic name g.4427_4444delinsCCTGCCTGAATTTCT,
Systematic name c.142_159delinsCCTGCCTGAATTTCT,
Systematic name r.142_159delinsccugccugaauuucu,
Systematic name p.Ser48_Ala53delinsProAlaXIleSer
Original code LPS
Description An indel mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 05-Sep-2007 (Rel. 2, Created)
Date 05-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> cctgcctgaa tttct
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: complex; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> PAXIS
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Supurative otitis media, gingivostomatitis, salmonella
Symptoms sepsis
Age 0,8
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree: Grandmother, mother and aunt
Relative carriers. Uncle and first cousin have Classical X-linked
Relative CGD. Mother has Discoid Lupus Erythematosus
Relative CYBBbase; A0599 uncle
Relative CYBBbase; A0600 cousin
//
ID #S48X50(1a); standard; MUTATION; NTERM
Accession A0709
Systematic name g.4427_4444delinsTTAATTT, c.142_159delinsTTAATTT,
Systematic name r.142_159delinsuuaauuu, p.Ser48fsX3
Description A frame shift indel mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> ttaattt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> LIX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0710
Relative CYBBbase; A0711
//
ID #S48X50(1b); standard; MUTATION; NTERM
Accession A0710
Systematic name g.4427_4444delinsTTAATTT, c.142_159delinsTTAATTT,
Systematic name r.142_159delinsuuaauuu, p.Ser48fsX3
Description A frame shift indel mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> ttaattt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> LIX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0709
Relative CYBBbase; A0711
//
ID #S48X50(1c); standard; MUTATION; NTERM
Accession A0711
Systematic name g.4427_4444delinsTTAATTT, c.142_159delinsTTAATTT,
Systematic name r.142_159delinsuuaauuu, p.Ser48fsX3
Description A frame shift indel mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4427..4444
Feature /change: tcagcactgg cactggcc -> ttaattt
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 156..173
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 48..53
Feature /change: SALALA -> LIX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0709
Relative CYBBbase; A0710
//
ID A53D(1); standard; MUTATION; NTERM
Accession A0050
Systematic name g.4443C>A, c.158C>A, r.158c>a, p.Ala53Asp
Original code VII-04 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4443
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 172
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 53
Feature /change: A -> D
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Heme level Decreased (29%)
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD starting at 6 y
Sex XY
Ethnic origin Caucasian (Spanish)
Family history Inherited, mother is carrier
//
ID @A53X102(1); standard; MUTATION; NTERM
Accession A0160
Systematic name g.4444dupC, c.159dupC, r.159dupc, p.Arg54fsX49
Original code II-01 ref [1]
Description A frame shift duplication mutation in the exon 3 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4445
Feature /change: +c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 174
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 54
Feature /change: R ->
Feature /change: QGPCSLPEFQ LHADSLASLS KSAVLPQGFQ CVLLNKSSKT
Feature /change: TGQESHLSX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R54G(1); standard; MUTATION; NTERM
Accession A0243
Systematic name g.4445A>G, c.160A>G, r.160a>g, p.Arg54Gly
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4445
Feature /change: a -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 174
Feature /codon: agg -> ggg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 54
Feature /change: R -> G
Feature /domain: NTERM
Phenotype X91 +
Protein level Normal
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID R54M(1); standard; MUTATION; NTERM
Accession A0455
Systematic name g.4446G>T, c.161G>T, r.161g>u, p.Arg54Met
Original code pt 22 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4446
Feature /change: g -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 175
Feature /codon: agg -> atg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 54
Feature /change: R -> M
Feature /domain: NTERM
Phenotype X91 +
//
ID R54M(2); standard; MUTATION; NTERM
Accession A0715
Systematic name g.4446G>T, c.161G>T, r.161g>u, p.Arg54Met
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4446
Feature /change: g -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 175
Feature /codon: agg -> atg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 54
Feature /change: R -> M
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R54S(1); standard; MUTATION; NTERM
Accession A0133
Systematic name g.4447G>C, c.162G>C, r.162g>c, p.Arg54Ser
Original code T.J. ref [1];VII-05 ref [2];IV-02 ref [3]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7713925
RefAuthors Cross, A. R., Heyworth, P. G., Rae, J., Curnutte, J. T.
RefTitle A variant X-linked chronic granulomatous disease
RefTitle patient (X91+) with partially functional cytochrome b.
RefLoc J Biol Chem 270:8194-8200 (1995)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4447
Feature /change: g -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 176
Feature /codon: agg -> agc; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 54
Feature /change: R -> S
Feature /domain: NTERM
Phenotype X91 +
Protein level Normal
Oxidase act. 0
Symptoms Mild CGD
Sex XY
//
ID #R54-2(1); standard; MUTATION; NTERM
Accession A0322
Systematic name g.4445_4450delAGGGCC, c.160_165delAGGGCC,
Systematic name r.160_165delagggcc, p.Arg54_Pro56del
Description An inframe deletion in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4445..4450
Feature /change: -agggcc
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 174..179
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 54..55
Feature /change: -RA
Feature /domain: NTERM
Sex XY
//
ID #R54-2(2); standard; MUTATION; NTERM
Accession A0714
Systematic name g.4445_4450delAGGGCC, c.160_165delAGGGCC,
Systematic name r.160_165delagggcc, p.Arg54_Pro56del
Description An inframe deletion in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4445..4450
Feature /change: -agggcc
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 174..179
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 54..55
Feature /change: -RA
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A55D(1); standard; MUTATION; NTERM
Accession A0353
Systematic name g.4449C>A, c.164C>A, r.164c>a, p.Ala55Asp
Original code 24 ref [1];91-4 ref [2]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4449
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 178
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 55
Feature /change: A -> D
Feature /domain: NTERM
Phenotype X91 0
//
ID A55D(2); standard; MUTATION; NTERM
Accession A0716
Systematic name g.4449C>A, c.164C>A, r.164c>a, p.Ala55Asp
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4449
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 178
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 55
Feature /change: A -> D
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A55D(3); standard; MUTATION; NTERM
Accession A0717
Systematic name g.4449C>A, c.164C>A, r.164c>a, p.Ala55Asp
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4449
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 178
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 55
Feature /change: A -> D
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID P56L(1a); standard; MUTATION; NTERM
Accession A0244
Systematic name g.4452C>T, c.167C>T, r.167c>u, p.Pro56Leu
Original code HKR ref [1];VII-06 ref [2]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8070813
RefAuthors Roos, D.
RefTitle The genetic basis of chronic granulomatous disease.
RefLoc Immunol Rev 138:121-157 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4452
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 181
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 56
Feature /change: P -> L
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 -
Protein level Decreased
Heme level 60 %
Oxidase act. Strongly decreased
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Danish)
Relative CYBBbase; A0245 brother
//
ID P56L(1b); standard; MUTATION; NTERM
Accession A0245
Systematic name g.4452C>T, c.167C>T, r.167c>u, p.Pro56Leu
Original code JKR ref [1];VII-06 ref [2]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8070813
RefAuthors Roos, D.
RefTitle The genetic basis of chronic granulomatous disease.
RefLoc Immunol Rev 138:121-157 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4452
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 181
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 56
Feature /change: P -> L
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 -
Protein level Decreased
Oxidase act. Strongly decreased
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Danish)
Relative CYBBbase; A0244 brother
//
ID P56L(2); standard; MUTATION; NTERM
Accession A0304
Systematic name g.4452C>T, c.167C>T, r.167c>u, p.Pro56Leu
Original code VII-07 ref [2]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 10-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7918677
RefAuthors Thrasher, A. J., Keep, N. H., Wientjes, F., Segal, A. W.
RefTitle Chronic granulomatous disease.
RefLoc Biochim Biophys Acta 1227:1-24 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4452
Feature /change: c -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 181
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 56
Feature /change: P -> L
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Sex ??
//
ID A57E(1); standard; MUTATION; NTERM
Accession A0069
Systematic name g.4455C>A, c.170C>A, r.170c>a, p.Ala57Glu
Original code "VII-08 ref [2];91-5" ref [4]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8101486
RefAuthors Ariga, T., Sakiyama, Y., Tomizawa, K., Imajoh-Ohmi, S.,
RefAuthors Kanegasaki, S., Matsumoto, S.
RefTitle A newly recognized point mutation in the cytochrome b558
RefTitle heavy chain gene replacing alanine57 by glutamic acid, in
RefTitle a patient with cytochrome b positive X-linked chronic
RefTitle granulomatous disease.
RefLoc Eur J Pediatr 152:469-472 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [4]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4455
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 184
Feature /codon: gca -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 57
Feature /change: A -> E
Feature /domain: NTERM
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
Family history Inherited, mother is carrier
//
ID A57E(2); standard; MUTATION; NTERM
Accession A0718
Systematic name g.4455C>A, c.170C>A, r.170c>a, p.Ala57Glu
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4455
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 184
Feature /codon: gca -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 57
Feature /change: A -> E
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C59F(1); standard; MUTATION; NTERM
Accession A0362
Systematic name g.4461G>T, c.176G>T, r.176g>u, p.Cys59Phe
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4461
Feature /change: g -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 190
Feature /codon: tgc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> F
Feature /domain: NTERM
Phenotype X91 -
Heme level Normal
//
ID C59R(1a); standard; MUTATION; NTERM
Accession A0175
Systematic name g.4460T>C, c.175T>C, r.175u>c, p.Cys59Arg
Original code IV-03 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4460
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 189
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> R
Feature /domain: NTERM
Phenotype X91 0
Protein level Decreased
Heme level Normal
Oxidase act. Decreased
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0176 brother
//
ID C59R(1b); standard; MUTATION; NTERM
Accession A0176
Systematic name g.4460T>C, c.175T>C, r.175u>c, p.Cys59Arg
Original code IV-03 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4460
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 189
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> R
Feature /domain: NTERM
Phenotype X91 0
Protein level Decreased
Heme level Normal
Oxidase act. Decreased
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0175 brother
//
ID C59R(2); standard; MUTATION; NTERM
Accession A0719
Systematic name g.4460T>C, c.175T>C, r.175u>c, p.Cys59Arg
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4460
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 189
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C59R(3); standard; MUTATION; NTERM
Accession A1421
Systematic name g.4460T>C, c.175T>C, r.175u>c, p.Cys59Arg
Original code PSC
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 20-Jun-2012 (Rel. 2, Created)
Date 20-Jun-2012 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (20-Jun-2012) to CYBBbase.
RefLoc Oscar de la Calle-Martin; Immunology, Hospital Sant Pau,
RefLoc Universitat Autonoma Barcelona, Spain; Tel +34 935537546;
RefLoc Fax +34 935537598; e-mail odlcalle@santpau.cat
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4460
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 189
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> R
Feature /domain: NTERM
mRNA level Normal
Protein level Normal
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms colitis, anemia, osteomyelitis, endocarditis
Age 1
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:His elder brother had died due to a
Relative sepsis when he was 15-months old before the propositus was
Relative born. DNA analysis in a frozen biopsy revealed the same
Relative CYBB mutation.
//
ID C59W(1); standard; MUTATION; NTERM
Accession A0246
Systematic name g.4462C>G, c.177C>G, r.177c>g, p.Cys59Trp
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4462
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 191
Feature /codon: tgc -> tgg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> W
Feature /domain: NTERM
Phenotype X91 0
Heme level Normal
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (French)
Family history Inherited, mother is carrier
Comment Patient deceased
//
ID C59W(2); standard; MUTATION; NTERM
Accession A0541
Systematic name g.4462C>G, c.177C>G, r.177c>g, p.Cys59Trp
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4462
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 191
Feature /codon: tgc -> tgg; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> W
Feature /domain: NTERM
Sex XY
//
ID C59Y(1); standard; MUTATION; NTERM
Accession A0363
Systematic name g.4461G>A, c.176G>A, r.176g>a, p.Cys59Tyr
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4461
Feature /change: g -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 190
Feature /codon: tgc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> Y
Feature /domain: NTERM
Phenotype het
Sex XX
//
ID C59X(1); standard; MUTATION; NTERM
Accession A0720
Systematic name g.4462C>A, c.177C>A, r.177c>a, p.Cys59X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4462
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 191
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 59
Feature /change: C -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #F62X66(1); standard; MUTATION; NTERM
Accession A0614
Systematic name g.4470delT, c.185delT, r.185delu, p.Phe62fsX5
Original code BiMi
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4470
Feature /change: -t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 199
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 62
Feature /change: F -> STACX
Feature /domain: NTERM
mRNA level N.D.
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Sespis, pulmonary and bone aspergillosis, liver abscess
Age 5
Sex XY
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative Description of pedigree:mother and 2 sisters carriers
//
ID N63K(1a); standard; MUTATION; NTERM
Accession A0413
Systematic name g.4474C>G, c.189C>G, r.189c>g, p.Asn63Lys
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4474
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 203
Feature /codon: aac -> aag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 63
Feature /change: N -> K
Feature /domain: NTERM
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0414 cousin
//
ID N63K(1b); standard; MUTATION; NTERM
Accession A0414
Systematic name g.4474C>G, c.189C>G, r.189c>g, p.Asn63Lys
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4474
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 203
Feature /codon: aac -> aag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 63
Feature /change: N -> K
Feature /domain: NTERM
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0413 cousin
//
ID N63K(2); standard; MUTATION; NTERM
Accession A0721
Systematic name g.4474C>G, c.189C>G, r.189c>g, p.Asn63Lys
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4474
Feature /change: c -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 203
Feature /codon: aac -> aag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 63
Feature /change: N -> K
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C64R(1); standard; MUTATION; NTERM
Accession A0247
Systematic name g.4475T>C, c.190T>C, r.190u>c, p.Cys64Arg
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4475
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 204
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 64
Feature /change: C -> R
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level Normal
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (French)
//
ID C64R(2); standard; MUTATION; NTERM
Accession A0722
Systematic name g.4475T>C, c.190T>C, r.190u>c, p.Cys64Arg
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4475
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 204
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 64
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C64X(1); standard; MUTATION; NTERM
Accession A0364
Systematic name g.4477C>A, c.192C>A, r.192c>a, p.Cys64X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4477
Feature /change: c -> a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 206
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 64
Feature /change: C -> X
Feature /domain: NTERM
Heme level Normal
Sex XY
//
ID M65R(1a); standard; MUTATION; NTERM
Accession A0723
Systematic name g.4479T>G, c.194T>G, r.194u>g, p.Met65Arg
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4479
Feature /change: t -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 208
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 65
Feature /change: M -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0724
//
ID M65R(1b); standard; MUTATION; NTERM
Accession A0724
Systematic name g.4479T>G, c.194T>G, r.194u>g, p.Met65Arg
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4479
Feature /change: t -> g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 208
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 65
Feature /change: M -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0723
//
ID L66P(1); standard; MUTATION; NTERM
Accession A0725
Systematic name g.4482T>C, c.197T>C, r.197u>c, p.Leu66Pro
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4482
Feature /change: t -> c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 211
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 66
Feature /change: L -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @L66X102(1a); standard; MUTATION; NTERM
Accession A0196
Systematic name g.4480dupG, c.195dupG, r.195dupg, p.Leu66fsX37
Original code V-02 ? ref [1];II-02 ref [2]
Description A frame shift duplication mutation in the exon 3 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4481
Feature /change: +g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 210
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 66
Feature /change: L -> ADSLASLSKS AVLPQGFQCV LLNKSSKTTG QESHLSX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0197 brother
//
ID @L66X102(1b); standard; MUTATION; NTERM
Accession A0197
Systematic name g.4480dupG, c.195dupG, r.195dupg, p.Leu66fsX37
Original code V-02 ? ref [1];II-02 ref [2]
Description A frame shift duplication mutation in the exon 3 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
FRefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4481
Feature /change: +g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 210
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 66
Feature /change: L -> ADSLASLSKS AVLPQGFQCV LLNKSSKTTG QESHLSX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0196 brother
//
ID @V71X102(1); standard; MUTATION; NTERM
Accession A0726
Systematic name g.4495dupA, c.210dupA, r.210dupa, p.Val71fsX32
Description A frame shift duplication mutation in the exon 3 leading to
Description a premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4496
Feature /change: +a
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 225
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 71
Feature /change: V -> SLSKSAVLPQ GFQCVLLNKS SKTTGQESHL SX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(1); standard; MUTATION; NTERM
Accession A0008
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Original code BC ref [1];VIII-04 ref [2]
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
Comment Sister prenatally normal
//
ID R73X(2); standard; MUTATION; NTERM
Accession A0188
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Original code III-02 ref [1]
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R73X(3); standard; MUTATION; NTERM
Accession A0262
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Original code VIII-05 ref [1]
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Polish)
Comment Father, mother, sister normal
//
ID R73X(4); standard; MUTATION; NTERM
Accession A0263
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Australian)
Family history Inherited, mother carrier
Comment Maternal aunts, grand- and great-grandmother are carriers, uncle and cousin are normal
//
ID R73X(5); standard; MUTATION; NTERM
Accession A0456
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Original code III-03 ref [1]
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R73X(6); standard; MUTATION; NTERM
Accession A0457
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
//
ID R73X(7); standard; MUTATION; NTERM
Accession A0458
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R73X(8); standard; MUTATION; NTERM
Accession A0459
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
//
ID R73X(9); standard; MUTATION; NTERM
Accession A0576
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Original code Patient I
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent infections starting with pneumonia, followed by
Symptoms bone infection and abscesses in the axilla and liver,
Symptoms cutaneous and mucosal infections caused by Candida species
Sex XY
Ethnic origin Caucasoid; Brazil
//
ID R73X(10); standard; MUTATION; NTERM
Accession A0727
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(11); standard; MUTATION; NTERM
Accession A0728
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(12); standard; MUTATION; NTERM
Accession A0729
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(13); standard; MUTATION; NTERM
Accession A0730
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(14); standard; MUTATION; NTERM
Accession A0731
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(15); standard; MUTATION; NTERM
Accession A0732
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(16); standard; MUTATION; NTERM
Accession A0733
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(17); standard; MUTATION; NTERM
Accession A0734
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(18); standard; MUTATION; NTERM
Accession A0735
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(19); standard; MUTATION; NTERM
Accession A0736
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(20); standard; MUTATION; NTERM
Accession A0737
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(21); standard; MUTATION; NTERM
Accession A0738
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(22); standard; MUTATION; NTERM
Accession A0739
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(23); standard; MUTATION; NTERM
Accession A0740
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(24); standard; MUTATION; NTERM
Accession A0741
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R73X(25); standard; MUTATION; NTERM
Accession A0742
Systematic name g.4502C>T, c.217C>T, r.217c>u, p.Arg73X
Description A point mutation in the exon 3 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4502
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 231
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 73
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #L76X107(1a); standard; MUTATION; NTERM
Accession A0743
Systematic name g.4511delC, c.226delC, r.226delc, p.Leu76fsX32
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4511
Feature /change: -c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 240
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 76
Feature /change: L -> CPSSGVPVRA AQQEFEDNWT GISPFIKWWH GX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0744
//
ID #L76X107(1b); standard; MUTATION; NTERM
Accession A0744
Systematic name g.4511delC, c.226delC, r.226delc, p.Leu76fsX32
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4511
Feature /change: -c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 240
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 76
Feature /change: L -> CPSSGVPVRA AQQEFEDNWT GISPFIKWWH GX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0743
//
ID #G81X107(1); standard; MUTATION; NTERM
Accession A0011
Systematic name g.4527delG, c.242delG, r.242delg, p.Gly81fsX27
Original code IV-31 ref [1]
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4527
Feature /change: -g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 256
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 81
Feature /change: G -> VPVRAAQQEF EDNWTGISPF IKWWHGX
Feature /domain: NTERM
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
Comment Two brothers died young, one of tubercolosis-like disease, one of skin infection and lymphadenopathy
//
ID #G81X107(2); standard; MUTATION; NTERM
Accession A0745
Systematic name g.4527delG, c.242delG, r.242delg, p.Gly81fsX27
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4527
Feature /change: -g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 256
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 81
Feature /change: G -> VPVRAAQQEF EDNWTGISPF IKWWHGX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @G81X102(1); standard; MUTATION; NTERM
Accession A0746
Systematic name g.4527dupG, c.242dupG, r.242dupg, p.Ser82fsX21
Description A frame shift duplication mutation in the exon 3 leading to
Description a premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4528
Feature /change: +g
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 257
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 81
Feature /change: G -> GFQCVLLNKS SKTTGQESHL SX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(1); standard; MUTATION; NTERM
Accession A0022
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion; loss of exon sequence
Feature /loc: IDRefSeq: C0025: 156..266
Feature /change: -tcagcactgg cactggccag ggcccctgca gcctgcctga
Feature /change: atttcaactg catgctgatt ctcttgccag tctgtcgaaa
Feature /change: tctgctgtcc ttcctcaggg gttccagtgc g
Feature /note: skipping of exon 3
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /loc: GenBank: NP_000388: 48..84
Feature /name: deletion; inframe
Feature /change: -SALALARAPA ACLNFNCMLI LLPVCRNLLS FLRGSSA
Feature /domain: NTERM
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
//
ID A84A(2); standard; MUTATION; NTERM
Accession A0063
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code pat. 7 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion; loss of exon sequence
Feature /loc: IDRefSeq: C0025: 156..266
Feature /change: -tcagcactgg cactggccag ggcccctgca gcctgcctga
Feature /change: atttcaactg catgctgatt ctcttgccag tctgtcgaaa
Feature /change: tctgctgtcc ttcctcaggg gttccagtgc g
Feature /note: skipping of exon 3
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /loc: GenBank: NP_000388: 48..84
Feature /name: deletion; inframe
Feature /change: -SALALARAPA ACLNFNCMLI LLPVCRNLLS FLRGSSA
Feature /domain: NTERM
mRNA level Smaller mRNA
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
Family history Inherited, mother is carrier
//
ID A84A(3); standard; MUTATION; NTERM
Accession A0100
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code V-08 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
//
ID A84A(4); standard; MUTATION; NTERM
Accession A0127
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code V-11 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
//
ID A84A(5); standard; MUTATION; NTERM
Accession A0193
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code V-10 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
//
ID A84A(6); standard; MUTATION; NTERM
Accession A0226
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code VI-05 ref [1];P.C. ref [2]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 8615831
RefAuthors Porter, C. D., Kuribayashi, F., Parkar, M. H., Roos, D.,
RefAuthors Kinnon, C.
RefTitle Detection of gp91-phox precursor protein in B-cell lines
RefTitle from patients with X-linked chronic granulomatous disease
RefTitle as an indicator for mutations impairing cytochrome b558
RefTitle biosynthesis.
RefLoc Biochem J 315 ( Pt 2):571-575 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Sex XY
Ethnic origin Caucasian (British)
//
ID A84A(7); standard; MUTATION; NTERM
Accession A0227
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code VI-06 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
Comment Maternal grandmother normal.
//
ID A84A(8a); standard; MUTATION; NTERM
Accession A0228
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code VI-07 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0229 brother
Comment Father normal
//
ID A84A(8b); standard; MUTATION; NTERM
Accession A0229
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code VI-07 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0228 brother
Comment Father normal
//
ID A84A(9); standard; MUTATION; NTERM
Accession A0230
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code VI-08 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID A84A(10); standard; MUTATION; NTERM
Accession A0231
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID A84A(11); standard; MUTATION; NTERM
Accession A0354
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code V-09 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
mRNA level + normal mRNA
Phenotype X91 -
//
ID A84A(12); standard; MUTATION; NTERM
Accession A0355
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code 91-6 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
mRNA level + normal mRNA
Phenotype X91 0
//
ID A84A(13); standard; MUTATION; NTERM
Accession A0356
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code 91-7 ref [1]
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
mRNA level + normal mRNA
Phenotype X91 0
//
ID A84A(14); standard; MUTATION; NTERM
Accession A0357
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Polish)
//
ID A84A(15); standard; MUTATION; NTERM
Accession A0534
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code LBMS
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 05-Nov-2002 (Rel. 7, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Submitted (05-Nov-2002) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan., Servicio
RefLoc de Inmunologia-Edificio Anatomia Patologica-Hospital La
RefLoc Paz-Castellana 261-28046 Madrid-Espana, Tel 917277238, Fax
RefLoc 917277095, e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
mRNA level N.D.
Protein level Absent
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Carriers: Grandmother, Mother,
Relative Aunt.
//
ID A84A(16); standard; MUTATION; NTERM
Accession A0577
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code Patient K
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent pneumonia and chronic lung disease, including
Symptoms bronchiectasis and fibrosis; otitis, sinusitis, skin
Symptoms infections, and diarrhea caused by Salmonella sp.
Sex XY
Ethnic origin Negroid; Brazil
Comment Patient also have erythrocyte glucose-6-phosphate
Comment dehydrogenase deficiency (African variant)
//
ID A84A(17); standard; MUTATION; NTERM
Accession A0578
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code Patient F
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Cytomegalovirus infection, recurrent pneumonia,
Symptoms tonsillitis, otitis, sinusitis, skin infection,
Symptoms lymphadenitis, granulomas that resulted in gastric
Symptoms obstruction, granulomas obstructing the airway and urinary
Symptoms tract
Sex XY
Ethnic origin Caucasoid; Brazil
//
ID A84A(18); standard; MUTATION; NTERM
Accession A0633
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code P9
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 22-May-2008 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent pulmonary Tuberculosis
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID A84A(19); standard; MUTATION; NTERM
Accession A0634
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code P10
Description Point mutation in the end of exon 3 leading to splice
Description donor defect
Date 22-May-2008 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Skin abscess
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID A84A(20); standard; MUTATION; NTERM
Accession A0642
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code patient
Description Point mutation in the end of exon 3 leading to splice
Description donor defect
Date 04-Jun-2008 (Rel. 2, Created)
Date 04-Jun-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17543165
RefAuthors Brunner, J., Dockter, G., Rosen-Wolff, A., Roesler, J.
RefTitle X-linked chronic granulomatous disease (CGD) caused by an
RefTitle intra-exonic splice mutation (CYBB exon 3, c.262G->A)
RefTitle is mimicking juvenile sarcoidosis.
RefLoc Clin Exp Rheumatol:336-338 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change:a A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Cervical and pulmonary lymphadenopathy, liver abscess
Sex XY
//
ID A84A(21); standard; MUTATION; NTERM
Accession A0747
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(22a); standard; MUTATION; NTERM
Accession A0748
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0749
//
ID A84A(22b); standard; MUTATION; NTERM
Accession A0749
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0748
//
ID A84A(23a); standard; MUTATION; NTERM
Accession A0750
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0751
//
ID A84A(23b); standard; MUTATION; NTERM
Accession A0751
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0750
//
ID A84A(24a); standard; MUTATION; NTERM
Accession A0752
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0753
//
ID A84A(24b); standard; MUTATION; NTERM
Accession A0753
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0752
//
ID A84A(25a); standard; MUTATION; NTERM
Accession A0754
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0755
//
ID A84A(25b); standard; MUTATION; NTERM
Accession A0755
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0754
//
ID A84A(26a); standard; MUTATION; NTERM
Accession A0756
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0757
//
ID A84A(26b); standard; MUTATION; NTERM
Accession A0757
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0756
//
ID A84A(27a); standard; MUTATION; NTERM
Accession A0758
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0759
//
ID A84A(27b); standard; MUTATION; NTERM
Accession A0759
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0758
//
ID A84A(28a); standard; MUTATION; NTERM
Accession A0760
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0761
//
ID A84A(28b); standard; MUTATION; NTERM
Accession A0761
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0760
//
ID A84A(29a); standard; MUTATION; NTERM
Accession A0762
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0763
//
ID A84A(29b); standard; MUTATION; NTERM
Accession A0763
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0762
//
ID A84A(30); standard; MUTATION; NTERM
Accession A0764
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(31); standard; MUTATION; NTERM
Accession A0765
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(32); standard; MUTATION; NTERM
Accession A0766
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(33); standard; MUTATION; NTERM
Accession A0767
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(34); standard; MUTATION; NTERM
Accession A0768
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(35); standard; MUTATION; NTERM
Accession A0769
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(36); standard; MUTATION; NTERM
Accession A0770
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(37); standard; MUTATION; NTERM
Accession A0771
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(38); standard; MUTATION; NTERM
Accession A0772
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(39); standard; MUTATION; NTERM
Accession A0773
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(40); standard; MUTATION; NTERM
Accession A0774
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(41); standard; MUTATION; NTERM
Accession A0775
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(42); standard; MUTATION; NTERM
Accession A0776
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(43); standard; MUTATION; NTERM
Accession A0777
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A84A(44a); standard; MUTATION; NTERM
Accession A0778
Systematic name g.4537G>T, c.252G>T, r.252g>u, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gct; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0779
//
ID A84A(44b); standard; MUTATION; NTERM
Accession A0779
Systematic name g.4537G>T, c.252G>T, r.252g>u, p.Ala84Ala
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> t
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gct; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0778
//
ID A84A(45); standard; MUTATION; NTERM
Accession A1430
Systematic name g.4537G>A, c.252G>A, r.252g>a, p.Ala84Ala
Original code JMU
Description A point mutation in the exon 3 leading to an amino acid
Description change in the NTERM domain
Date 06-Nov-2013 (Rel. 2, Created)
Date 06-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (06-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta
RefLoc sotano-Hospital Infantil.Hospital La Paz. Castellana 261.
RefLoc 28046 Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4537
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 266
Feature /codon: gcg -> gca; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> A
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Age 4
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier
Comment Now helthy by hematopoietic stem cell transplantation from
Comment sister HLA identical
//
ID #A84X107(1); standard; MUTATION; NTERM
Accession A0110
Systematic name g.4536delC, c.251delC, r.251delc, p.Ala84fsX24
Original code V-07 ref [1]
Description A frame shift deletion mutation in the exon 3 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4536
Feature /change: -c
Feature /genomic_region: exon; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 265
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 84
Feature /change: A -> GAAQQEFEDN WTGISPFIKW WHGX
Feature /domain: NTERM
mRNA level Multiple spliced mRNA's
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID C85X(1); standard; MUTATION; NTERM
Accession A0365
Systematic name g.12910C>A, c.255C>A, r.255c>a, p.Cys85X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12910
Feature /change: c -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 269
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 85
Feature /change: C -> X
Feature /domain: NTERM
Phenotype X91 0
Heme level Normal
Sex XY
Family history Inherited, mother is carrier
//
ID #R89X107(1); standard; MUTATION; NTERM
Accession A1439
Systematic name g.12921delG, c.266delG, r.266delg, p.Arg89fsX19
Original code JCAP
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12921
Feature /change: -g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 280
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 89
Feature /change: R -> KFEDNWTGIS PFIKWWHGX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Submandibular, axillary and inguinal
Symptoms lymphadenophaty,epilepsy,
Symptoms salmonellosis,gingivitis,pulmonary aspergillosis,anal
Symptoms furunculosis,anal fistula,pelvic osteomyelitis,pneumonia
Age 6.5
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier
Comment Deceased
//
ID R91X(1); standard; MUTATION; NTERM
Accession A0029
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code VIII-08
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Swiss)
//
ID R91X(2); standard; MUTATION; NTERM
Accession A0149
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code VIII-09? ref [1];III-04 ref [2]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Protein level 0
Oxidase act. 0
Sex XY
//
ID R91X(3); standard; MUTATION; NTERM
Accession A0178
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code III-05 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Protein level 0
Oxidase act. 0
Sex XY
//
ID R91X(4a); standard; MUTATION; NTERM
Accession A0264
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code VIII-06 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Swedish)
Family history Inherited, mother carrier
Relative CYBBbase; A0265 brother
Comment Mother is carrier
//
ID R91X(4b); standard; MUTATION; NTERM
Accession A0265
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code VIII-06 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Swedish)
Family history Inherited, mother carrier
Relative CYBBbase; A0264 brother
Comment Mother is carrier
//
ID R91X(5); standard; MUTATION; NTERM
Accession A0266
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code VIII-07 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited, mother carrier
//
ID R91X(6); standard; MUTATION; NTERM
Accession A0460
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Family history Inherited, mother carrier
//
ID R91X(7); standard; MUTATION; NTERM
Accession A0461
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
Comment Mother is carrier
//
ID R91X(8); standard; MUTATION; NTERM
Accession A0462
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code 91-8 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
//
ID R91X(9); standard; MUTATION; NTERM
Accession A0463
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
//
ID R91X(10); standard; MUTATION; NTERM
Accession A0464
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Phenotype X91 0
Sex XY
//
ID R91X(11); standard; MUTATION; NTERM
Accession A0643
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code proband 1
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 04-Jun-2008 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 18402298
RefAuthors Vilaiphan, P., Chatchatee, P., Ngamphaiboon, J.,
RefAuthors Tongkobpetch, S., Suphapeetiporn, K., Shotelersuk, V.
RefTitle Nonsense mutations of the CYBB gene in two thai families
RefTitle with X-linked chronic granulomatous disease.
RefLoc Asian Pac J Allergy Immunol:243-247 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Severe persistent pulmonary infections
Sex XY
Ethnic origin Mongoloid; Thailand
Family history Inherited
//
ID R91X(12); standard; MUTATION; NTERM
Accession A0799
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(13); standard; MUTATION; NTERM
Accession A0800
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(14); standard; MUTATION; NTERM
Accession A0801
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(15); standard; MUTATION; NTERM
Accession A0802
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(16); standard; MUTATION; NTERM
Accession A0803
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(17); standard; MUTATION; NTERM
Accession A0804
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(18); standard; MUTATION; NTERM
Accession A0805
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(19); standard; MUTATION; NTERM
Accession A0806
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(20); standard; MUTATION; NTERM
Accession A0807
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(21); standard; MUTATION; NTERM
Accession A0808
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(22); standard; MUTATION; NTERM
Accession A0809
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(23); standard; MUTATION; NTERM
Accession A0810
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(24); standard; MUTATION; NTERM
Accession A0811
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R91X(25); standard; MUTATION; NTERM
Accession A1418
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code HGP
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 20-Feb-2012 (Rel. 2, Created)
Date 20-Feb-2012 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (20-Feb-2012) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia-Planta SAntano
RefLoc Hospital Materno Infantil-Hospital La Paz-Castellana
RefLoc 261-28046 Madrid-Spain; Tel 917277238; Fax 917277095;
RefLoc e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
mRNA level Normal
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms submandibular adenitis, intraperitoneal abcesses
Age 1
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
//
ID R91X(26); standard; MUTATION; NTERM
Accession A1419
Systematic name g.12926C>T, c.271C>T, r.271c>u, p.Arg91X
Original code HGP
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 20-Feb-2012 (Rel. 2, Created)
Date 20-Feb-2012 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (20-Feb-2012) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia-Planta Sotano
RefLoc Hospital Materno Infantil-Hospital La Paz-Castellana
RefLoc 261-28046 Madrid-Spain; Tel 917277238; Fax 917277095;
RefLoc e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12926
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 285
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 91
Feature /change: R -> X
Feature /domain: NTERM
mRNA level Normal
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Submandibular abcesses, intraperitoneal adenitis
Age 1
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier
//
ID #R92X107(1); standard; MUTATION; NTERM
Accession A0798
Systematic name g.12930delG, c.275delG, r.275delg, p.Arg92fsX16
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12930
Feature /change: -g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 289
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 92
Feature /change: R -> NNWTGISPFI KWWHGX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #R96X100(1); standard; MUTATION; NTERM
Accession A0812
Systematic name g.12941_12945delAGGAA, c.286_290delAGGAA,
Systematic name r.286_290delaggaa, p.Arg96fsX5
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12941..12945
Feature /change: -aggaa
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 300..304
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 96..97
Feature /change: RN -> SHLSX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #T99X107(1); standard; MUTATION; NTERM
Accession A0097
Systematic name g.12950delA, c.295delA, r.295dela, p.Thr99fsX9
Original code IV-32 ref [1];II-03 ref [2]
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12950
Feature /change: -a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 309
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 99
Feature /change: T -> PFIKWWHGX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID #T99X119(1a); standard; MUTATION; NTERM
Accession A0813
Systematic name g.12951_12961delinsTCC, c.296_306delinsTCC,
Systematic name r.296_306delinsucc, p.Thr99fsX21
Description A frame shift indel mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 12951
Feature /change: cctttcataa a -> tcc
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 310
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 99..102
Feature /change: TFHK -> IHGGMDDCTS LCDSHHCTSI X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0814
Relative CYBBbase; A0815
//
ID #T99X119(1b); standard; MUTATION; NTERM
Accession A0814
Systematic name g.12951_12961delinsTCC, c.296_306delinsTCC,
Systematic name r.296_306delinsucc, p.Thr99fsX21
Description A frame shift indel mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 12951
Feature /change: cctttcataa a -> tcc
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 310
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 99..102
Feature /change: TFHK -> IHGGMDDCTS LCDSHHCTSI X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0813
Relative CYBBbase; A0815
//
ID #T99X119(1c); standard; MUTATION; NTERM
Accession A0815
Systematic name g.12951_12961delinsTCC, c.296_306delinsTCC,
Systematic name r.296_306delinsucc, p.Thr99fsX21
Description A frame shift indel mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 12951
Feature /change: cctttcataa a -> tcc
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 310
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 99..102
Feature /change: TFHK -> IHGGMDDCTS LCDSHHCTSI X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0813
Relative CYBBbase; A0814
//
ID H101R(1); standard; MUTATION; NTERM
Accession A0017
Systematic name g.12957A>G, c.302A>G, r.302a>g, p.His101Arg
Original code J.P. ref [1];VII-09(F) ref [2]
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12957
Feature /change: a -> g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 316
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 101
Feature /change: H -> R
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level Strongly reduced
Heme level Strongly reduced
Oxidase act. Strongly reduced
NBT-slide 4 %
Sex XX
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
//
ID H101R(2); standard; MUTATION; NTERM
Accession A0248
Systematic name g.12957A>G, c.302A>G, r.302a>g, p.His101Arg
Original code VII-10 ref [1]
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12957
Feature /change: a -> g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 316
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 101
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Swedish)
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID H101Y(1); standard; MUTATION; NTERM
Accession A0381
Systematic name g.12956C>T, c.301C>T, r.301c>u, p.His101Tyr
Original code 91-9 ref [2]
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9856476
RefAuthors Tsuda, M., Kaneda, M., Sakiyama, T., Inana, I., Owada, M.,
RefAuthors Kiryu, C., Shiraishi, T., Kakinuma, K.
RefTitle A novel mutation at a probable heme-binding ligand in
RefTitle neutrophil cytochrome b558 in atypical X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet 103:377-381 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12956
Feature /change: c -> t
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 315
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 101
Feature /change: H -> Y
Feature /domain: NTERM
Phenotype X91 -
//
ID W106X(1); standard; MUTATION; NTERM
Accession A0015
Systematic name g.12973G>A, c.318G>A, r.318g>a, p.Trp106X
Original code VIII-10 ref [1]
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12973
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 332
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 106
Feature /change: W -> X
Feature /domain: NTERM
mRNA level Reduced
Phenotype X91 0
Heme level 0
Oxidase act. 0
Sex XY
Family history Inherited, mother carrier
//
ID W106X(2); standard; MUTATION; NTERM
Accession A0479
Systematic name g.12973G>A, c.318G>A, r.318g>a, p.Trp106X
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12973
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 332
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 106
Feature /change: W -> X
Feature /domain: NTERM
Sex XY
//
ID W106X(3); standard; MUTATION; NTERM
Accession A0586
Systematic name g.12973G>A, c.318G>A, r.318g>a, p.Trp106X
Original code 8. D.Z.
Description A point mutation in the exon 4 leading to a premature stop
Description codon in the NTERM domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12973
Feature /change: g -> a
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 332
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 106
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 ?
Diagnosis Classical X-linked CGD
Symptoms Liver abscess (Staphylococcus aureus), perianal abscess,
Symptoms gastroenteritis (salmonella enteritidis), lymphadenitis
Age 4
Family history Inherited
//
ID M107R(1); standard; MUTATION; NTERM
Accession A0410
Systematic name g.12975T>G, c.320T>G, r.320u>g, p.Met107Arg
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12975
Feature /change: t -> g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 334
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 107
Feature /change: M -> R
Feature /domain: NTERM
Phenotype X91 -
//
ID M107R(2); standard; MUTATION; NTERM
Accession A0816
Systematic name g.12975T>G, c.320T>G, r.320u>g, p.Met107Arg
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12975
Feature /change: t -> g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 334
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 107
Feature /change: M -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I108X122(1); standard; MUTATION; NTERM
Accession A0057
Systematic name g.12976dupG, c.321dupG, r.321dupg, p.Ile108fsX15
Original code V-03 ref [1]
Description A frame shift duplication mutation in the exon 4 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 12977
Feature /change: +g
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 336
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 108
Feature /change: I -> DCTSLCDSHH CTSIX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
//
ID #A109X121(1); standard; MUTATION; NTERM
Accession A0210
Systematic name g.12981_12982delCA, c.326_327delCA, r.326_327delca,
Systematic name p.Leu110fsX12
Original code IV-23 ref [1]
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12981..12982
Feature /change: -ca
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 340..341
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 109
Feature /change: A -> ASLCDSHHCT SIX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (German)
//
ID #A109X121(2); standard; MUTATION; NTERM
Accession A0817
Systematic name g.12981_12982delCA, c.326_327delCA, r.326_327delca,
Systematic name p.Leu110fsX12
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12981..12982
Feature /change: -ca
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 340..341
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 109
Feature /change: A -> ASLCDSHHCT SIX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #L110X121(1); standard; MUTATION; NTERM
Accession A0818
Systematic name g.12985_12986delTC, c.330_331delTC, r.330_331deluc,
Systematic name p.His111fsX11
Description A frame shift deletion mutation in the exon 4 leading to a
Description premature stop codon in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 12985..12986
Feature /change: -tc
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 344..345
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 110..111
Feature /change: LH -> LLCDSHHCTS IX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S112P(1); standard; MUTATION; NTERM
Accession A0820
Systematic name g.12989T>C, c.334T>C, r.334u>c, p.Ser112Pro
Description A point mutation in the exon 4 leading to an amino acid
Description change in the NTERM domain
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12989
Feature /change: t -> c
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 348
Feature /codon: tct -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 112
Feature /change: S -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #A113X127(1); standard; MUTATION; NTERM
Accession A0827
Systematic name g.14599delG, c.339delG, r.339delg, p.Ile114fsX14
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14599
Feature /change: -g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 353
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 113
Feature /change: A -> AFTPLHIYLM WNGVX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H115Q(1); standard; MUTATION; NTERM
Accession A0382
Systematic name g.14605C>A, c.345C>A, r.345c>a, p.His115Gln
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14605
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 359
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 115
Feature /change: H -> Q
Feature /domain: NTERM
//
ID H115Y(1); standard; MUTATION; NTERM
Accession A0383
Systematic name g.14603C>T, c.343C>T, r.343c>u, p.His115Tyr
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 26-Jul-2002 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14603
Feature /change: c -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 357
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 115
Feature /change: H -> Y
Feature /domain: NTERM
Sex XY
//
ID #A118X127(1); standard; MUTATION; NTERM
Accession A0103
Systematic name g.14614delA, c.354delA, r.354dela, p.His119fsX9
Original code II-04 ref [1]
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14614
Feature /change: -a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 368
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 118
Feature /change: A -> AIYLMWNGVX
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID H119R(1); standard; MUTATION; NTERM
Accession A0384
Systematic name g.14616A>G, c.356A>G, r.356a>g, p.His119Arg
Original code IV-04 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14616
Feature /change: a -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 370
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 119
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
//
ID H119R(2); standard; MUTATION; NTERM
Accession A0385
Systematic name g.14616A>G, c.356A>G, r.356a>g, p.His119Arg
Original code IV-05 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14616
Feature /change: a -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 370
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 119
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
//
ID @H119X122(1); standard; MUTATION; NTERM
Accession A0007
Systematic name g.14616dupA, c.356dupA, r.356dupa, p.His119fsX4
Original code V-04 ref [1]
Description A frame shift duplication mutation in the exon 5 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 14617
Feature /change: +a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 371
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 119
Feature /change: H -> QSIX
Feature /domain: NTERM
mRNA level 0
Phenotype X91 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Comment Sister normal
//
ID L120P(1); standard; MUTATION; NTERM
Accession A0249
Systematic name g.14619T>C, c.359T>C, r.359u>c, p.Leu120Pro
Original code VII-11 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14619
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 373
Feature /codon: cta -> cca; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 120
Feature /change: L -> P
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID #L120X122(1); standard; MUTATION; NTERM
Accession A0828
Systematic name g.14620_14635delATTTAATGTGGAATGG,
Systematic name c.360_375delATTTAATGTGGAATGG, r.360_375delauuuaauguggaaugg,
Systematic name p.Phe121fsX2
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14620..14635
Feature /change: -atttaatgtg gaatgg
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 374..389
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 120..125
Feature /change: LFNVEW -> LVX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID E124X(1); standard; MUTATION; NTERM
Accession A0829
Systematic name g.14630G>T, c.370G>T, r.370g>u, p.Glu124X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14630
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 384
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 124
Feature /change: E -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W125C(1); standard; MUTATION; NTERM
Accession A0480
Systematic name g.14635G>T, c.375G>T, r.375g>u, p.Trp125Cys
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14635
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 389
Feature /codon: tgg -> tgt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 125
Feature /change: W -> C
Feature /domain: NTERM
//
ID W125X(1); standard; MUTATION; NTERM
Accession A0564
Systematic name g.14635G>A, c.375G>A, r.375g>a, p.Trp125X
Original code P2
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14635
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 389
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 125
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, liver abscess, becegitis,
Symptoms pneumonia, lymphadenitis
Sex XY
//
ID W125X(2); standard; MUTATION; NTERM
Accession A0830
Systematic name g.14634G>A, c.374G>A, r.374g>a, p.Trp125X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14634
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 388
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 125
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @A129X134(1); standard; MUTATION; NTERM
Accession A0831
Systematic name g.14642_14645dup, c.382_385dup, r.382_385dup, p.Ala129fsX6
Description A frame shift duplication mutation in the exon 5 leading to
Description a premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 14646
Feature /change: +aatg
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 400
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 129
Feature /change: A -> ECPSQX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130L(1); standard; MUTATION; NTERM
Accession A0862
Systematic name g.14649G>T, c.389G>T, r.389g>u, p.Arg130Leu
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14649
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 403
Feature /codon: cga -> cta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> L
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130P(1); standard; MUTATION; NTERM
Accession A0861
Systematic name g.14649G>C, c.389G>C, r.389g>c, p.Arg130Pro
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14649
Feature /change: g -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 403
Feature /codon: cga -> cca; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(1); standard; MUTATION; NTERM
Accession A0065
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code J1 ref [?];91-11 ref [2]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID R130X(2); standard; MUTATION; NTERM
Accession A0113
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code III-06 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XX
Comment Carrier
//
ID R130X(3); standard; MUTATION; NTERM
Accession A0267
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code VIII-11 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Hungarian)
//
ID R130X(4a); standard; MUTATION; NTERM
Accession A0268
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code VIII-12 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0269 brother
//
ID R130X(4b); standard; MUTATION; NTERM
Accession A0269
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code VIII-12 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0268 brother
//
ID R130X(5); standard; MUTATION; NTERM
Accession A0270
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code VIII-13 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID R130X(6); standard; MUTATION; NTERM
Accession A0271
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code VIII-14 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID R130X(7); standard; MUTATION; NTERM
Accession A0272
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID R130X(8); standard; MUTATION; NTERM
Accession A0427
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Comment Mother and aunt heterozygous
//
ID R130X(9); standard; MUTATION; NTERM
Accession A0428
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R130X(10); standard; MUTATION; NTERM
Accession A0429
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
//
ID R130X(11); standard; MUTATION; NTERM
Accession A0430
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R130X(12); standard; MUTATION; NTERM
Accession A0431
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R130X(13); standard; MUTATION; NTERM
Accession A0432
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
//
ID R130X(14); standard; MUTATION; NTERM
Accession A0587
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code 9. H.G.
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Brain abscess, liver abscess, spleen abscess, cervical
Symptoms abscess (Staphylococcus aureus), retroperitoneal
Symptoms lymphadenopathy
Age 8 mo
Family history Inherited
//
ID R130X(15); standard; MUTATION; NTERM
Accession A0596
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Original code Patient 1
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 15-Mar-2007 (Rel. 2, Created)
Date 15-Mar-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089090
RefAuthors Chollet-Martin, S., Lopez, A., Gaud, C., Henry, D., Stos,
RefAuthors B., El Benna, J., Chedevile, G., Gendrel, D., Gougerot-
RefAuthors Pocidalo, M. A., Grandchamp, B., Gerard, B.
RefTitle Severe X-linked chronic granulomatous disease in two
RefTitle unrelated females.
RefLoc Eur J Pediatr:153-159 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms skin abscesses, skin ulcers
Age 14
Sex XX
Ethnic origin Caucasoid; Tahiti
Family history De novo
//
ID R130X(16a); standard; MUTATION; NTERM
Accession A0834
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0835
//
ID R130X(16b); standard; MUTATION; NTERM
Accession A0835
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0834
//
ID R130X(17a); standard; MUTATION; NTERM
Accession A0836
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0837
//
ID R130X(17b); standard; MUTATION; NTERM
Accession A0837
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0836
//
ID R130X(18); standard; MUTATION; NTERM
Accession A0838
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(19); standard; MUTATION; NTERM
Accession A0839
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(20); standard; MUTATION; NTERM
Accession A0840
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(21); standard; MUTATION; NTERM
Accession A0841
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(22); standard; MUTATION; NTERM
Accession A0842
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(23); standard; MUTATION; NTERM
Accession A0843
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(24); standard; MUTATION; NTERM
Accession A0844
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(25); standard; MUTATION; NTERM
Accession A0845
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(26); standard; MUTATION; NTERM
Accession A0846
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(27); standard; MUTATION; NTERM
Accession A0847
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(28); standard; MUTATION; NTERM
Accession A0848
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(29); standard; MUTATION; NTERM
Accession A0849
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(30); standard; MUTATION; NTERM
Accession A0850
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(31); standard; MUTATION; NTERM
Accession A0851
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(32); standard; MUTATION; NTERM
Accession A0852
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(33); standard; MUTATION; NTERM
Accession A0853
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(34); standard; MUTATION; NTERM
Accession A0854
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(35); standard; MUTATION; NTERM
Accession A0855
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(36); standard; MUTATION; NTERM
Accession A0856
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(37); standard; MUTATION; NTERM
Accession A0857
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(38); standard; MUTATION; NTERM
Accession A0858
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(39); standard; MUTATION; NTERM
Accession A0859
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R130X(40); standard; MUTATION; NTERM
Accession A0860
Systematic name g.14648C>T, c.388C>T, r.388c>u, p.Arg130X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #R130X139(1); standard; MUTATION; NTERM
Accession A0832
Systematic name g.14648delC, c.388delC, r.388delc, p.Arg130fsX10
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: -c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> ESIILILIQX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #R130X139(2); standard; MUTATION; NTERM
Accession A0833
Systematic name g.14648delC, c.388delC, r.388delc, p.Arg130fsX10
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14648
Feature /change: -c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 402
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> ESIILILIQX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @R130X133(1); standard; MUTATION; NTERM
Accession A0080
Systematic name g.14648_14649insT, c.388_389insT, r.388_389insu,
Systematic name p.Arg130fsX4
Original code patient 2 ref []
Description A frame shift insertion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 14649
Feature /change: +t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 403
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 130
Feature /change: R -> LSQX
Feature /domain: NTERM
mRNA level Present
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
Comment Brother affected (died)
//
ID #N132X135(1); standard; MUTATION; NTERM
Accession A0863
Systematic name g.14654_14666delAATAATTCTGATC, c.394_406delAATAATTCTGATC,
Systematic name r.394_406delaauaauucugauc, p.Asn132fsX4
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14654..14666
Feature /change: -aataattctg atc
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 408..420
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 132..136
Feature /change: NNSDP -> LIQX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #N133X139(1); standard; MUTATION; NTERM
Accession A0543
Systematic name g.14658delA, c.398delA, r.398dela, p.Asn133fsX7
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 19-Oct-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 11978610
RefAuthors Lun, A., Roesler, J., Renz, H.
RefTitle Unusual late onset of X-linked chronic granulomatous
RefTitle disease in an adult woman after unsuspicious childhood.
RefLoc Clin Chem:780-781 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14658
Feature /change: -a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 412
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 133
Feature /change: N -> ILILIQX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Since the age of 18 years; recurrent serious conditions
Symptoms typical of CGD, including Arpergillus fumigatus infection
Symptoms and formation of intestinal granulomas, cutaneous abscesses
Symptoms in the anogenital and back region, recurrent bacterial
Symptoms pneumonia
Age 43
Sex XX
Comment For the first 17 years of her life, no typical CGD
Comment infections and no typical CGD symptoms occurred
//
ID Y137X(1); standard; MUTATION; NTERM
Accession A0864
Systematic name g.14671T>A, c.411T>A, r.411u>a, p.Tyr137X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14671
Feature /change: t -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 425
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 137
Feature /change: Y -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S138X(1); standard; MUTATION; NTERM
Accession A0866
Systematic name g.14673C>A, c.413C>A, r.413c>a, p.Ser138X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14673
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 427
Feature /codon: tca -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 138
Feature /change: S -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S138X(2); standard; MUTATION; NTERM
Accession A0867
Systematic name g.14673C>A, c.413C>A, r.413c>a, p.Ser138X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14673
Feature /change: c -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 427
Feature /codon: tca -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 138
Feature /change: S -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #S138X158(1); standard; MUTATION; NTERM
Accession A0865
Systematic name g.14672_14678delTCAGTAG, c.412_418delTCAGTAG,
Systematic name r.412_418delucaguag, p.Ser138fsX21
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14672..14678
Feature /change: -tcagtag
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 426..432
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 138..140
Feature /change: SVA -> HSLNLETGKM KVISILLERE X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID L141P(1); standard; MUTATION; NTERM
Accession A0559
Systematic name g.14682T>C, c.422T>C, r.422u>c, p.Leu141Pro
Original code Patient 5
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15082894
RefAuthors Oh, H. B., Park, J. S., Lee, W., Yoo, S. J., Yang, J. H.,
RefAuthors Oh, S. Y.
RefTitle Molecular analysis of X-linked chronic granulomatous
RefTitle disease in five unrelated korean patients.
RefLoc J Korean Med Sci:218-222 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14682
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 436
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 141
Feature /change: L -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Upper respiratory infection, lymphadenitis and liver
Symptoms abscesses
Sex XY
Ethnic origin Mongoloid; Korea
//
ID L141P(2); standard; MUTATION; NTERM
Accession A0868
Systematic name g.14682T>C, c.422T>C, r.422u>c, p.Leu141Pro
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14682
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 436
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 141
Feature /change: L -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S142P(1); standard; MUTATION; NTERM
Accession A0465
Systematic name g.14684T>C, c.424T>C, r.424u>c, p.Ser142Pro
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14684
Feature /change: t -> c
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 438
Feature /codon: tct -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 142
Feature /change: S -> P
Feature /domain: NTERM
Family history Inherited, mother carrier
//
ID Q148X(1); standard; MUTATION; NTERM
Accession A0111
Systematic name g.14702_14703delinsT, c.442_443delinsT, r.442_443delinsu,
Systematic name p.Gln148X
Description An indel mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Curnutte '95
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 14702..14703
Feature /change: ca -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 456..457
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 148
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
//
ID Q148X(2); standard; MUTATION; NTERM
Accession A0273
Systematic name g.14702C>T, c.442C>T, r.442c>u, p.Gln148X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14702
Feature /change: c -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 456
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 148
Feature /change: Q -> X
Feature /domain: NTERM
//
ID Q148X(3); standard; MUTATION; NTERM
Accession A0420
Systematic name g.14702C>T, c.442C>T, r.442c>u, p.Gln148X
Original code 91-12 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14702
Feature /change: c -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 456
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 148
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID @N149X150(1); standard; MUTATION; NTERM
Accession A0139
Systematic name g.14706dupA, c.446dupA, r.446dupa, p.Asn149fsX2
Original code II-06 ref [2]
Description A frame shift duplication mutation in the exon 5 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8500277
RefAuthors Curnutte, J. T.
RefTitle Chronic granulomatous disease: the solving of a clinical
RefTitle riddle at the molecular level.
RefLoc Clin Immunol Immunopathol 67:S2-15 (1993)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 14707
Feature /change: +a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 461
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 149
Feature /change: N -> KX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID E150X(1); standard; MUTATION; NTERM
Accession A0869
Systematic name g.14708G>T, c.448G>T, r.448g>u, p.Glu150X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14708
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 462
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 150
Feature /change: E -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #E150X163(1); standard; MUTATION; NTERM
Accession A0870
Systematic name g.14710_14711delAA, c.450_451delAA, r.450_451delaa,
Systematic name p.Ser151fsX13
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14710..14711
Feature /change: -aa
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 464..465
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 150..151
Feature /change: ES -> ELSQFCSKEN KEPX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y152X(1); standard; MUTATION; NTERM
Accession A0124
Systematic name g.14716T>A, c.456T>A, r.456u>a, p.Tyr152X
Original code III-07 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14716
Feature /change: t -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 470
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 152
Feature /change: Y -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Y152X(2); standard; MUTATION; NTERM
Accession A0644
Systematic name g.14716T>A, c.456T>A, r.456u>a, p.Tyr152X
Original code proband 2
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 04-Jun-2008 (Rel. 2, Created)
Date 04-Jun-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18402298
RefAuthors Vilaiphan, P., Chatchatee, P., Ngamphaiboon, J.,
RefAuthors Tongkobpetch, S., Suphapeetiporn, K., Shotelersuk, V.
RefTitle Nonsense mutations of the CYBB gene in two thai families
RefTitle with X-linked chronic granulomatous disease.
RefLoc Asian Pac J Allergy Immunol:243-247 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14716
Feature /change: t -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 470
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 152
Feature /change: Y -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Severe persistent pulmonary infections
Sex XY
Ethnic origin Mongoloid; Thailand
Family history Inherited
//
ID #Y152X163(1); standard; MUTATION; NTERM
Accession A0332
Systematic name g.14715_14716delAT, c.455_456delAT, r.455_456delau,
Systematic name p.Tyr152fsX12
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14715..14716
Feature /change: -at
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 469..470
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 152
Feature /change: Y -> SQFCSKENKE PX
Feature /domain: NTERM
Phenotype X91 0
//
ID L153R(1a); standard; MUTATION; NTERM
Accession A0871
Systematic name g.14718T>G, c.458T>G, r.458u>g, p.Leu153Arg
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14718
Feature /change: t -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 472
Feature /codon: ctc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 153
Feature /change: L -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0872
//
ID L153R(1b); standard; MUTATION; NTERM
Accession A0872
Systematic name g.14718T>G, c.458T>G, r.458u>g, p.Leu153Arg
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14718
Feature /change: t -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 472
Feature /codon: ctc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 153
Feature /change: L -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0871
//
ID #N154X160(1); standard; MUTATION; NTERM
Accession A0873
Systematic name g.14721delA, c.461delA, r.461dela, p.Asn154fsX7
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14721
Feature /change: -a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 475
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 154
Feature /change: N -> ILLEREX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A156T(1); standard; MUTATION; NTERM
Accession A0055
Systematic name g.14726G>A, c.466G>A, r.466g>a, p.Ala156Thr
Original code VII-12 ref [2]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14726
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 480
Feature /codon: gct -> act; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 156
Feature /change: A -> T
Feature /domain: NTERM
Phenotype X91 -
Protein level Weak, Mr increased
Heme level Strongly decreased (8%)
Oxidase act. Decreased (15%)
NBT-slide 97% weakly positive
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
//
ID A156T(2); standard; MUTATION; NTERM
Accession A0137
Systematic name g.14726G>A, c.466G>A, r.466g>a, p.Ala156Thr
Original code IV-06 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14726
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 480
Feature /codon: gct -> act; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 156
Feature /change: A -> T
Feature /domain: NTERM
mRNA level 0
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased (3)
Symptoms Mild CGD
Sex XY
//
ID A156T(3); standard; MUTATION; NTERM
Accession A0187
Systematic name g.14726G>A, c.466G>A, r.466g>a, p.Ala156Thr
Original code IV-07 ref [1]
Description Point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14726
Feature /change: g -> a
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 480
Feature /codon: gct -> act; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 156
Feature /change: A -> T
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased (3)
Oxidase act. Decreased (2)
Symptoms Mild CGD
Sex XY
//
ID R157X(1a); standard; MUTATION; NTERM
Accession A0074
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-16 ref [2];91-13 ref [4]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7907031
RefAuthors Ariga, T., Sakiyama, Y., Furuta, H., Matsumoto, S.
RefTitle Molecular genetic studies of two families with X-linked
RefTitle chronic granulomatous disease: mutation analysis and
RefTitle definitive determination of carrier status in patients\RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1994)
RefNumber [3]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [4]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
Family history Inherited, mother is carrier
Relative CYBBbase; A0075 nephew
//
ID R157X(1b); standard; MUTATION; NTERM
Accession A0075
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-16(4)91-13 ref [2]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7907031
RefAuthors Ariga, T., Sakiyama, Y., Furuta, H., Matsumoto, S.
RefTitle Molecular genetic studies of two families with X-linked
RefTitle chronic granulomatous disease: mutation analysis and
RefTitle definitive determination of carrier status in patients\RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1994)
RefNumber [3]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [4]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
Family history Inherited, mother is carrier
Relative CYBBbase; A0074 uncle
//
ID R157X(2); standard; MUTATION; NTERM
Accession A0095
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code III-08 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID R157X(3); standard; MUTATION; NTERM
Accession A0098
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code III-09 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R157X(4); standard; MUTATION; NTERM
Accession A0152
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code III-10 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID R157X(5); standard; MUTATION; NTERM
Accession A0177
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code III-11 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
//
ID R157X(6); standard; MUTATION; NTERM
Accession A0274
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-17 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
//
ID R157X(7); standard; MUTATION; NTERM
Accession A0275
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-18 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Swedish)
Family history Inherited, mother is carrier
Comment Father and brother normal
//
ID R157X(8a); standard; MUTATION; NTERM
Accession A0276
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-19 ref [1]
Description Point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0277 cousin
Comment Sister carrier
//
ID R157X(8b); standard; MUTATION; NTERM
Accession A0277
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code VIII-19 ref [1]
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0276 cousin
//
ID R157X(9); standard; MUTATION; NTERM
Accession A0433
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
Family history Inherited, mother is carrier
Comment Brother (functionally) normal
//
ID R157X(10); standard; MUTATION; NTERM
Accession A0434
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R157X(11); standard; MUTATION; NTERM
Accession A0565
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code P3
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, cerebral aspergillosis,
Symptoms retro-pharyngeal abscess, bacterial mastoiditis
Sex XY
//
ID R157X(12a); standard; MUTATION; NTERM
Accession A0566
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code P4a
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Liver abscess, severe sepsis to Salmonella, purulent
Symptoms rhinitis, pyodermitis buccal aphthosis, pneumonia, osteitis
Sex XY
Family history Inherited
Relative CYBBbase; A0567 brother
//
ID R157X(12b); standard; MUTATION; NTERM
Accession A0567
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code P4b
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, severe sepsis to Salmonella,
Symptoms purulent rhinitis, pneumonia, gastric granuloma
Sex XY
Family history Inherited
Relative CYBBbase; A0566 brother
//
ID R157X(13); standard; MUTATION; NTERM
Accession A0568
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code P5
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Lobar pneumonia, salmonellosis, anal fissures, cervical
Symptoms adenopathies, recurrent impetigo
Sex XY
Family history Inherited
//
ID R157X(14a); standard; MUTATION; NTERM
Accession A0874
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0875
//
ID R157X(14b); standard; MUTATION; NTERM
Accession A0875
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0874
//
ID R157X(15); standard; MUTATION; NTERM
Accession A0876
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(16); standard; MUTATION; NTERM
Accession A0877
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(17); standard; MUTATION; NTERM
Accession A0878
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(18); standard; MUTATION; NTERM
Accession A0879
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(19); standard; MUTATION; NTERM
Accession A0880
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(20); standard; MUTATION; NTERM
Accession A0881
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(21); standard; MUTATION; NTERM
Accession A0882
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(22); standard; MUTATION; NTERM
Accession A0883
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(23); standard; MUTATION; NTERM
Accession A0884
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(24); standard; MUTATION; NTERM
Accession A0885
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(25); standard; MUTATION; NTERM
Accession A0886
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(26); standard; MUTATION; NTERM
Accession A0887
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R157X(27); standard; MUTATION; NTERM
Accession A1424
Systematic name g.14729C>T, c.469C>T, r.469c>u, p.Arg157X
Original code ACS
Description A point mutation in the exon 5 leading to a premature stop
Description codon in the NTERM domain
Date 03-Oct-2013 (Rel. 2, Created)
Date 03-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (03-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; PLanta Sotano Hospital Infantil-Hospital
RefLoc La Paz-Castellana261-28046 Madrid-Spain; Tel 34 917277238;
RefLoc Fax 34 917277095; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14729
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 483
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 157
Feature /change: R -> X
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Leishmania and hemophagocytic syndrome
Age 5
Ethnic origin Caucasoid; Spain
Family history Not known
Relative Description of pedigree:Mother and sister carriers
//
ID #K158X159(1); standard; MUTATION; NTERM
Accession A0311
Systematic name g.14732_14735delAAGA, c.472_475delAAGA, r.472_475delaaga,
Systematic name p.Lys158fsX2
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14732..14735
Feature /change: -aaga
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 486..489
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 158..159
Feature /change: KR -> EX
Feature /domain: NTERM
Phenotype X91 0
//
ID #R159X169(1); standard; MUTATION; NTERM
Accession A0888
Systematic name g.14735_14741delAGAATAA, c.475_481delAGAATAA,
Systematic name r.475_481delagaauaa, p.Ile160fsX10
Description A frame shift deletion mutation in the exon 5 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 14735..14741
Feature /change: -agaataa
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 489..495
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 159..161
Feature /change: RIK -> RTLKEACTWL X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I160X164(1); standard; MUTATION; NTERM
Accession A0335
Systematic name g.14739dupT, c.479dupT, r.479dupu, p.Asn162fsX3
Description A frame shift duplication mutation in the exon 5 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 14740
Feature /change: +t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 494
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 160
Feature /change: I -> IKEPX
Feature /domain: NTERM
Comment both parents normal
//
ID K161N(1); standard; MUTATION; NTERM
Accession A0233
Systematic name g.14743G>T, c.483G>T, r.483g>u, p.Lys161Asn
Original code "VI-10; VII-13" ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14743
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 497
Feature /codon: aag -> aat; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 161
Feature /change: K -> N
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID K161R(1a); standard; MUTATION; NTERM
Accession A0179
Systematic name g.14742A>G, c.482A>G, r.482a>g, p.Lys161Arg
Original code V-14 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14742
Feature /change: a -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 496
Feature /codon: aag -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 161
Feature /change: K -> R
Feature /domain: NTERM
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0180 brother
//
ID K161R(1b); standard; MUTATION; NTERM
Accession A0180
Systematic name g.14742A>G, c.482A>G, r.482a>g, p.Lys161Arg
Original code V-14 ref [1]
Description A point mutation in the exon 5 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14742
Feature /change: a -> g
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 496
Feature /codon: aag -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 161
Feature /change: K -> R
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0179 brother
//
ID #L173X188(1); standard; MUTATION; NTERM
Accession A0217
Systematic name g.16917delC, c.517delC, r.517delc, p.Leu173fsX16
Original code IV-33 ref [1]
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16917
Feature /change: -c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 531
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 173
Feature /change: L -> CWQASLELSS RCASYX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID G179E(1); standard; MUTATION; NTERM
Accession A0903
Systematic name g.16936G>A, c.536G>A, r.536g>a, p.Gly179Glu
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16936
Feature /change: g -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 550
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 179
Feature /change: G -> E
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID G179R(1); standard; MUTATION; NTERM
Accession A0375
Systematic name g.16935G>A, c.535G>A, r.535g>a, p.Gly179Arg
Original code N.V. ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9794433
RefAuthors Dusi, S., Nadalini, K. A., Donini, M., Zentilin, L.,
RefAuthors Wientjes, F. B., Roos, D., Giacca, M., Rossi, F.
RefTitle Nicotinamide-adenine dinucleotide phosphate oxidase
RefTitle assembly and activation in EBV-transformed B
RefTitle lymphoblastoid cell lines of normal and chronic
RefTitle granulomatous disease patients.
RefLoc J Immunol 161:4968-4974 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16935
Feature /change: g -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 549
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 179
Feature /change: G -> R
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. 0
//
ID G179X(1); standard; MUTATION; NTERM
Accession A0901
Systematic name g.16935G>T, c.535G>T, r.535g>u, p.Gly179X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16935
Feature /change: g -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 549
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 179
Feature /change: G -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID G179X(2); standard; MUTATION; NTERM
Accession A0902
Systematic name g.16935G>T, c.535G>T, r.535g>u, p.Gly179X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16935
Feature /change: g -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 549
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 179
Feature /change: G -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #T183-4(1); standard; MUTATION; NTERM
Accession A0904
Systematic name g.16948_16959delCGCTGTGCCTCA, c.548_559delCGCTGTGCCTCA,
Systematic name r.548_559delcgcugugccuca, p.Thr183del
Description An inframe deletion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16948..16959
Feature /change: -cgctgtgcct ca
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 562..573
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 183..187
Feature /change: TLCLI -> I
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C185R(1); standard; MUTATION; NTERM
Accession A0905
Systematic name g.16953T>C, c.553T>C, r.553u>c, p.Cys185Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16953
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 567
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 185
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C185X(1); standard; MUTATION; NTERM
Accession A0182
Systematic name g.16955C>A, c.555C>A, r.555c>a, p.Cys185X
Original code III-12 ref [1]
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16955
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 569
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 185
Feature /change: C -> X
Feature /domain: NTERM
Sex XY
//
ID C185X(2); standard; MUTATION; NTERM
Accession A0358
Systematic name g.16955C>A, c.555C>A, r.555c>a, p.Cys185X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16955
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 569
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 185
Feature /change: C -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID C185X(3); standard; MUTATION; NTERM
Accession A0906
Systematic name g.16955C>A, c.555C>A, r.555c>a, p.Cys185X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16955
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 569
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 185
Feature /change: C -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #C185X188(1); standard; MUTATION; NTERM
Accession A0218
Systematic name g.16954delG, c.554delG, r.554delg, p.Cys185fsX4
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16954
Feature /change: -g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 568
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 185
Feature /change: C -> SSYX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Sex XY
Family history De novo mutation, mother not carrier
Comment Father, mother and sister normal
//
ID #I187-3(1); standard; MUTATION; NTERM
Accession A0907
Systematic name g.16959_16967delATATTAATT, c.559_567delATATTAATT,
Systematic name r.559_567delauauuaauu, p.Ile187_Ile190del
Description An inframe deletion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16959..16967
Feature /change: -atattaatt
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 573..581
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 187..189
Feature /change: -ILI
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I187+2(2); standard; MUTATION; NTERM
Accession A0585
Systematic name g.16955_16960dup, c.555_560dup, r.555_560dup,
Systematic name p.Leu186_Ile187insIleLeuIle
Original code 6. D.S.
Description A duplication mutation in the exon 6 leading to an amino
Description acid change in the NTERM domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 16961
Feature /change: +cctcat
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe duplication
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 575
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 187
Feature /change: I -> ILI
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Liver abscess (Enterobacter aerogenes), lymphadenitis,
Symptoms cervical abscesses, gastroenteritis, pneumonia
Age 2
Family history Inherited
//
ID #I189X212(1); standard; MUTATION; NTERM
Accession A0309
Systematic name g.16965_16968delATTA, c.565_568delATTA, r.565_568delauua,
Systematic name p.Ile189fsX24
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
efNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16965..16968
Feature /change: -atta
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 579..582
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 189..190
Feature /change: II -> SLPPPKPSGG LTLKSFGTHI ISLX
Feature /domain: NTERM
Phenotype X91 0
//
ID #I189X212(2); standard; MUTATION; NTERM
Accession A0908
Systematic name g.16965_16968delATTA, c.565_568delATTA, r.565_568delauua,
Systematic name p.Ile189fsX24
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16965..16968
Feature /change: -atta
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 579..582
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 189..190
Feature /change: II -> SLPPPKPSGG LTLKSFGTHI ISLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #I189X212(3); standard; MUTATION; NTERM
Accession A0909
Systematic name g.16965_16968delATTA, c.565_568delATTA, r.565_568delauua,
Systematic name p.Ile189fsX24
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16965..16968
Feature /change: -atta
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 579..582
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 189..190
Feature /change: II -> SLPPPKPSGG LTLKSFGTHI ISLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S193F(1); standard; MUTATION; NTERM
Accession A0466
Systematic name g.16978C>T, c.578C>T, r.578c>u, p.Ser193Phe
Original code VP2 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16978
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 592
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 193
Feature /change: S -> F
Feature /domain: NTERM
Phenotype X91 -
Protein level 0,1-4,7% (7D5)
Oxidase act. 0,53-1,8% (H2O2-prod.)
Family history Inherited, mother carrier
//
ID S193F(2); standard; MUTATION; NTERM
Accession A0913
Systematic name g.16978C>T, c.578C>T, r.578c>u, p.Ser193Phe
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16978
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 592
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 193
Feature /change: S -> F
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S193P(1); standard; MUTATION; NTERM
Accession A0627
Systematic name g.16977T>C, c.577T>C, r.577u>c, p.Ser193Pro
Original code P3
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16977
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 591
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 193
Feature /change: S -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Salmonella soft tissue abscess, lymphadenitis.
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID S193P(2); standard; MUTATION; NTERM
Accession A0911
Systematic name g.16977T>C, c.577T>C, r.577u>c, p.Ser193Pro
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16977
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 591
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 193
Feature /change: S -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID S193P(3); standard; MUTATION; NTERM
Accession A0912
Systematic name g.16977T>C, c.577T>C, r.577u>c, p.Ser193Pro
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16977
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 591
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 193
Feature /change: S -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @T194+3(1); standard; MUTATION; NTERM
Accession A0910
Systematic name g.16973_16981dup, c.573_581dup, r.573_581dup,
Systematic name p.Ser193_Thr194insThrSerSerThr
Description A duplication mutation in the exon 6 leading to an amino
Description acid change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 16982
Feature /change: +ttcctccac
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe duplication
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 596
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 194
Feature /change: T -> TSST
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @K195+2(1); standard; MUTATION; NTERM
Accession A0914
Systematic name g.16982_16983insAAAACA, c.582_583insAAAACA,
Systematic name r.582_583insaaaaca, p.Thr194_Lys195insLysThr
Description An inframe insertion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 16983
Feature /change: +aaaaca
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 597
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 195
Feature /change: +KT
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #R198X213(1); standard; MUTATION; NTERM
Accession A0915
Systematic name g.16992delC, c.592delC, r.592delc, p.Arg198fsX16
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16992
Feature /change: -c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 606
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 198
Feature /change: R -> GGLTLKSFGT HIISLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #R199X213(1); standard; MUTATION; NTERM
Accession A0320
Systematic name g.16995delA, c.595delA, r.595dela, p.Arg199fsX15
Original code II-07 ref [1]
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 16995
Feature /change: -a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 609
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 199
Feature /change: R -> GLTLKSFGTH IISLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
//
ID @R199X216(1); standard; MUTATION; NTERM
Accession A0916
Systematic name g.16996_16997insGTCTTACT, c.596_597insGTCTTACT,
Systematic name r.596_597insgucuuacu, p.Phe202fsX15
Description A frame shift insertion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 16997
Feature /change: +gtcttact
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 611
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 199
Feature /change: R -> RSYCLTLKSF GTHIISLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y201X(1); standard; MUTATION; NTERM
Accession A0917
Systematic name g.17003C>G, c.603C>G, r.603c>g, p.Tyr201X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17003
Feature /change: c -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 617
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 201
Feature /change: Y -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #Y201X213(1); standard; MUTATION; NTERM
Accession A0333
Systematic name g.17003delC, c.603delC, r.603delc, p.Phe202fsX12
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17003
Feature /change: -c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 617
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 201
Feature /change: Y -> YLKSFGTHII SLX
Feature /domain: NTERM
Phenotype X91 0
//
ID #F202X213(1); standard; MUTATION; NTERM
Accession A0918
Systematic name g.17006_17008delinsGG, c.606_608delinsGG,
Systematic name r.606_608delinsgg, p.Phe202fsX12
Description A frame shift indel mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 17006..17008
Feature /change: tga -> gg
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 620..622
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 202..203
Feature /change: FE -> LESFGTHIIS LX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID E203X(1); standard; MUTATION; NTERM
Accession A0278
Systematic name g.17007G>T, c.607G>T, r.607g>u, p.Glu203X
Original code VIII-20 ref [1]
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
efNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17007
Feature /change: g -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 621
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 203
Feature /change: E -> X
Feature /domain: NTERM
Phenotype X91 -
Heme level Normal
Sex XY
Ethnic origin Caucasian (Hungarian)
//
ID E203X(2); standard; MUTATION; NTERM
Accession A0919
Systematic name g.17007G>T, c.607G>T, r.607g>u, p.Glu203X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17007
Feature /change: g -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 621
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 203
Feature /change: E -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID F205I(1); standard; MUTATION; NTERM
Accession A0060
Systematic name g.17013T>A, c.613T>A, r.613u>a, p.Phe205Ile
Original code pat. 3 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17013
Feature /change: t -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 627
Feature /codon: ttt -> att; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 205
Feature /change: F -> I
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
//
ID #F205X207(1); standard; MUTATION; NTERM
Accession A0920
Systematic name g.17014_17032delTTTGGTACACACATCATCT,
Systematic name c.614_632delTTTGGTACACACATCATCT,
Systematic name r.614_632deluuugguacacacaucaucu, p.Phe205fsX3
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17014..17032
Feature /change: -tttggtacac acatcatct
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 628..646
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 205..211
Feature /change: FWYTHHL -> SLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W206X(1); standard; MUTATION; NTERM
Accession A0921
Systematic name g.17018G>A, c.618G>A, r.618g>a, p.Trp206X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17018
Feature /change: g -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 632
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 206
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y207X(1); standard; MUTATION; NTERM
Accession A0012
Systematic name g.17021C>A, c.621C>A, r.621c>a, p.Tyr207X
Original code R.H. ref [1];VI-14 ref [2]
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1520880
RefAuthors de Boer, M., Bolscher, B. G., Dinauer, M. C., Orkin, S.
RefAuthors H., Smith, C. I., Ahlin, A., Weening, R. S., Roos, D.
RefTitle Splice site mutations are a common cause of X-linked
RefTitle chronic granulomatous disease.
RefLoc Blood 80:1553-1558 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17021
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 635
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 207
Feature /change: Y -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level Strongly reduced
Oxidase act. Strongly reduced
NBT-slide 5 %
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
Comment "Mother and sister carriers; mat. grandmother is not."
//
ID H209Q(1); standard; MUTATION; NTERM
Accession A0125
Systematic name g.17027T>A, c.627T>A, r.627u>a, p.His209Gln
Original code IV-08 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17027
Feature /change: t -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 641
Feature /codon: cat -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Q
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID H209Q(2); standard; MUTATION; NTERM
Accession A0924
Systematic name g.17027T>A, c.627T>A, r.627u>a, p.His209Gln
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17027
Feature /change: t -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 641
Feature /codon: cat -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Q
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H209R(1); standard; MUTATION; NTERM
Accession A0386
Systematic name g.17026A>G, c.626A>G, r.626a>g, p.His209Arg
Original code 91-15 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17026
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 640
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
//
ID H209R(2); standard; MUTATION; NTERM
Accession A0923
Systematic name g.17026A>G, c.626A>G, r.626a>g, p.His209Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17026
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 640
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H209Y(1); standard; MUTATION; NTERM
Accession A0006
Systematic name g.17025C>T, c.625C>T, r.625c>u, p.His209Tyr
Original code PB ref [1];VII-14 ref [2]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17025
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Y
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level Reduced, low Mr
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
Comment Aunt normal
//
ID H209Y(2); standard; MUTATION; NTERM
Accession A0387
Systematic name g.17025C>T, c.625C>T, r.625c>u, p.His209Tyr
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17025
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Y
Feature /domain: NTERM
//
ID H209Y(3); standard; MUTATION; NTERM
Accession A0388
Systematic name g.17025C>T, c.625C>T, r.625c>u, p.His209Tyr
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17025
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Y
Feature /domain: NTERM
//
ID H209Y(4); standard; MUTATION; NTERM
Accession A0389
Systematic name g.17025C>T, c.625C>T, r.625c>u, p.His209Tyr
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17025
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Y
Feature /domain: NTERM
Phenotype X91 -
//
ID H209Y(5); standard; MUTATION; NTERM
Accession A0922
Systematic name g.17025C>T, c.625C>T, r.625c>u, p.His209Tyr
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17025
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> Y
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #H209X224(1); standard; MUTATION; NTERM
Accession A0211
Systematic name g.17025_17026delCA, c.625_626delCA, r.625_626delca,
Systematic name p.His209fsX16
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9454688
RefAuthors Heyworth, P. G., Curnutte, J. T., Noack, D., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease--an update.
RefLoc Blood Cells Mol Dis 23:443-450 (1997)
RefNumber [2]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17025..17026
Feature /change: -ca
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 639..640
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 209
Feature /change: H -> SSLCDLLHWP CHPWSX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Italian)
//
ID L211P(1); standard; MUTATION; NTERM
Accession A0925
Systematic name g.17032T>C, c.632T>C, r.632u>c, p.Leu211Pro
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17032
Feature /change: t -> c
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 646
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 211
Feature /change: L -> P
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID L211R(1); standard; MUTATION; NTERM
Accession A0926
Systematic name g.17032T>G, c.632T>G, r.632u>g, p.Leu211Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17032
Feature /change: t -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 646
Feature /codon: ctc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 211
Feature /change: L -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @L211X226(1); standard; MUTATION; NTERM
Accession A0597
Systematic name g.17028_17031dup, c.628_631dup, r.628_631dup, p.Leu211fsX16
Original code Patient 2
Description A frame shift duplication mutation in the exon 6 leading to
Description a premature stop codon in the NTERM domain
Date 15-Mar-2007 (Rel. 2, Created)
Date 15-Mar-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17089090
RefAuthors Chollet-Martin, S., Lopez, A., Gaud, C., Henry, D., Stos,
RefAuthors B., El Benna, J., Chedevile, G., Gendrel, D., Gougerot-
RefAuthors Pocidalo, M. A., Grandchamp, B., Gerard, B.
RefTitle Severe X-linked chronic granulomatous disease in two
RefTitle unrelated females.
RefLoc Eur J Pediatr:153-159 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 17032
Feature /change: +catc
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 646
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 211
Feature /change: L -> PSLCDLLHWP CHPWSX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms folliculitis, BGC vaccination caused inflammation lasting
Symptoms for 1 year, two large liver abscesses, large skin abscesses
Age 9
Sex XX
Ethnic origin Caucasoid; Island of Reunion
Family history De novo
//
ID #F212X213(1); standard; MUTATION; NTERM
Accession A0927
Systematic name g.17036delT, c.636delT, r.636delu, p.Phe212fsX2
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17036
Feature /change: -t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 650
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 212
Feature /change: F -> LX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #F212X213(2); standard; MUTATION; NTERM
Accession A0928
Systematic name g.17036delT, c.636delT, r.636delu, p.Phe212fsX2
Description A frame shift deletion mutation in the exon 6 leading to a
Description premature stop codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17036
Feature /change: -t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 650
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 212
Feature /change: F -> LX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #F216-1(1); standard; MUTATION; NTERM
Accession A0010
Systematic name g.17046_17048delTTC, c.646_648delTTC, r.646_648deluuc,
Systematic name p.Phe216del
Original code CG ref [1];IV-19 ref [2]
Description An inframe deletion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8070813
RefAuthors Roos, D.
RefTitle The genetic basis of chronic granulomatous disease.
RefLoc Immunol Rev 138:121-157 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17046..17048
Feature /change: -ttc
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 660..662
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 216
Feature /change: -F
Feature /domain: NTERM
Phenotype X91 -
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited
Comment Twin sister is carrier
//
ID #F216-1(2); standard; MUTATION; NTERM
Accession A0058
Systematic name g.17046_17048delTTC, c.646_648delTTC, r.646_648deluuc,
Systematic name p.Phe216del
Original code pat. 2 ref [1]
Description An inframe deletion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17046..17048
Feature /change: -ttc
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 660..662
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 216
Feature /change: -F
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
Family history Inherited, mother is carrier
//
ID #F216-1(3); standard; MUTATION; NTERM
Accession A0085
Systematic name g.17046_17048delTTC, c.646_648delTTC, r.646_648deluuc,
Systematic name p.Phe216del
Original code "IV-20" ref [1]
Description An inframe deletion in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9111587
RefAuthors Jendrossek, V., Ritzel, A., Neubauer, B., Heyden, S.,
RefAuthors Gahr, M.
RefTitle An in-frame triplet deletion within the gp91-phox gene in
RefTitle an adult X-linked chronic granulomatous disease patient
RefTitle with residual NADPH-oxidase activity.
RefLoc Eur J Haematol 58:78-85 (1997)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17046..17048
Feature /change: -ttc
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 660..662
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 216
Feature /change: -F
Feature /domain: NTERM
Phenotype X91 -
Oxidase act. 5 %
NBT-slide 80% weakly positive
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (German)
Family history Inherited, mother is carrier
//
ID H222L(1); standard; MUTATION; NTERM
Accession A0931
Systematic name g.17065A>T, c.665A>T, r.665a>u, p.His222Leu
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> L
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H222N(1); standard; MUTATION; NTERM
Accession A0390
Systematic name g.17064C>A, c.664C>A, r.664c>a, p.His222Asn
Original code IV-09 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17064
Feature /change: c -> a
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 678
Feature /codon: cat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> N
Feature /domain: NTERM
//
ID H222R(1); standard; MUTATION; NTERM
Accession A0250
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Original code VII-15 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID H222R(2); standard; MUTATION; NTERM
Accession A0391
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Original code IV-11 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
//
ID H222R(3); standard; MUTATION; NTERM
Accession A0392
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Original code CP1 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
Phenotype X91 0
Protein level 0% (7D5)
Oxidase act. 0% (H2O2-prod.)
Family history Inherited, mother is carrier
//
ID H222R(4); standard; MUTATION; NTERM
Accession A0393
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 18546332
RefAuthors Kannengiesser, C., Gerard, B., El Benna, J., Henri, D.,
RefAuthors Kroviarski, Y., Chollet-Martin, S., Gougerot-Pocidalo, M.
RefAuthors A., Elbim, C., Grandchamp, B.
RefTitle Molecular epidemiology of chronic granulomatous disease in
RefTitle a series of 80 kindreds: identification of 31 novel
RefTitle mutations.
RefLoc Hum Mutat:E132-149 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
Sex XY
//
ID H222R(5); standard; MUTATION; NTERM
Accession A0929
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H222R(6); standard; MUTATION; NTERM
Accession A0930
Systematic name g.17065A>G, c.665A>G, r.665a>g, p.His222Arg
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17065
Feature /change: a -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 679
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID H222Y(1); standard; MUTATION; NTERM
Accession A0394
Systematic name g.17064C>T, c.664C>T, r.664c>u, p.His222Tyr
Original code IV-10 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17064
Feature /change: c -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 678
Feature /codon: cat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 222
Feature /change: H -> Y
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID &G223(1); standard; MUTATION; NTERM
Accession A0109
Systematic name g.17067_17068delinsTT, c.667_668delinsTT,
Systematic name r.667_668delinsuu, p.Gly223Leu
Original code IV-12 ref [1]
Description A complex mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 17067..17068
Feature /change: gg -> tt
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 681..682
Feature /codon: gga -> tta; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 223
Feature /change: G -> L
Feature /domain: NTERM
Symptoms Mild CGD
Sex XY
//
ID G223X(1); standard; MUTATION; NTERM
Accession A0932
Systematic name g.17067G>T, c.667G>T, r.667g>u, p.Gly223X
Description A point mutation in the exon 6 leading to a premature stop
Description codon in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17067
Feature /change: g -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 681
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 223
Feature /change: G -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID A224G(1); standard; MUTATION; NTERM
Accession A0351
Systematic name g.17071C>G, c.671C>G, r.671c>g, p.Ala224Gly
Original code 91-16 ref [1]
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17071
Feature /change: c -> g
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 685
Feature /codon: gct -> ggt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 224
Feature /change: A -> G
Feature /domain: NTERM
Phenotype X91 0
//
ID E225V(1); standard; MUTATION; NTERM
Accession A0933
Systematic name g.17074A>T, c.674A>T, r.674a>u, p.Glu225Val
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17074
Feature /change: a -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 688
Feature /codon: gaa -> gta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 225
Feature /change: E -> V
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID E225V(2); standard; MUTATION; NTERM
Accession A0934
Systematic name g.17074A>T, c.674A>T, r.674a>u, p.Glu225Val
Description A point mutation in the exon 6 leading to an amino acid
Description change in the NTERM domain
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17074
Feature /change: a -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 688
Feature /codon: gaa -> gta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 225
Feature /change: E -> V
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(1); standard; MUTATION; NTERM
Accession A0132
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code III-13 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R226X(2); standard; MUTATION; NTERM
Accession A0150
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code III-14 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID R226X(3a); standard; MUTATION; NTERM
Accession A0279
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code VIII-22 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0280 brother
Comment Sister Ewa carrier, father normal
//
ID R226X(3b); standard; MUTATION; NTERM
Accession A0280
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code VIII-22 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Relative CYBBbase; A0279 brother
Comment Sister Ewa carrier, father normal
//
ID R226X(4); standard; MUTATION; NTERM
Accession A0281
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code VIII-23 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (French)
Family history Inherited, mother is carrier
//
ID R226X(5); standard; MUTATION; NTERM
Accession A0282
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code VIII-24 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID R226X(6); standard; MUTATION; NTERM
Accession A0283
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID R226X(7); standard; MUTATION; NTERM
Accession A0284
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Dutch)
Family history Inherited, mother is carrier
Comment Maternal aunt is carrier
//
ID R226X(8); standard; MUTATION; NTERM
Accession A0435
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code III-15 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(9); standard; MUTATION; NTERM
Accession A0436
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(10); standard; MUTATION; NTERM
Accession A0437
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(11); standard; MUTATION; NTERM
Accession A0438
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Both parents normal
Comment Parents are normal
//
ID R226X(12); standard; MUTATION; NTERM
Accession A0439
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code 91-17 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(13); standard; MUTATION; NTERM
Accession A0440
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code 91-18 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(14); standard; MUTATION; NTERM
Accession A0441
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Sex XY
//
ID R226X(15); standard; MUTATION; NTERM
Accession A0442
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID R226X(16); standard; MUTATION; NTERM
Accession A0588
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code 10. M.M.
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Phenotype X91 ?
Diagnosis Classical X-linked CGD
Symptoms Recurrent lymphadenitis, recurrent pyodermatitis
Age 8 mo
Family history Unknown
//
ID R226X(17a); standard; MUTATION; NTERM
Accession A0957
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0958
//
ID R226X(17b); standard; MUTATION; NTERM
Accession A0958
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0957
//
ID R226X(18a); standard; MUTATION; NTERM
Accession A0959
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0960
//
ID R226X(18b); standard; MUTATION; NTERM
Accession A0960
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0959
//
ID R226X(19a); standard; MUTATION; NTERM
Accession A0961
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0962
//
ID R226X(19b); standard; MUTATION; NTERM
Accession A0962
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0961
//
ID R226X(20a); standard; MUTATION; NTERM
Accession A0963
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0964
//
ID R226X(20b); standard; MUTATION; NTERM
Accession A0964
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0963
//
ID R226X(21a); standard; MUTATION; NTERM
Accession A0965
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0966
//
ID R226X(21b); standard; MUTATION; NTERM
Accession A0966
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0965
//
ID R226X(22); standard; MUTATION; NTERM
Accession A0967
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(23); standard; MUTATION; NTERM
Accession A0968
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(24); standard; MUTATION; NTERM
Accession A0969
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(25); standard; MUTATION; NTERM
Accession A0970
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(26); standard; MUTATION; NTERM
Accession A0971
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(27); standard; MUTATION; NTERM
Accession A0972
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(28); standard; MUTATION; NTERM
Accession A0973
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(29); standard; MUTATION; NTERM
Accession A0974
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(30); standard; MUTATION; NTERM
Accession A0975
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(31); standard; MUTATION; NTERM
Accession A0976
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(32); standard; MUTATION; NTERM
Accession A0977
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(33); standard; MUTATION; NTERM
Accession A0978
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(34); standard; MUTATION; NTERM
Accession A0979
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(35); standard; MUTATION; NTERM
Accession A0980
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(36); standard; MUTATION; NTERM
Accession A0981
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(37); standard; MUTATION; NTERM
Accession A0982
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(38); standard; MUTATION; NTERM
Accession A0983
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(39); standard; MUTATION; NTERM
Accession A0984
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(40); standard; MUTATION; NTERM
Accession A0985
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(41); standard; MUTATION; NTERM
Accession A0986
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(42); standard; MUTATION; NTERM
Accession A0987
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(43); standard; MUTATION; NTERM
Accession A0988
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(44); standard; MUTATION; NTERM
Accession A0989
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(45); standard; MUTATION; NTERM
Accession A0990
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(46); standard; MUTATION; NTERM
Accession A0991
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(47); standard; MUTATION; NTERM
Accession A0992
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(48); standard; MUTATION; NTERM
Accession A0993
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(49); standard; MUTATION; NTERM
Accession A0994
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(50); standard; MUTATION; NTERM
Accession A0995
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(51); standard; MUTATION; NTERM
Accession A0996
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(52); standard; MUTATION; NTERM
Accession A0997
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(53); standard; MUTATION; NTERM
Accession A0998
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(54); standard; MUTATION; NTERM
Accession A0999
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(55); standard; MUTATION; NTERM
Accession A1000
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID R226X(56); standard; MUTATION; NTERM
Accession A1440
Systematic name g.19889C>T, c.676C>T, r.676c>u, p.Arg226X
Original code GMS
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19889
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 690
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 226
Feature /change: R -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Hepatic and pulmonary aspergillosis
Age 0.2
Sex male
Ethnic origin Caucasoid
Family history Inherited
Comment Mother carrier
//
ID Q231X(1); standard; MUTATION; NTERM
Accession A0421
Systematic name g.19904C>T, c.691C>T, r.691c>u, p.Gln231X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19904
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 705
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 231
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype het
Sex XX
//
ID Q231X(2); standard; MUTATION; NTERM
Accession A0422
Systematic name g.19904C>T, c.691C>T, r.691c>u, p.Gln231X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19904
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 705
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 231
Feature /change: Q -> X
Feature /domain: NTERM
Sex XY
//
ID Q231X(3); standard; MUTATION; NTERM
Accession A1001
Systematic name g.19904C>T, c.691C>T, r.691c>u, p.Gln231X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19904
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 705
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 231
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Q231X(4); standard; MUTATION; NTERM
Accession A1002
Systematic name g.19904C>T, c.691C>T, r.691c>u, p.Gln231X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19904
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 705
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 231
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID E234X(1); standard; MUTATION; NTERM
Accession A0607
Systematic name g.19913G>T, c.700G>T, r.700g>u, p.Glu234X
Original code Patient 1
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 23-Oct-2007 (Rel. 2, Created)
Date 23-Oct-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17576211
RefAuthors Koker, M. Y., Sanal, O., De Boer, M., Tezcan, I., Metin,
RefAuthors A., Ersoy, F., Roos, D.
RefTitle Mutations of chronic granulomatous disease in turkish
RefTitle families.
RefLoc Eur J Clin Invest:589-595 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19913
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 714
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 234
Feature /change: E -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Pulmonary tuberculosis with mycobacterium infections after
Symptoms BCG vaccination, recurrent pneumonia, subcutaneous
Symptoms abscesses in the neck and face at around 3 years
Ethnic origin Caucasoid; Turkey
Comment Patient's sister, mother and grandmother are carriers of
Comment the mutation
//
ID #S235X239(1); standard; MUTATION; NTERM
Accession A0120
Systematic name g.19916_19917delAG, c.703_704delAG, r.703_704delag,
Systematic name p.Ser235fsX5
Original code II-08 ref [1]
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19916..19917
Feature /change: -ag
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 717..718
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 235
Feature /change: S -> FGCAX
Feature /domain: NTERM
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID #S235X239(2); standard; MUTATION; NTERM
Accession A0212
Systematic name g.19916_19917delAG, c.703_704delAG, r.703_704delag,
Systematic name p.Ser235fsX5
Original code IV-24 ref [1]
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19916..19917
Feature /change: -ag
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 717..718
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 235
Feature /change: S -> FGCAX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
//
ID #S235X239(3); standard; MUTATION; NTERM
Accession A0323
Systematic name g.19916_19917delAG, c.703_704delAG, r.703_704delag,
Systematic name p.Ser235fsX5
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19916..19917
Feature /change: -ag
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 717..718
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 235
Feature /change: S -> FGCAX
Feature /domain: NTERM
Phenotype X91 0
//
ID #S235X239(4); standard; MUTATION; NTERM
Accession A1003
Systematic name g.19916_19917delAG, c.703_704delAG, r.703_704delag,
Systematic name p.Ser235fsX5
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19916..19917
Feature /change: -ag
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 717..718
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 235
Feature /change: S -> FGCAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #S235X239(5); standard; MUTATION; NTERM
Accession A1004
Systematic name g.19916_19917delAG, c.703_704delAG, r.703_704delag,
Systematic name p.Ser235fsX5
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19916..19917
Feature /change: -ag
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 717..718
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 235
Feature /change: S -> FGCAX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @L236X242(1); standard; MUTATION; NTERM
Accession A0344
Systematic name g.19919_19920dup, c.706_707dup, r.706_707dup, p.Leu236fsX7
Original code 91-19 ref [2]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19921
Feature /change: +tt
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 722
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 236
Feature /change: L -> FWLCIIX
Feature /domain: NTERM
Phenotype X91 0
//
ID #V238X241(1); standard; MUTATION; NTERM
Accession A0628
Systematic name g.19926delT, c.713delT, r.713delu, p.Val238fsX4
Original code P4
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19926
Feature /change: -t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 727
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 238
Feature /change: V -> GIIX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent severe pneumonia.
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID #H239X243(1); standard; MUTATION; NTERM
Accession A0117
Systematic name g.19929_19933delATAAT, c.716_720delATAAT,
Systematic name r.716_720delauaau, p.Ile241fsX3
Original code II-09 ref [1]
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19929..19933
Feature /change: -ataat
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 730..734
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 239..240
Feature /change: HN -> HNSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex ??
//
ID C244G(1); standard; MUTATION; NTERM
Accession A0359
Systematic name g.19943T>G, c.730T>G, r.730u>g, p.Cys244Gly
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19943
Feature /change: t -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 744
Feature /codon: tgt -> ggt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> G
Feature /domain: NTERM
Phenotype X91 -
//
ID C244R(1); standard; MUTATION; NTERM
Accession A0171
Systematic name g.19943T>C, c.730T>C, r.730u>c, p.Cys244Arg
Original code IV-13 ref [1]
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19943
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 744
Feature /codon: tgt -> cgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> R
Feature /domain: NTERM
Sex XY
//
ID C244R(2); standard; MUTATION; NTERM
Accession A1006
Systematic name g.19943T>C, c.730T>C, r.730u>c, p.Cys244Arg
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19943
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 744
Feature /codon: tgt -> cgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C244S(1); standard; MUTATION; NTERM
Accession A0251
Systematic name g.19944G>C, c.731G>C, r.731g>c, p.Cys244Ser
Original code J.L. ref [1];VII-16 ref [2]
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19944
Feature /change: g -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 745
Feature /codon: tgt -> tct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> S
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 -
Protein level Strongly decreased
Heme level Strongly decreased
Oxidase act. Strongly decreased
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Danish)
//
ID C244S(2); standard; MUTATION; NTERM
Accession A1005
Systematic name g.19943T>A, c.730T>A, r.730u>a, p.Cys244Ser
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19943
Feature /change: t -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 744
Feature /codon: tgt -> agt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> S
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C244Y(1); standard; MUTATION; NTERM
Accession A0252
Systematic name g.19944G>A, c.731G>A, r.731g>a, p.Cys244Tyr
Original code pat. 2 ref []
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7579466
RefAuthors Bu-Ghanim, H. N., Segal, A. W., Keep, N. H., Casimir, C.
RefAuthors M.
RefTitle Molecular analysis in three cases of X91- variant chronic
RefTitle granulomatous disease.
RefLoc Blood 86:3575-3582 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19944
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 745
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> Y
Feature /domain: NTERM
Phenotype X91 -
Sex XY
//
ID C244Y(2); standard; MUTATION; NTERM
Accession A1007
Systematic name g.19944G>A, c.731G>A, r.731g>a, p.Cys244Tyr
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19944
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 745
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> Y
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C244Y(3); standard; MUTATION; NTERM
Accession A1008
Systematic name g.19944G>A, c.731G>A, r.731g>a, p.Cys244Tyr
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19944
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 745
Feature /codon: tgt -> tat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> Y
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID C244X(1); standard; MUTATION; NTERM
Accession A1009
Systematic name g.19945T>A, c.732T>A, r.732u>a, p.Cys244X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19945
Feature /change: t -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 746
Feature /codon: tgt -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 244
Feature /change: C -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID E245X(1); standard; MUTATION; NTERM
Accession A1010
Systematic name g.19946G>T, c.733G>T, r.733g>u, p.Glu245X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19946
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 747
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 245
Feature /change: E -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Q246X(1a); standard; MUTATION; NTERM
Accession A0122
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Original code III-16 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0123 brother
//
ID Q246X(1b); standard; MUTATION; NTERM
Accession A0123
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Original code III-16 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0122 brother
//
ID Q246X(2); standard; MUTATION; NTERM
Accession A0186
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Original code III-17 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID Q246X(3); standard; MUTATION; NTERM
Accession A0423
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID Q246X(4a); standard; MUTATION; NTERM
Accession A1011
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1012
//
ID Q246X(4b); standard; MUTATION; NTERM
Accession A1012
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1011
//
ID Q246X(5a); standard; MUTATION; NTERM
Accession A1013
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1014
//
ID Q246X(5b); standard; MUTATION; NTERM
Accession A1014
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1013
//
ID Q246X(6); standard; MUTATION; NTERM
Accession A1015
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Q246X(7); standard; MUTATION; NTERM
Accession A1016
Systematic name g.19949C>T, c.736C>T, r.736c>u, p.Gln246X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19949
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 750
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #Q246X254(1); standard; MUTATION; NTERM
Accession A0021
Systematic name g.19951_19952delinsT, c.738_739delinsT, r.738_739delinsu,
Systematic name p.Gln246fsX9
Description A frame shift indel mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 19951..19952
Feature /change: aa -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 752..753
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 246..247
Feature /change: QK -> HKSQNGEKX
Feature /domain: NTERM
Protein struct Premature stop
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
//
ID @I248X283(1); standard; MUTATION; NTERM
Accession A0002
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code V-06 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
Heme level 0
Oxidase act. 0
NBT-slide 0 %
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Netherlands)
//
ID @I248X283(2a); standard; MUTATION; NTERM
Accession A0061
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code patient 4 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
Family history Inherited, mother is carrier
Relative CYBBbase; A0062 brother
Comment Another brother with CGD deceased
//
ID @I248X283(2b); standard; MUTATION; NTERM
Accession A0062
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code patient 5 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
Family history Inherited, mother is carrier
Relative CYBBbase; A0061 brother
Comment Another brother with CGD deceased
//
ID @I248X283(3); standard; MUTATION; NTERM
Accession A0121
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code J.H. ref [1];II-11 ref [2]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7525551
RefAuthors Nanda, A., Romanek, R., Curnutte, J. T., Grinstein, S.
RefTitle Assessment of the contribution of the cytochrome b moiety
RefTitle of the NADPH oxidase to the transmembrane H+ conductance
RefTitle of leukocytes.
RefLoc J Biol Chem:27280-27285 (1994)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID @I248X283(4); standard; MUTATION; NTERM
Accession A0126
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code B.H. ref [1];II-12 ref [2]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7525551
RefAuthors Nanda, A., Romanek, R., Curnutte, J. T., Grinstein, S.
RefTitle Assessment of the contribution of the cytochrome b moiety
RefTitle of the NADPH oxidase to the transmembrane H+ conductance
RefTitle of leukocytes.
RefLoc J Biol Chem:27280-27285 (1994)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID @I248X283(5); standard; MUTATION; NTERM
Accession A0146
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code II-13 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID @I248X283(6); standard; MUTATION; NTERM
Accession A0162
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code II-14 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID @I248X283(7); standard; MUTATION; NTERM
Accession A0170
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code II-15 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Sex XY
Comment Deceased
//
ID @I248X283(8); standard; MUTATION; NTERM
Accession A0189
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code II-16 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID @I248X283(9); standard; MUTATION; NTERM
Accession A0337
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code II-10 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
//
ID @I248X283(10); standard; MUTATION; NTERM
Accession A0338
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9454688
RefAuthors Heyworth, P. G., Curnutte, J. T., Noack, D., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease--an update.
RefLoc Blood Cells Mol Dis 23:443-450 (1997)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
//
ID @I248X283(11); standard; MUTATION; NTERM
Accession A0339
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9454688
RefAuthors Heyworth, P. G., Curnutte, J. T., Noack, D., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease--an update.
RefLoc Blood Cells Mol Dis 23:443-450 (1997)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
//
ID @I248X283(12); standard; MUTATION; NTERM
Accession A0340
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
//
ID @I248X283(13); standard; MUTATION; NTERM
Accession A0341
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code 91-20 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
//
ID @I248X283(14); standard; MUTATION; NTERM
Accession A0342
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code 91-21 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
//
ID @I248X283(15); standard; MUTATION; NTERM
Accession A0343
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 11-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Phenotype X91 0
//
ID @I248X283(16a); standard; MUTATION; NTERM
Accession A0602
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code GAO
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 07-Sep-2007 (Rel. 2, Created)
Date 07-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Osteomyelitis in left humerus, pneumonia, anal fistula.
Age 5,5
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother is carrier. Brother has CGD.
Relative CYBBbase; A0603 brother
Comment This patient died when ten years old from pneumonia,sepsis
Comment and brain haemorrhage
//
ID @I248X283(16b); standard; MUTATION; NTERM
Accession A0603
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code FAO
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 07-Sep-2007 (Rel. 2, Created)
Date 07-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Anal fistula, inguinal abscess.
Age 1,9
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother is carrier. Brother has CGD
Relative CYBBbase; A0602 brother
//
ID @I248X283(17); standard; MUTATION; NTERM
Accession A0604
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Original code YAA
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 07-Sep-2007 (Rel. 2, Created)
Date 07-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Sep-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan; Servicio de
RefLoc Inmunologia. Planta sotano Hospital Infantil. Hospital La
RefLoc Paz.Castellana 261.28046 Madrid.Spain; Tel 917277095; Fax
RefLoc 917277238; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Perianal abscess, cervical adenitis
Age 3
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother is carrier. Brother died
Relative from sepsis.
//
ID @I248X283(18); standard; MUTATION; NTERM
Accession A1017
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(19); standard; MUTATION; NTERM
Accession A1018
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(20); standard; MUTATION; NTERM
Accession A1019
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(21); standard; MUTATION; NTERM
Accession A1020
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(22); standard; MUTATION; NTERM
Accession A1021
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(23); standard; MUTATION; NTERM
Accession A1022
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(24); standard; MUTATION; NTERM
Accession A1023
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(25); standard; MUTATION; NTERM
Accession A1024
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(26); standard; MUTATION; NTERM
Accession A1025
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(27); standard; MUTATION; NTERM
Accession A1026
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(28); standard; MUTATION; NTERM
Accession A1027
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(29); standard; MUTATION; NTERM
Accession A1028
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I248X283(30); standard; MUTATION; NTERM
Accession A1029
Systematic name g.19955dupA, c.742dupA, r.742dupa, p.Ile248fsX36
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19956
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 757
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 248
Feature /change: I -> NLRMGKNKGM PNPSVCWKPS YDLEMDSGSH VSVSLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W251X(1); standard; MUTATION; NTERM
Accession A0285
Systematic name g.19965G>A, c.752G>A, r.752g>a, p.Trp251X
Original code VIII-25 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19965
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 766
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 251
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Sex XY
Comment Sister is carrier
//
ID W251X(2); standard; MUTATION; NTERM
Accession A1030
Systematic name g.19965G>A, c.752G>A, r.752g>a, p.Trp251X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19965
Feature /change: g -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 766
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 251
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID G252X(1); standard; MUTATION; NTERM
Accession A1031
Systematic name g.19967G>T, c.754G>T, r.754g>u, p.Gly252X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19967
Feature /change: g -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 768
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #G252X254(1a); standard; MUTATION; NTERM
Accession A0219
Systematic name g.19968delG, c.755delG, r.755delg, p.Gly252fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> EKX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
Relative CYBBbase; A0220 brother
//
ID #G252X254(1b); standard; MUTATION; NTERM
Accession A0220
Systematic name g.19968delG, c.755delG, r.755delg, p.Gly252fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> EKX
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Italian)
Family history Inherited, mother is carrier
Relative CYBBbase; A0219 brother
//
ID #G252X254(2); standard; MUTATION; NTERM
Accession A0195
Systematic name g.19968delG, c.755delG, r.755delg, p.Gly252fsX3
Original code II-17 ref [1]
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> EKX
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID #G252X254(3); standard; MUTATION; NTERM
Accession A1032
Systematic name g.19968delG, c.755delG, r.755delg, p.Gly252fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> EKX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #G252X254(4); standard; MUTATION; NTERM
Accession A1033
Systematic name g.19968delG, c.755delG, r.755delg, p.Gly252fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968
Feature /change: -g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> EKX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #G252X282(1); standard; MUTATION; NTERM
Accession A1034
Systematic name g.19968_19969delGA, c.755_756delGA, r.755_756delga,
Systematic name p.Gly252fsX31
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Sep-2010 (Rel. 2, Created)
Date 02-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19968..19969
Feature /change: -ga
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 769..770
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 252
Feature /change: G -> ENKGMPNPSV CWKPSYDLEM DSGSHVSVSL X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @I254X283(1); standard; MUTATION; NTERM
Accession A0128
Systematic name g.19973dupA, c.760dupA, r.760dupa, p.Ile254fsX30
Original code II-18 ref [1]
Description A frame shift duplication mutation in the exon 7 leading to
Description a premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 19974
Feature /change: +a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 775
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 254
Feature /change: I -> NKGMPNPSVC WKPSYDLEMD SGSHVSVSLX
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID C257R(1a); standard; MUTATION; NTERM
Accession A1035
Systematic name g.19982T>C, c.769T>C, r.769u>c, p.Cys257Arg
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19982
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 783
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 257
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1036
//
ID C257R(1b); standard; MUTATION; NTERM
Accession A1036
Systematic name g.19982T>C, c.769T>C, r.769u>c, p.Cys257Arg
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19982
Feature /change: t -> c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 783
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 257
Feature /change: C -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A01035
//
ID C257X(1); standard; MUTATION; NTERM
Accession A0360
Systematic name g.19984C>A, c.771C>A, r.771c>a, p.Cys257X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19984
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 785
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 257
Feature /change: C -> X
Feature /domain: NTERM
Phenotype X91-0
Sex XX
Comment "carrier; daughter is also carrier"
//
ID C257X(2); standard; MUTATION; NTERM
Accession A1038
Systematic name g.19984C>A, c.771C>A, r.771c>a, p.Cys257X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19984
Feature /change: c -> a
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 785
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 257
Feature /change: C -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #C257X268(1); standard; MUTATION; NTERM
Accession A1037
Systematic name g.19984delC, c.771delC, r.771delc, p.Pro258fsX11
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19984
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 785
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 257
Feature /change: C -> CQSLSLLETL LX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID P260R(1); standard; MUTATION; NTERM
Accession A1039
Systematic name g.19992C>G, c.779C>G, r.779c>g, p.Pro260Arg
Description A point mutation in the exon 7 leading to an amino acid
Description change in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19992
Feature /change: c -> g
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 793
Feature /codon: cct -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 260
Feature /change: P -> R
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Q261X(1); standard; MUTATION; NTERM
Accession A0020
Systematic name g.19994C>T, c.781C>T, r.781c>u, p.Gln261X
Original code VIII-26 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19994
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> X
Feature /domain: NTERM
mRNA level Decreased
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
//
ID Q261X(2); standard; MUTATION; NTERM
Accession A0286
Systematic name g.19994C>T, c.781C>T, r.781c>u, p.Gln261X
Original code VIII-27 ref [1]
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19994
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited, mother is carrier
Comment 2x prenatal diagnosis, both positive for mutation in CVS
Comment and aborted fetus DNA
//
ID Q261X(3); standard; MUTATION; NTERM
Accession A0424
Systematic name g.19994C>T, c.781C>T, r.781c>u, p.Gln261X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19994
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Comment Other sister is carrier, the other not
//
ID Q261X(4); standard; MUTATION; NTERM
Accession A0425
Systematic name g.19994C>T, c.781C>T, r.781c>u, p.Gln261X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19994
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID Q261X(5); standard; MUTATION; NTERM
Accession A1040
Systematic name g.19994C>T, c.781C>T, r.781c>u, p.Gln261X
Description A point mutation in the exon 7 leading to a premature stop
Description codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19994
Feature /change: c -> t
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #Q261X282(1); standard; MUTATION; NTERM
Accession A0001
Systematic name g.19994_19995delCA, c.781_782delCA, r.781_782delca,
Systematic name p.Gln261fsX22
Original code IV-25 ref [1]
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 19994..19995
Feature /change: -ca
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 795..796
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 261
Feature /change: Q -> VCWKPSYDLE MDSGSHVSVS LX
Feature /domain: NTERM
mRNA level Reduced
Phenotype X91 0
Protein level Reduced, low Mr
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
Comment Brothers normal
//
ID @F262+7/Intron 7/Intron 7(1); standard; MUTATION; NTERM
Accession A1416
Systematic name g.[19998_19999insTGCTGGAAACCCTCCTATGGT;
Systematic name 20020_20027delATGTACAA; 20019_20020insTG],
Systematic name c.[785_786insTGCTGGAAACCCTCCTATGGT;
Systematic name 804+3_804+10delATGTACAA; 804+2_804+3insTG],
Systematic name r.[785_786insugcuggaaacccuccuauggu;
Systematic name 804+3_804+10delauguacaa; 804+2_804+3insug],
Systematic name p.[Gln261_Phe262insPheAlaGlyAsnProProMetVal;?;?]
Description An inframe insertion in the exon 7 leading to an amino acid
Description change in the NTERM domain, 8 bp deletion and 2 bp
Description inserttion in intron 7
Date 15-Sep-2010 (Rel. 2, Created)
Date 15-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 4
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 19999
Feature /change: +tgctggaaac cctcctatgg t
Feature /genomic_region: exon; 7
Feature dna; 2
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 20020..20027
Feature /change: -atgtacaa
Feature /genomic_region: intron; 7
Feature dna; 3
Feature /rnalink: 6
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 20020
Feature /change: +tg
Feature /genomic_region: intron; 7
Feature rna; 4
Feature /dnalink: 1
Feature /aalink: 7
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 800
Feature rna; 5
Feature /dnalink: 2
Feature /aalink: 8
Feature /name: unknown
Feature /inexloc: +3
Feature rna; 6
Feature /dnalink: 3
Feature /aalink: 9
Feature /name: unknown
Feature aa; 7
Feature /rnalink: 4
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 262
Feature /change: F -> FAGNPPMV
Feature /domain: NTERM
Feature aa; 8
Feature /rnalink: 5
Feature /name: unknown
Feature /domain: NTERM
Feature /inexloc: +3
Feature aa; 9
Feature /rnalink: 6
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID #A263X268(1); standard; MUTATION; NTERM
Accession A0582
Systematic name g.20001delC, c.788delC, r.788delc, p.Ala263fsX6
Original code 2. A.S.
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 02-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 20001
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 802
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 263
Feature /change: A -> VETLLX
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, brain abscess, BCG-lymphadenitis,
Symptoms impetigo contagiosa, lymphadenitis, perianal fissures
Age 3
Comment Death after BMT
//
ID #P266X268(1); standard; MUTATION; NTERM
Accession A0316
Systematic name g.20010delC, c.797delC, r.797delc, p.Pro266fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 20010
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 811
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 266
Feature /change: P -> LLX
Feature /domain: NTERM
//
ID #P266X268(2); standard; MUTATION; NTERM
Accession A1041
Systematic name g.20010delC, c.797delC, r.797delc, p.Pro266fsX3
Description A frame shift deletion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 20010
Feature /change: -c
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 811
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 266
Feature /change: P -> LLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID @P267X269(1); standard; MUTATION; NTERM
Accession A1042
Systematic name g.20012_20013insAA, c.799_800insAA, r.799_800insaa,
Systematic name p.Pro267fsX3
Description A frame shift insertion mutation in the exon 7 leading to a
Description premature stop codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 20013
Feature /change: +aa
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 814
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 267
Feature /change: P -> QLX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W270X(1); standard; MUTATION; NTERM
Accession A0624
Systematic name g.22194G>A, c.810G>A, r.810g>a, p.Trp270X
Original code P10
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 29-Apr-2008 (Rel. 2, Created)
Date 29-Apr-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18322777
RefAuthors Teimourian, S., Rezvani, Z., Badalzadeh, M.,
RefAuthors Kannengiesser, C., Mansouri, D., Movahedi, M., Zomorodian,
RefAuthors E., Parvaneh, N., Mamishi, S., Pourpak, Z., Moin, M.
RefTitle Molecular diagnosis of X-linked chronic granulomatous
RefTitle disease in iran.
RefLoc Int J Hematol (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22194
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 824
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 270
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Age 2
Sex XY
Ethnic origin Caucasoid; Iran
Family history Inherited
//
ID W270X(2); standard; MUTATION; NTERM
Accession A1052
Systematic name g.22194G>A, c.810G>A, r.810g>a, p.Trp270X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22194
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 824
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 270
Feature /change: W -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID K271X(1); standard; MUTATION; NTERM
Accession A1053
Systematic name g.22195A>T, c.811A>T, r.811a>u, p.Lys271X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22195
Feature /change: a -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 825
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 271
Feature /change: K -> X
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID W272X(1); standard; MUTATION; NTERM
Accession A0047
Systematic name g.22200G>A, c.816G>A, r.816g>a, p.Trp272X
Original code VIII-28 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22200
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 830
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 272
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother carrier
Comment Sister is carrier
//
ID W272X(2); standard; MUTATION; NTERM
Accession A0099
Systematic name g.22200G>A, c.816G>A, r.816g>a, p.Trp272X
Original code III-18 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22200
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 830
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 272
Feature /change: W -> X
Feature /domain: NTERM
Symptoms Classical CGD
Sex XY
//
ID W272X(3); standard; MUTATION; NTERM
Accession A0287
Systematic name g.22200G>A, c.816G>A, r.816g>a, p.Trp272X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22200
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 830
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 272
Feature /change: W -> X
Feature /domain: NTERM
Sex XY
//
ID W272X(4); standard; MUTATION; NTERM
Accession A0482
Systematic name g.22200G>A, c.816G>A, r.816g>a, p.Trp272X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the NTERM domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22200
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 830
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 272
Feature /change: W -> X
Feature /domain: NTERM
Phenotype X91 0
//
ID #M277X339(1); standard; MUTATION; NTERM
Accession A1054
Systematic name g.22215_22237delGTTTCTGTATCTCTGTGAGAGGT,
Systematic name c.831_853delGTTTCTGTATCTCTGTGAGAGGT,
Systematic name r.831_853delguuucuguaucucugugagaggu, p.Met277fsX63
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon in the NTERM domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22215..22237
Feature /change: -gtttctgtat ctctgtgaga ggt
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 845..867
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 277..285
Feature /change: MFLYLCERL ->
Feature /change: IGAVLAISTE GGHHQGGHSP FQNHRATDEE EGVQNGSGTI
Feature /change: HFCQVPKGVQ AGVAPFYTDI RPX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Y280X(1); standard; MUTATION; FADBR
Accession A1055
Systematic name g.22224T>A, c.840T>A, r.840u>a, p.Tyr280X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22224
Feature /change: t -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 854
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 280
Feature /change: Y -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #C282X302(1); standard; MUTATION; FADBR
Accession A0536
Systematic name g.22228_22258del, c.844_874del, r.844_874del, p.Cys282fsX21
Original code U.G.G
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon in the FADBR domain
Date 12-Apr-2004 (Rel. 7, Created)
Date 12-Apr-2004 (Rel. 7, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (12-Apr-2004) to CYBBbase.
RefLoc A.Ferreira, M.C. Garcia Rodriguez, G.Fontan; Servicio de
RefLoc Inmunologia-Edificio Anatomia Patologica-Hospital La
RefLoc Paz-Castellana 261-28046 Madrid-Espana; Tel 917277238; Fax
RefLoc 917277095; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22228..22258
Feature /change: -tgtgagaggt tggtgcggtt ttggcgatct c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 858..888
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 282..292
Feature /change: CERLVRFWRS Q -> NRRWSSPRWS LTLSKPSSYR X
Feature /domain: FADBR
mRNA level N.D.
Protein level Absent
Sex XY
Ethnic origin Caucasoid; Spain
Family history De novo
//
ID @C282X283(1); standard; MUTATION; FADBR
Accession A1056
Systematic name g.22229dupG, c.845dupG, r.845dupg, p.Cys282fsX2
Description A frame shift duplication mutation in the exon 8 leading to
Description a premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 22230
Feature /change: +g
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 860
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 282
Feature /change: C -> WX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W289X(1); standard; MUTATION; FADBR
Accession A0542
Systematic name g.22251G>A, c.867G>A, r.867g>a, p.Trp289X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 13-Oct-2006 (Rel. 2, Created)
Date 13-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14697745
RefAuthors Anderson-Cohen, M., Holland, S. M., Kuhns, D. B.,
RefAuthors Fleisher, T. A., Ding, L., Brenner, S., Malech, H. L.,
RefAuthors Roesler, J.
RefTitle Severe phenotype of chronic granulomatous disease
RefTitle presenting in a female with a de novo mutation in gp91-
RefTitle phox and a non familial, extremely skewed X chromosome
RefTitle inactivation.
RefLoc Clin Immunol:308-317 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22251
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 881
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 289
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Symptoms Anemia, recurrent urinary tract infections, vertebral
Symptoms Aspergillus infection, liver abscesses from S. aureus,
Symptoms disseminated nocardiosis, several pneumonias due to A.
Symptoms fumigatus, Scedosporium apiospermum, B. cepacia, and S.
Symptoms marcescens, undefined intermittent spinal myoclonus
Sex XX
//
ID W289X(2); standard; MUTATION; FADBR
Accession A1057
Systematic name g.22251G>A, c.867G>A, r.867g>a, p.Trp289X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22251
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 881
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 289
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(1a); standard; MUTATION; FADBR
Accession A0045
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code VIII-33 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother carrier
Relative CYBBbase; A0046 cousin
Comment Maternal aunt is carrier
//
ID R290X(1b); standard; MUTATION; FADBR
Accession A0046
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code VIII-33 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother carrier
Relative CYBBbase; A0045 cousin
Comment Maternal aunt is carrier
//
ID R290X(2); standard; MUTATION; FADBR
Accession A0145
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code III-19 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother carrier
//
ID R290X(3); standard; MUTATION; FADBR
Accession A0159
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code III-20 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R290X(4); standard; MUTATION; FADBR
Accession A0194
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code III-21 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Sex XY
//
ID R290X(5); standard; MUTATION; FADBR
Accession A0198
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code III-22 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID R290X(6); standard; MUTATION; FADBR
Accession A0288
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code VIII-31 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited, mother carrier
//
ID R290X(7); standard; MUTATION; FADBR
Accession A0289
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code VIII-32 ref [1]
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Sex XY
//
ID R290X(8); standard; MUTATION; FADBR
Accession A0443
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Family history Inherited, mother carrier
//
ID R290X(9); standard; MUTATION; FADBR
Accession A0444
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Sex XX
Comment Carrier, mother of patient, prenatal: fetus normal
//
ID R290X(10); standard; MUTATION; FADBR
Accession A0445
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Sex XY
//
ID R290X(11); standard; MUTATION; FADBR
Accession A0446
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
//
ID R290X(12); standard; MUTATION; FADBR
Accession A0447
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
//
ID R290X(13); standard; MUTATION; FADBR
Accession A0448
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9454688
RefAuthors Heyworth, P. G., Curnutte, J. T., Noack, D., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease--an update.
RefLoc Blood Cells Mol Dis 23:443-450 (1997)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
//
ID R290X(14); standard; MUTATION; FADBR
Accession A0449
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9454688
RefAuthors Heyworth, P. G., Curnutte, J. T., Noack, D., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease--an update.
RefLoc Blood Cells Mol Dis 23:443-450 (1997)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
//
ID R290X(15); standard; MUTATION; FADBR
Accession A0450
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Sex XX
Comment Carrier, sister of patient
//
ID R290X(16a); standard; MUTATION; FADBR
Accession A0451
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0452 brother
Comment Grandmother is carrier
//
ID R290X(16b); standard; MUTATION; FADBR
Accession A0452
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0451 brother
Comment Grandmother is carrier
//
ID R290X(17); standard; MUTATION; FADBR
Accession A0453
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Sex XY
//
ID R290X(18); standard; MUTATION; FADBR
Accession A0639
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code P15
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 23-May-2008 (Rel. 2, Created)
Date 23-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Symptoms Pulmonary and abdominal tuberculosis, pneumonia, spleen and
Symptoms liver abscesses, lymphadenitis, purulent arthritis,
Symptoms impetigo.
Sex XY
Ethnic origin Mongoloid
//
ID R290X(19a); standard; MUTATION; FADBR
Accession A1058
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1059
//
ID R290X(19b); standard; MUTATION; FADBR
Accession A1059
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1058
//
ID R290X(20); standard; MUTATION; FADBR
Accession A1060
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(21); standard; MUTATION; FADBR
Accession A1061
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(22); standard; MUTATION; FADBR
Accession A1062
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(23); standard; MUTATION; FADBR
Accession A1063
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(24); standard; MUTATION; FADBR
Accession A1064
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(25); standard; MUTATION; FADBR
Accession A1065
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(26); standard; MUTATION; FADBR
Accession A1066
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(27); standard; MUTATION; FADBR
Accession A1067
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(28); standard; MUTATION; FADBR
Accession A1068
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(29); standard; MUTATION; FADBR
Accession A1069
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(30); standard; MUTATION; FADBR
Accession A1070
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(31); standard; MUTATION; FADBR
Accession A1071
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(32); standard; MUTATION; FADBR
Accession A1072
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(33); standard; MUTATION; FADBR
Accession A1073
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(34); standard; MUTATION; FADBR
Accession A1074
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(35); standard; MUTATION; FADBR
Accession A1075
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(36); standard; MUTATION; FADBR
Accession A1076
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(37); standard; MUTATION; FADBR
Accession A1077
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R290X(38); standard; MUTATION; FADBR
Accession A1433
Systematic name g.22252C>T, c.868C>T, r.868c>u, p.Arg290X
Original code RAF
Description A point mutation in the exon 8 leading to a premature stop
Description codon in the FADBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22252
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 882
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290
Feature /change: R -> X
Feature /domain: FADBR
Protein level Absent
Diagnosis Classical X-linked CGD
Age 1.5
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier. Grandmother
Relative healthy.
//
ID #R290X309(1); standard; MUTATION; FADBR
Accession A0321
Systematic name g.22254_22263delATCTCAACAG, c.870_879delATCTCAACAG,
Systematic name r.870_879delaucucaacag, p.Ser291fsX19
Original code 91-23 ref [1]
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22254..22263
Feature /change: -atctcaacag
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 884..893
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 290..293
Feature /change: RSQQ -> RRWSSPRWSL TLSKPSSYRX
Feature /domain: FADBR
Phenotype X91 0
//
ID @V296X314(1); standard; MUTATION; FADBR
Accession A1078
Systematic name g.22267_22271dup, c.883_887dup, r.883_887dup, p.Ile297fsX18
Description A frame shift duplication mutation in the exon 8 leading to
Description a premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 22272
Feature /change: +gtggt
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 902
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 296
Feature /change: V -> VWSSPRWSLT LSKPSSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #I297-5(1); standard; MUTATION; FADBR
Accession A0310
Systematic name g.22274_22288delTCACCAAGGTGGTCA,
Systematic name c.890_904delTCACCAAGGTGGTCA, r.890_904delucaccaaggugguca,
Systematic name p.Ile297del
Original code M.C. ref [1]
Description An inframe deletion in the exon 8 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9794433
RefAuthors Dusi, S., Nadalini, K. A., Donini, M., Zentilin, L.,
RefAuthors Wientjes, F. B., Roos, D., Giacca, M., Rossi, F.
RefTitle Nicotinamide-adenine dinucleotide phosphate oxidase
RefTitle assembly and activation in EBV-transformed B
RefTitle lymphoblastoid cell lines of normal and chronic
RefTitle granulomatous disease patients.
RefLoc J Immunol 161:4968-4974 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22274..22288
Feature /change: -tcaccaaggt ggtca
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 904..918
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 297..302
Feature /change: ITKVVT -> T
Feature /domain: FADBR
Phenotype X91 +
Oxidase act. 20 %
//
ID #T298X312(1a); standard; MUTATION; FADBR
Accession A1079
Systematic name g.22278delC, c.894delC, r.894delc, p.Lys299fsX14
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22278
Feature /change: -c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 908
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 298
Feature /change: T -> TRWSLTLSKP SSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1080
//
ID #T298X312(1b); standard; MUTATION; FADBR
Accession A1080
Systematic name g.22278delC, c.894delC, r.894delc, p.Lys299fsX14
Description A frame shift deletion mutation in the exon 8 leading to a
Description premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 22278
Feature /change: -c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 908
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 298
Feature /change: T -> TRWSLTLSKP SSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1079
//
ID K299K(1); standard; MUTATION; FADBR
Accession A1081
Systematic name g.22281G>A, c.897G>A, r.897g>a, p.Lys299Lys
Description A point mutation in the exon 8 leading to an amino acid
Description change in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22281
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 911
Feature /codon: aag -> aaa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 299
Feature /change: K -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID K299K(2); standard; MUTATION; FADBR
Accession A1082
Systematic name g.22281G>A, c.897G>A, r.897g>a, p.Lys299Lys
Description A point mutation in the exon 8 leading to an amino acid
Description change in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22281
Feature /change: g -> a
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 911
Feature /codon: aag -> aaa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 299
Feature /change: K -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID K299N(1); standard; MUTATION; FADBR
Accession A0402
Systematic name g.22281G>T, c.897G>T, r.897g>u, p.Lys299Asn
Description A point mutation in the exon 8 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22281
Feature /change: g -> t
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 911
Feature /codon: aag -> aat; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 299
Feature /change: K -> N
Feature /domain: FADBR
Sex XY
Comment Mother and maternal aunt not carrier
//
ID H303N/P304R(1a); standard; MUTATION; FADBR
Accession A0538
Systematic name g.[24823C>A; 24827C>G], c.[907C>A; 911C>G],
Systematic name r.[907c>a; 911c>g], p.[His303Asn; Pro304Arg]
Description Two point mutations in the exon 9 leading to two amino
Description acid changes in the FADBR domain
Date 09-Jul-2004 (Rel. 7, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Submitted (09-Jul-2004) to CYBBbase.
RefLoc STASIA; GREPI EA 2938 UJF,Lab Enzymologie CHU de Grenoble,
RefLoc BP217 38043 Grenoble FRANCE; Tel 33.4.76.76.54.83; Fax
RefLoc 33.4.76.76.56.08; e-mail MJStasia@chu-grenoble.fr
RefNumber [2]
RefCrossRef PUBMED; 11997083
RefAuthors Stasia, M. J., Lardy, B., Maturana, A., Rousseau, P.,
RefAuthors Martel, C., Bordigoni, P., Demaurex, N., Morel, F.
RefTitle Molecular and functional characterization of a new X-
RefTitle linked chronic granulomatous disease variant (X91+) case
RefTitle with a double missense mutation in the cytosolic gp91phox
RefTitle C-terminal tail.
RefLoc Biochim Biophys Acta 1586:316-330 (2002)
RefNumber [3]
RefCrossRef PUBMED; 15818813
RefAuthors Stasia, M. J.
RefTitle Gene symbol: CYBB. disease: X-linked chronic granulomatous
RefTitle disease.
RefLoc Hum Genet:236 (2005)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24823
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24827
Feature /change: c -> g
Feature /genomic_region: exon; 9
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 921
Feature /codon: cac -> aac; 1
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 925
Feature /codon: cct -> cgt; 2
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> N
Feature /domain: FADBR
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 304
Feature /change: P -> R
Feature /domain: FADBR
Phenotype X91 +
mRNA level Normal
Protein level Normal
Sex XY
Ethnic origin Caucasoid; France
Family history Inherited
Relative CYBBbase; A0648 cousin
//
ID H303N/P304R(1b); standard; MUTATION; FADBR
Accession A0648
Systematic name g.[24823C>A; 24827C>G], c.[907C>A; 911C>G],
Systematic name r.[907c>a; 911c>g], p.[His303Asn; Pro304Arg]
Description Two point mutations in the exon 9 leading to two amino
Description acid changes in the FADBR domain
Date 18-Aug-2010 (Rel. 2, Created)
Date 18-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11997083
RefAuthors Stasia, M. J., Lardy, B., Maturana, A., Rousseau, P.,
RefAuthors Martel, C., Bordigoni, P., Demaurex, N., Morel, F.
RefTitle Molecular and functional characterization of a new X-
RefTitle linked chronic granulomatous disease variant (X91+) case
RefTitle with a double missense mutation in the cytosolic gp91phox
RefTitle C-terminal tail.
RefLoc Biochim Biophys Acta 1586:316-330 (2002)
Feature dna; 1
Feature /rnalink: 3
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24823
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24827
Feature /change: c -> g
Feature /genomic_region: exon; 9
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 921
Feature /codon: cac -> aac; 1
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 925
Feature /codon: cct -> cgt; 2
Feature aa; 5
Feature /rnalink: 3
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> N
Feature /domain: FADBR
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 304
Feature /change: P -> R
Feature /domain: FADBR
Ethnic origin Caucasoid; France
Family history Inherited
Relative CYBBbase; A0538 cousin
//
ID T302P(1); standard; MUTATION; FADBR
Accession A1088
Systematic name g.24820A>C, c.904A>C, r.904a>c, p.Thr302Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24820
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 918
Feature /codon: act -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 302
Feature /change: T -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #T302X311(1); standard; MUTATION; FADBR
Accession A1089
Systematic name g.24822_24825delTCAC, c.906_909delTCAC, r.906_909delucac,
Systematic name p.His303fsX9
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24822..24825
Feature /change: -tcac
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 920..923
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 302..303
Feature /change: TH -> TLSKPSSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @T302X347(1); standard; MUTATION; FADBR
Accession A1087
Systematic name g.24819dupC, c.903dupC, r.903dupc, p.Thr302fsX46
Description A frame shift duplication mutation in the exon 9 leading to
Description a premature stop codon in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 24820
Feature /change: +c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 918
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 302
Feature /change: T ->
Feature /change: HSPFQNHRAT DEEEGVQNGS GTIHFCQVPK GVQAGVAPFY
Feature /change: TDIRPX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H303Q(1a); standard; MUTATION; FADBR
Accession A1091
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1092
Relative CYBBbase; A1093
Relative CYBBbase; A1094
Relative CYBBbase; A1095
Relative CYBBbase; A1096
Relative CYBBbase; A1097
//
ID H303Q(1b); standard; MUTATION; FADBR
Accession A1092
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1093
Relative CYBBbase; A1094
Relative CYBBbase; A1095
Relative CYBBbase; A1096
Relative CYBBbase; A1097
//
ID H303Q(1c); standard; MUTATION; FADBR
Accession A1093
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1092
Relative CYBBbase; A1094
Relative CYBBbase; A1095
Relative CYBBbase; A1096
Relative CYBBbase; A1097
//
ID H303Q(1d); standard; MUTATION; FADBR
Accession A1094
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1092
Relative CYBBbase; A1093
Relative CYBBbase; A1095
Relative CYBBbase; A1096
Relative CYBBbase; A1097
//
ID H303Q(1e); standard; MUTATION; FADBR
Accession A1095
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1092
Relative CYBBbase; A1093
Relative CYBBbase; A1094
Relative CYBBbase; A1096
Relative CYBBbase; A1097
//
ID H303Q(1f); standard; MUTATION; FADBR
Accession A1096
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1092
Relative CYBBbase; A1093
Relative CYBBbase; A1094
Relative CYBBbase; A1095
Relative CYBBbase; A1097
//
ID H303Q(1g); standard; MUTATION; FADBR
Accession A1097
Systematic name g.24825C>A, c.909C>A, r.909c>a, p.His303Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24825
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 923
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1091
Relative CYBBbase; A1092
Relative CYBBbase; A1093
Relative CYBBbase; A1094
Relative CYBBbase; A1095
Relative CYBBbase; A1096
//
ID H303Y(1); standard; MUTATION; FADBR
Accession A1090
Systematic name g.24823C>T, c.907C>T, r.907c>u, p.His303Tyr
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24823
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 921
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 303
Feature /change: H -> Y
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P304H(1); standard; MUTATION; FADBR
Accession A1436
Systematic name g.24827C>A, c.911C>A, r.911c>a, p.Pro304His
Original code JMDR
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24827
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 925
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 304
Feature /change: P -> H
Feature /domain: FADBR
Protein level N.D.
Activity N.D.
Diagnosis Classical X-linked CGD
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier. ODR (brother) is
Relative CGD patient
//
ID P304L(1a); standard; MUTATION; FADBR
Accession A1098
Systematic name g.24827C>T, c.911C>T, r.911c>u, p.Pro304Leu
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24827
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 925
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 304
Feature /change: P -> L
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1099
//
ID P304L(1b); standard; MUTATION; FADBR
Accession A1099
Systematic name g.24827C>T, c.911C>T, r.911c>u, p.Pro304Leu
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24827
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 925
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 304
Feature /change: P -> L
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1098
//
ID #F305X312(1); standard; MUTATION; FADBR
Accession A0558
Systematic name g.24831delC, c.915delC, r.915delc, p.Phe305fsX8
Original code Patient 4
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15082894
RefAuthors Oh, H. B., Park, J. S., Lee, W., Yoo, S. J., Yang, J. H.,
RefAuthors Oh, S. Y.
RefTitle Molecular analysis of X-linked chronic granulomatous
RefTitle disease in five unrelated korean patients.
RefLoc J Korean Med Sci:218-222 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24831
Feature /change: -c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 929
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 305
Feature /change: F -> LKPSSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Symptoms Recurrent lymphadenitis, salmonellosis, intractable cough
Symptoms and rhinorrhea, pneumonia, hepatitis, acute renal failure
Sex XY
Ethnic origin Mongoloid; Korea
Comment Patient died of septic shock
//
ID K306X(1); standard; MUTATION; FADBR
Accession A0290
Systematic name g.24832A>T, c.916A>T, r.916a>u, p.Lys306X
Original code VIII-34 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24832
Feature /change: a -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 930
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 306
Feature /change: K -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID T307P(1); standard; MUTATION; FADBR
Accession A0469
Systematic name g.24835A>C, c.919A>C, r.919a>c, p.Thr307Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24835
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 933
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 307
Feature /change: T -> P
Feature /domain: FADBR
Sex XY
//
ID T307P(2); standard; MUTATION; FADBR
Accession A0590
Systematic name g.24835A>C, c.919A>C, r.919a>c, p.Thr307Pro
Original code 12. T.P.
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24835
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 933
Feature /codon: acc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 307
Feature /change: T -> P
Feature /domain: FADBR
Phenotype X91 ?
Diagnosis Classical X-linked CGD
Symptoms Recurrent lymphadenitis
Family history Not known
//
ID #T307X312(1); standard; MUTATION; FADBR
Accession A0221
Systematic name g.24835delA, c.919delA, r.919dela, p.Thr307fsX6
Original code IV-34 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24835
Feature /change: -a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 933
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 307
Feature /change: T -> PSSYRX
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
Comment Mother and sisters normal
//
ID @I308X315/M312-1(1); standard; MUTATION; FADBR
Accession A1100
Systematic name g.[24838_24839insTCCTTTCA;24851_24853delTGA],
Systematic name c.[922_923insTCCTTTCA;935_937delTGA],
Systematic name r.[922_923insuccuuuca;935_937deluga],
Systematic name p.[Glu309fsX7;Met312del]
Description A frame shift insertion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain and an inframe
Description deletion in the exon 9 leading to an aminoacid change in
Description FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 3
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 24839
Feature /change: +tcctttca
Feature /genomic_region: exon; 9
Feature dna; 2
Feature /rnalink: 4
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24851..24853
Feature /change: -tga
Feature /genomic_region: exon; 9
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 937
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 949..951
Feature aa; 5
Feature /rnalink: 3
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 308
Feature /change: I -> ILSSSYRX
Feature /domain: FADBR
Feature aa; 6
Feature /rnalink: 4
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 312..313
Feature /change: MK -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @I308X314(1); standard; MUTATION; FADBR
Accession A1101
Systematic name g.24838_24839insGTTTC, c.922_923insGTTTC,
Systematic name r.922_923insguuuc, p.Ile308fsX7
Description A frame shift insertion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 24839
Feature /change: +gtttc
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 937
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 308
Feature /change: I -> SFSSYRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID E309K(1a); standard; MUTATION; FADBR
Accession A0101
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Original code VII-18 ref [1];IV-14 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [3]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased (17)
Heme level Normal
Oxidase act. Decreased (4)
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0102 cousin
//
ID E309K(1b); standard; MUTATION; FADBR
Accession A0102
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Original code VII-18 ref [1];IV-14 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [3]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased
Heme level Normal
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0101 cousin
//
ID E309K(2a); standard; MUTATION; FADBR
Accession A0368
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 0
Heme level Normal
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0369 brother
//
ID E309K(2b); standard; MUTATION; FADBR
Accession A0369
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0368 brother
//
ID E309K(3); standard; MUTATION; FADBR
Accession A0370
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 ?
Heme level Normal
Sex XY
Family history Inherited, mother is carrier
//
ID E309K(4); standard; MUTATION; FADBR
Accession A0371
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 -
Heme level Normal
Sex XY
Family history Inherited, mother is carrier
//
ID E309K(5); standard; MUTATION; FADBR
Accession A0372
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Original code 91-24 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10068684
RefAuthors Kaneda, M., Sakuraba, H., Ohtake, A., Nishida, A., Kiryu,
RefAuthors C., Kakinuma, K.
RefTitle Missense mutations in the gp91-phox gene encoding
RefTitle cytochrome b558 in patients with cytochrome b positive and
RefTitle negative X-linked chronic granulomatous disease.
RefLoc Blood 93:2098-2104 (1999)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Phenotype X91 -
Heme level Normal
//
ID E309K(6a); standard; MUTATION; FADBR
Accession A1102
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1103
//
ID E309K(6b); standard; MUTATION; FADBR
Accession A1103
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1102
//
ID E309K(7a); standard; MUTATION; FADBR
Accession A1104
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1105
//
ID E309K(7b); standard; MUTATION; FADBR
Accession A1105
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1104
//
ID E309K(8a); standard; MUTATION; FADBR
Accession A1106
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1107
//
ID E309K(8b); standard; MUTATION; FADBR
Accession A1107
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1106
//
ID E309K(9); standard; MUTATION; FADBR
Accession A1108
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID E309K(10); standard; MUTATION; FADBR
Accession A1437
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Original code JMDR
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Protein level N.D.
Activity N.D.
Diagnosis Classical X-linked CGD
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Comment Mother carrier. ODR(brother) is CGD patient
//
ID E309K(11); standard; MUTATION; FADBR
Accession A1438
Systematic name g.24841G>A, c.925G>A, r.925g>a, p.Glu309Lys
Original code ODR
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> a
Feature /CpG; 2
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> aag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> K
Feature /domain: FADBR
Protein level N.D.
Activity N.D.
Diagnosis Classical X-linked CGD
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Comment Mother carrier. JMDR(brother) is CGD patient
//
ID E309X(1a); standard; MUTATION; FADBR
Accession A1109
Systematic name g.24841G>T, c.925G>T, r.925g>u, p.Glu309X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1110
//
ID E309X(1b); standard; MUTATION; FADBR
Accession A1110
Systematic name g.24841G>T, c.925G>T, r.925g>u, p.Glu309X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24841
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 939
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 309
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1109
//
ID L310P(1); standard; MUTATION; FADBR
Accession A1111
Systematic name g.24845T>C, c.929T>C, r.929u>c, p.Leu310Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24845
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 943
Feature /codon: cta -> cca; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 310
Feature /change: L -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #Q311X312(1); standard; MUTATION; FADBR
Accession A1112
Systematic name g.24847delC, c.931delC, r.931delc, p.Gln311fsX2
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24847
Feature /change: -c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 945
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 311
Feature /change: Q -> RX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID M312K(1); standard; MUTATION; FADBR
Accession A0629
Systematic name g.24851T>A, c.935T>A, r.935u>a, p.Met312Lys
Original code P5
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24851
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 949
Feature /codon: atg -> aag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 312
Feature /change: M -> K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Symptoms Lung abscess, perianal abscess, lymphadenitis.
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID M312R(1); standard; MUTATION; FADBR
Accession A0253
Systematic name g.24851T>G, c.935T>G, r.935u>g, p.Met312Arg
Original code VII-19 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24851
Feature /change: t -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 949
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 312
Feature /change: M -> R
Feature /domain: FADBR
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother is carrier
Comment Grandmother normal
//
ID M312R(2); standard; MUTATION; FADBR
Accession A1113
Systematic name g.24851T>G, c.935T>G, r.935u>g, p.Met312Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24851
Feature /change: t -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 949
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 312
Feature /change: M -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #K315-1(1); standard; MUTATION; FADBR
Accession A0163
Systematic name g.24859_24861delAAG, c.943_945delAAG, r.943_945delaag,
Systematic name p.Lys315del
Original code IV-21 ref [2];I-15 ref [3]
Description An inframe deletion in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8500277
RefAuthors Curnutte, J. T.
RefTitle Chronic granulomatous disease: the solving of a clinical
RefTitle riddle at the molecular level.
RefLoc Clin Immunol Immunopathol 67:S2-15 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24859..24861
Feature /change: -aag
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 957..959
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 315
Feature /change: -K
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XX?
//
ID #K315-1(2a); standard; MUTATION; FADBR
Accession A0208
Systematic name g.24859_24861delAAG, c.943_945delAAG, r.943_945delaag,
Systematic name p.Lys315del
Original code pat.1 ref [1];D.L ref [2];IV-22 ref [3]
Description An inframe deletion in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7918677
RefAuthors Thrasher, A. J., Keep, N. H., Wientjes, F., Segal, A. W.
RefTitle Chronic granulomatous disease.
RefLoc Biochim Biophys Acta 1227:1-24 (1994)
RefNumber [2]
RefCrossRef PUBMED; 7579466
RefAuthors Bu-Ghanim, H. N., Segal, A. W., Keep, N. H., Casimir, C.
RefAuthors M.
RefTitle Molecular analysis in three cases of X91- variant chronic
RefTitle granulomatous disease.
RefLoc Blood 86:3575-3582 (1995)
RefNumber [3]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24859..24861
Feature /change: -aag
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 957..959
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 315
Feature /change: -K
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
NBT-slide 80% weak
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0209 brother
//
ID #K315-1(2b); standard; MUTATION; FADBR
Accession A0209
Systematic name g.24859_24861delAAG, c.943_945delAAG, r.943_945delaag,
Systematic name p.Lys315del
Original code pat.1 ref [1];D.L ref [2];IV-22 ref [3]
Description An inframe deletion in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7918677
RefAuthors Thrasher, A. J., Keep, N. H., Wientjes, F., Segal, A. W.
RefTitle Chronic granulomatous disease.
RefLoc Biochim Biophys Acta 1227:1-24 (1994)
RefNumber [2]
RefCrossRef PUBMED; 7579466
RefAuthors Bu-Ghanim, H. N., Segal, A. W., Keep, N. H., Casimir, C.
RefAuthors M.
RefTitle Molecular analysis in three cases of X91- variant chronic
RefTitle granulomatous disease.
RefLoc Blood 86:3575-3582 (1995)
RefNumber [3]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24859..24861
Feature /change: -aag
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 957..959
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 315
Feature /change: -K
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased
NBT-slide 92% weak
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A0208 brother
//
ID #K315-1(3); standard; MUTATION; FADBR
Accession A1114
Systematic name g.24859_24861delAAG, c.943_945delAAG, r.943_945delaag,
Systematic name p.Lys315del
Description An inframe deletion in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24859..24861
Feature /change: -aag
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 957..959
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 315
Feature /change: -K
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #G316X342(1); standard; MUTATION; FADBR
Accession A0222
Systematic name g.24864delG, c.948delG, r.948delg, p.Phe317fsX26
Original code 3. M.H. ref.[2]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24864
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 962
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 316
Feature /change: G -> GSKWKWDNTF LSSAQRCPSW SGTLLHX
Feature /domain: FADBR
Phenotype X91 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (French)
//
ID E320X(1); standard; MUTATION; FADBR
Accession A0569
Systematic name g.24874G>T, c.958G>T, r.958g>u, p.Glu320X
Original code P6
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24874
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 972
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 320
Feature /change: E -> X
Feature /domain: FADBR
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Undocumented persisting sepsis, cervical tumefaction,
Symptoms cervical abscess to Serratia marcescens
Sex XY
Family history Inherited
//
ID #E320X342(1); standard; MUTATION; FADBR
Accession A0306
Systematic name g.24876delA, c.960delA, r.960dela, p.Val321fsX22
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24876
Feature /change: -a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 974
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 320
Feature /change: E -> EWDNTFLSSA QRCPSWSGTL LHX
Feature /domain: FADBR
Phenotype X91 0
//
ID #E320X342(2); standard; MUTATION; FADBR
Accession A1115
Systematic name g.24874delG, c.958delG, r.958delg, p.Glu320fsX23
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24874
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 972
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 320
Feature /change: E -> KWDNTFLSSA QRCPSWSGTL LHX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #E320X342/V321G(1); standard; MUTATION; FADBR
Accession A1116
Systematic name g.[24874delG;24878T>G], c.[958delG;962T>G],
Systematic name r.[958delg;962u>g], p.[Glu320fsX23;Val321Gly]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain and a point
Description mutation in the exon 9 leading to an amino acid change
Description in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 3
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24874
Feature /change: -g
Feature /genomic_region: exon; 9
Feature dna; 2
Feature /rnalink: 4
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24878
Feature /change: t -> g
Feature /genomic_region: exon; 9
Feature rna; 3
Feature /dnalink: 1
Feature /aalink: 5
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 972
Feature rna; 4
Feature /dnalink: 2
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 976
Feature /codon: gtg -> ggg; 2
Feature aa; 5
Feature /rnalink: 3
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 320
Feature /change: E -> KWDNTFLSSA QRCPSWSGTL LHX
Feature /domain: FADBR
Feature aa; 6
Feature /rnalink: 4
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 321
Feature /change: V -> G
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G322E(1); standard; MUTATION; FADBR
Accession A0377
Systematic name g.24881G>A, c.965G>A, r.965g>a, p.Gly322Glu
Original code IV-15 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24881
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 979
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 322
Feature /change: G -> E
Feature /domain: FADBR
Phenotype X91 -
//
ID G322E(2); standard; MUTATION; FADBR
Accession A1117
Systematic name g.24881G>A, c.965G>A, r.965g>a, p.Gly322Glu
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24881
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 979
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 322
Feature /change: G -> E
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #G322X342(1); standard; MUTATION; FADBR
Accession A0118
Systematic name g.24881delG, c.965delG, r.965delg, p.Gly322fsX21
Original code II-20 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24881
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 979
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 322
Feature /change: G -> DNTFLSSAQR CPSWSGTLLH X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Q323X(1); standard; MUTATION; FADBR
Accession A0067
Systematic name g.24883C>T, c.967C>T, r.967c>u, p.Gln323X
Original code J3 ref [?];91-25 ref [2]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24883
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 981
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 323
Feature /change: Q -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
//
ID Y324X(1); standard; MUTATION; FADBR
Accession A1118
Systematic name g.24888C>A, c.972C>A, r.972c>a, p.Tyr324X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24888
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 986
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 324
Feature /change: Y -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID I325F(1); standard; MUTATION; FADBR
Accession A0401
Systematic name g.24889A>T, c.973A>T, r.973a>u, p.Ile325Phe
Original code IV-16 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24889
Feature /change: a -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 987
Feature /codon: att -> ttt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 325
Feature /change: I -> F
Feature /domain: FADBR
Phenotype X91 -
Protein level Decreased (5)
Oxidase act. 4
//
ID #V327X342(1); standard; MUTATION; FADBR
Accession A0584
Systematic name g.24895delG, c.979delG, r.979delg, p.Val327fsX16
Original code 4. D.P.
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24895
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 993
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 327
Feature /change: V -> SSAQRCPSWS GTLLHX
Feature /domain: FADBR
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Liver abscess, pyodermatitis, cervical lymphadenitis,
Symptoms perianal abscess, pulmonary granuloma
Age 3
Family history Inherited
//
ID #V327X345(1); standard; MUTATION; FADBR
Accession A1119
Systematic name g.24897_24901delCAAGT, c.981_985delCAAGT,
Systematic name r.981_985delcaagu, p.Lys328fsX18
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24897..24901
Feature /change: -caagt
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 995..999
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 327..329
Feature /change: VKC -> VPKGVQAGVA PFYTDIRPX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID C329R(1); standard; MUTATION; FADBR
Accession A1120
Systematic name g.24901T>C, c.985T>C, r.985u>c, p.Cys329Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24901
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 999
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 329
Feature /change: C -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #K331X342(1); standard; MUTATION; FADBR
Accession A1121
Systematic name g.24908_24913delinsGGGGG, c.992_997delinsGGGGG,
Systematic name r.992_997delinsggggg, p.Lys331fsX12
Description A frame shift indel mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 24908..24913
Feature /change: aggtgt -> ggggg
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1006..1011
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 331..332
Feature /change: KV -> RGPSWSGTLL HX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #V332X342(1); standard; MUTATION; FADBR
Accession A0571
Systematic name g.24910delG, c.994delG, r.994delg, p.Val332fsX11
Original code P8
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24910
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1008
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 332
Feature /change: V -> CPSWSGTLLH X
Feature /domain: FADBR
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Gastric enteritis to Salmonella enteritidis, Pulmonary
Symptoms granuloma
Sex XY
Family history Inherited
//
ID S333P(1); standard; MUTATION; FADBR
Accession A0200
Systematic name g.24913T>C, c.997T>C, r.997u>c, p.Ser333Pro
Original code IV-17 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24913
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1011
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 333
Feature /change: S -> P
Feature /domain: FADBR
Sex XY
Family history Inherited, mother carrier
//
ID S333S(1); standard; MUTATION; FADBR
Accession A1432
Systematic name g.24914C>C, c.998C>C, r.998c>c, p.Ser333Ser
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Mustafa Yavuz Köker; Department of Immunology, University
RefLoc of Erciyes; Tel +905053478838; Fax +903522249327; e-mail
RefLoc mykoker@erciyes.edu.tr
RefNumber [1]
RefCrossRef PUBMED; 23910690
RefAuthors Köker, M. Y., Camcıoğlu, Y., van Leeuwen, K., Kılıç, S.
RefAuthors Ş., Barlan, I., Yılmaz, M., Metin, A., de Boer, M.,
RefAuthors Avcılar, H., Patıroğlu, T., Yıldıran, A., Yeğin, O.,
RefAuthors Tezcan, I., Sanal, O., Roos, D.
RefTitle Clinical, functional, and genetic characterization of
RefTitle chronic granulomatous disease in 89 turkish patients.
RefLoc J Allergy Clin Immunol:1156-1163.e5 (2013)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24914
Feature /change: c -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1012
Feature /codon: tcc -> tcc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 333
Feature /change: S -> S
Feature /domain: FADBR
mRNA level Absent
Protein level Absent
Activity Inactive
Protein struct [His338Asp)
Diagnosis Classical X-linked CGD
Age 1
Sex xy
Ethnic origin Caucasoid
Family history Inherited
Relative Description of pedigree:carrier mother with %25 normal
Relative neutrophil
//
ID E336X(1a); standard; MUTATION; FADBR
Accession A0087
Systematic name g.24922G>T, c.1006G>T, r.1006g>u, p.Glu336X
Original code III-23 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24922
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1020
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 336
Feature /change: E -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Heme level Normal
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0088 brother
//
ID E336X(1b); standard; MUTATION; FADBR
Accession A0088
Systematic name g.24922G>T, c.1006G>T, r.1006g>u, p.Glu336X
Original code III-23 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24922
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1020
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 336
Feature /change: E -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Heme level Normal
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0087 brother
//
ID E336X(2); standard; MUTATION; FADBR
Accession A0291
Systematic name g.24922G>T, c.1006G>T, r.1006g>u, p.Glu336X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24922
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1020
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 336
Feature /change: E -> X
Feature /domain: FADBR
Phenotype X91 0
Heme level Normal
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID E336X(3); standard; MUTATION; FADBR
Accession A1122
Systematic name g.24922G>T, c.1006G>T, r.1006g>u, p.Glu336X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24922
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1020
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 336
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID E336X(4); standard; MUTATION; FADBR
Accession A1123
Systematic name g.24922G>T, c.1006G>T, r.1006g>u, p.Glu336X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24922
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1020
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 336
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W337X(1); standard; MUTATION; FADBR
Accession A0292
Systematic name g.24926G>A, c.1010G>A, r.1010g>a, p.Trp337X
Original code VIII-35 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24926
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1024
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
mRNA level 0
Phenotype X91 0
Sex XY
//
ID W337X(2); standard; MUTATION; FADBR
Accession A0535
Systematic name g.24926G>A, c.1010G>A, r.1010g>a, p.Trp337X
Original code AUS
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 12-Nov-2002 (Rel. 7, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Submitted (12-Nov-2002) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan., Servicio
RefLoc de Inmunologia-Edificio Anatomia Patologica-Hospital La
RefLoc Paz-Castellana 261-28046 Madrid-Espana, Tel 917277238, Fax
RefLoc 917277095, e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24926
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1024
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
mRNA level N.D.
Protein level Absent
Sex XY
Ethnic origin Caucasoid; Spain
Family history De novo
Relative Description of pedigree: Mother, Grandmother and Sister are
Relative healthies.
//
ID W337X(3); standard; MUTATION; FADBR
Accession A1124
Systematic name g.24926G>A, c.1010G>A, r.1010g>a, p.Trp337X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24926
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1024
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W337X(4); standard; MUTATION; FADBR
Accession A1125
Systematic name g.24927G>A, c.1011G>A, r.1011g>a, p.Trp337X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24927
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1025
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W337X(5); standard; MUTATION; FADBR
Accession A1126
Systematic name g.24927G>A, c.1011G>A, r.1011g>a, p.Trp337X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24927
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1025
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W337X(6); standard; MUTATION; FADBR
Accession A1127
Systematic name g.24927G>A, c.1011G>A, r.1011g>a, p.Trp337X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24927
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1025
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 337
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H338N(1); standard; MUTATION; FADBR
Accession A0396
Systematic name g.24928C>A, c.1012C>A, r.1012c>a, p.His338Asn
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> aac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> N
Feature /domain: FADBR
//
ID H338Q(1); standard; MUTATION; FADBR
Accession A1134
Systematic name g.24930C>A, c.1014C>A, r.1014c>a, p.His338Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24930
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1028
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H338Q(2); standard; MUTATION; FADBR
Accession A1135
Systematic name g.24930C>A, c.1014C>A, r.1014c>a, p.His338Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24930
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1028
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H338Q(3); standard; MUTATION; FADBR
Accession A1136
Systematic name g.24930C>A, c.1014C>A, r.1014c>a, p.His338Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24930
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1028
Feature /codon: cac -> caa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H338R(1a); standard; MUTATION; FADBR
Accession A1130
Systematic name g.24929A>G, c.1013A>G, r.1013a>g, p.His338Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24929
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1027
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1131
//
ID H338R(1b); standard; MUTATION; FADBR
Accession A1131
Systematic name g.24929A>G, c.1013A>G, r.1013a>g, p.His338Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24929
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1027
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1130
//
ID H338R(2a); standard; MUTATION; FADBR
Accession A1132
Systematic name g.24929A>G, c.1013A>G, r.1013a>g, p.His338Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24929
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1027
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1133
//
ID H338R(2b); standard; MUTATION; FADBR
Accession A1133
Systematic name g.24929A>G, c.1013A>G, r.1013a>g, p.His338Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24929
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1027
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1132
//
ID H338R(3); standard; MUTATION; FADBR
Accession A1420
Systematic name g.24929A>G, c.1013A>G, r.1013a>g, p.His338Arg
Original code ISU
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 20-Jun-2012 (Rel. 2, Created)
Date 20-Jun-2012 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (20-Jun-2012) to CYBBbase.
RefLoc Oscar de la Calle-Martin; Immunology, Hospital Sant Pau,
RefLoc Universitat Autonoma Barcelona, Spain; Tel +34 935537546;
RefLoc Fax +34 935537598; e-mail odlcalle@santpau.cat
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24929
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1027
Feature /codon: cac -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> R
Feature /domain: FADBR
mRNA level Normal
Protein level Normal
Activity Inactive
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
//
ID H338Y(1); standard; MUTATION; FADBR
Accession A0014
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Original code VII-20 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
//
ID H338Y(2); standard; MUTATION; FADBR
Accession A0084
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Original code VP3 ref [1];TG ref [?]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
Phenotype X91 +
Protein level 13-33% (7D5)
Heme level 20 %
Oxidase act. 0,18-0,6% (H2O2-prod.)
NBT-slide 5 %
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (German)
Family history Inherited, mother is carrier
//
ID H338Y(3); standard; MUTATION; FADBR
Accession A0254
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Original code VII-21 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 0
Protein level Strongly decreased
Sex XY
Ethnic origin Caucasian (Danish)
//
ID H338Y(4); standard; MUTATION; FADBR
Accession A0397
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Original code 91-26 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9774399
RefAuthors Yoshida, L. S., Saruta, F., Yoshikawa, K., Tatsuzawa, O.,
RefAuthors Tsunawaki, S.
RefTitle Mutation at histidine 338 of gp91(phox) depletes FAD and
RefTitle affects expression of cytochrome b558 of the human NADPH
RefTitle oxidase.
RefLoc J Biol Chem 273:27879-27886 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
Phenotype X91 -
//
ID H338Y(5); standard; MUTATION; FADBR
Accession A0398
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Original code pat.3 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11997079
RefAuthors Lin, S. J., Huang, Y. F., Chen, J. Y., Heyworth, P. G.,
RefAuthors Noack, D., Wang, J. Y., Lin, C. Y., Chiang, B. L., Yang,
RefAuthors C. M., Liu, C. C., Shieh, C. C.
RefTitle Molecular quality control machinery contributes to the
RefTitle leukocyte NADPH oxidase deficiency in chronic
RefTitle granulomatous disease.
RefLoc Biochim Biophys Acta:275-286 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 -
Sex XY
Family history Inherited, mother is carrier
//
ID H338Y(6); standard; MUTATION; FADBR
Accession A1128
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H338Y(7); standard; MUTATION; FADBR
Accession A1129
Systematic name g.24928C>T, c.1012C>T, r.1012c>u, p.His338Tyr
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24928
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1026
Feature /codon: cac -> tac; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 338
Feature /change: H -> Y
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339H(1); standard; MUTATION; FADBR
Accession A0070
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Original code VII-23 ref [2]; 91-27 ref [4]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7927345
RefAuthors Ariga, T., Sakiyama, Y., Matsumoto, S.
RefTitle Two novel point mutations in the cytochrome b 558 heavy
RefTitle chain gene, detected in two japanese patients with X-
RefTitle linked chronic granulomatous disease.
RefLoc Hum Genet 94:441 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [4]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID P339H(2); standard; MUTATION; FADBR
Accession A0096
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Original code IV-18 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Phenotype X91 +/-
Protein level Decreased (20)
Oxidase act. 0
Symptoms Classical GCD
Sex XY
Comment Uncle and greatuncle died young of infections, mother, grand- and greatgrandmother are carriers.
//
ID P339H(3); standard; MUTATION; FADBR
Accession A0416
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Sex XY
Family history Inherited, mother is carrier
Comment Aunt normal
//
ID P339H(4); standard; MUTATION; FADBR
Accession A0417
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Original code VP4 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Phenotype X91 +
Protein level 14-38% (7D5)
Oxidase act. 0% (H2O2-prod.)
Family history Inherited, mother is carrier
//
ID P339H(5a); standard; MUTATION; FADBR
Accession A1137
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1138
//
ID P339H(5b); standard; MUTATION; FADBR
Accession A1138
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1137
//
ID P339H(6a); standard; MUTATION; FADBR
Accession A1139
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1140
//
ID P339H(6b); standard; MUTATION; FADBR
Accession A1140
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1139
//
ID P339H(7); standard; MUTATION; FADBR
Accession A1141
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339H(8); standard; MUTATION; FADBR
Accession A1142
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339H(9); standard; MUTATION; FADBR
Accession A1143
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339H(10); standard; MUTATION; FADBR
Accession A1144
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339H(11); standard; MUTATION; FADBR
Accession A1145
Systematic name g.24932C>A, c.1016C>A, r.1016c>a, p.Pro339His
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> cat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> H
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P339L(1); standard; MUTATION; FADBR
Accession A1146
Systematic name g.24932C>T, c.1016C>T, r.1016c>u, p.Pro339Leu
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature /codon: cct -> ctt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> L
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #P339X342(1); standard; MUTATION; FADBR
Accession A0317
Systematic name g.24932delC, c.1016delC, r.1016delc, p.Pro339fsX4
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24932
Feature /change: -c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1030
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> LLHX
Feature /domain: FADBR
//
ID @P339X347(1a); standard; MUTATION; FADBR
Accession A0347
Systematic name g.24932dupC, c.1016dupC, r.1016dupc, p.Thr341fsX7
Description A frame shift duplication mutation in the exon 9 leading to
Description a premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
RefNumber [2]
RefCrossRef PUBMED; 16138344
RefAuthors Wolach, B., Ash, S., Gavrieli, R., Stark, B., Yaniv, I.,
RefAuthors Roos, D.
RefTitle Acute lymphoblastic leukemia in a patient with chronic
RefTitle granulomatous disease and a novel mutation in CYBB: first
RefTitle report.
RefLoc Am J Hematol:50-54 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 24933
Feature /change: +c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1031
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> PFYTDIRPX
Feature /domain: FADBR
Phenotype X91 0
Relative CYBBbase; A1147
Comment Mother is carrier
//
ID @P339X347(1b); standard; MUTATION; FADBR
Accession A1147
Systematic name g.24932dupC, c.1016dupC, r.1016dupc, p.Thr341fsX7
Description A frame shift duplication mutation in the exon 9 leading to
Description a premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 24933
Feature /change: +c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1031
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 339
Feature /change: P -> PFYTDIRPX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0347
//
ID T341I(1); standard; MUTATION; FADBR
Accession A0470
Systematic name g.24938C>T, c.1022C>T, r.1022c>u, p.Thr341Ile
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24938
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1036
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 341
Feature /change: T -> I
Feature /domain: FADBR
Phenotype Xq1 -
//
ID T341K(1); standard; MUTATION; FADBR
Accession A0255
Systematic name g.24938C>A, c.1022C>A, r.1022c>a, p.Thr341Lys
Original code JW ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10627478
RefAuthors Leusen, J. H., Meischl, C., Eppink, M. H., Hilarius, P.
RefAuthors M., de Boer, M., Weening, R. S., Ahlin, A., Sanders, L.,
RefAuthors Goldblatt, D., Skopczynska, H., Bernatowska, E., Palmblad,
RefAuthors J., Verhoeven, A. J., van Berkel, W. J., Roos, D.
RefTitle Four novel mutations in the gene encoding gp91-phox of
RefTitle human NADPH oxidase: consequences for oxidase assembly.
RefLoc Blood 95:666-673 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24938
Feature /change: c -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1036
Feature /codon: aca -> aaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 341
Feature /change: T -> K
Feature /domain: FADBR
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0.04
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Polish)
Family history Inherited, mother carrier
Comment "Father and brother are normal; aunt and niece are normal"
//
ID L342Q(1); standard; MUTATION; FADBR
Accession A0064
Systematic name g.24941T>A, c.1025T>A, r.1025u>a, p.Leu342Gln
Original code pat. 1 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
RefNumber [2]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24941
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1039
Feature /codon: ctg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 342
Feature /change: L -> Q
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 0
Protein level 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
Family history Inherited, mother is carrier
Comment Brother died at 14 y of TB meningitis
//
ID L342Q(2); standard; MUTATION; FADBR
Accession A0256
Systematic name g.24941T>A, c.1025T>A, r.1025u>a, p.Leu342Gln
Original code VII-24 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24941
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1039
Feature /codon: ctg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 342
Feature /change: L -> Q
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited, mother is carrier
//
ID L342Q(3); standard; MUTATION; FADBR
Accession A0404
Systematic name g.24941T>A, c.1025T>A, r.1025u>a, p.Leu342Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24941
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1039
Feature /codon: ctg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 342
Feature /change: L -> Q
Feature /domain: FADBR
Phenotype X91 0
Sex XY
//
ID L342Q(4); standard; MUTATION; FADBR
Accession A1148
Systematic name g.24941T>A, c.1025T>A, r.1025u>a, p.Leu342Gln
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24941
Feature /change: t -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1039
Feature /codon: ctg -> cag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 342
Feature /change: L -> Q
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID T343P(1); standard; MUTATION; FADBR
Accession A0471
Systematic name g.24943A>C, c.1041A>C, p.T343P
Description Point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 26-Jul-2002 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24943
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 1041
Feature /codon: aca -> cca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 343
Feature /change: T -> P
Feature /domain: FADBR
Sex XY
//
ID T343P(2); standard; MUTATION; FADBR
Accession A1149
Systematic name g.24943A>C, c.1027A>C, r.1027a>c, p.Thr343Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24943
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1041
Feature /codon: aca -> cca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 343
Feature /change: T -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID S344F(1); standard; MUTATION; FADBR
Accession A0467
Systematic name g.24947C>T, c.1031C>T, r.1031c>u, p.Ser344Phe
Original code 91-28 ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> F
Feature /domain: FADBR
Phenotype X91 0
//
ID S344F(2); standard; MUTATION; FADBR
Accession A0468
Systematic name g.24947C>T, c.1031C>T, r.1031c>u, p.Ser344Phe
Original code 91-29 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> F
Feature /domain: FADBR
Phenotype X91 0
//
ID S344F(3a); standard; MUTATION; FADBR
Accession A1154
Systematic name g.24947C>T, c.1031C>T, r.1031c>u, p.Ser344Phe
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> F
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1155
//
ID S344F(3b); standard; MUTATION; FADBR
Accession A1155
Systematic name g.24947C>T, c.1031C>T, r.1031c>u, p.Ser344Phe
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature /codon: tcc -> ttc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> F
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1154
//
ID S344P(1); standard; MUTATION; FADBR
Accession A1150
Systematic name g.24946T>C, c.1030T>C, r.1030u>c, p.Ser344Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24946
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1044
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID S344P(2); standard; MUTATION; FADBR
Accession A1151
Systematic name g.24946T>C, c.1030T>C, r.1030u>c, p.Ser344Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24946
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1044
Feature /codon: tcc -> ccc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 344
Feature /change: S -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #S344X385(1); standard; MUTATION; FADBR
Accession A0324
Systematic name g.24948delC, c.1032delC, r.1032delc, p.Ala345fsX41
Description Deletion in the exon 9 leading to a premature stop codon
Description in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24948
Feature /change: -c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1046
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 344
Feature /change: S ->
Feature /change: SPLRKTSLVS ISASLGTGQR GCSMLVAVIS RSFKMRGNYL RX
Feature /domain: FADBR
Phenotype X91 0
Sex XY
//
ID #S344X385(2); standard; MUTATION; FADBR
Accession A0325
Systematic name g.24948delC, c.1032delC, r.1032delc, p.Ala345fsX41
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24948
Feature /change: -c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1046
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 344
Feature /change: S ->
Feature /change: SPLRKTSLVS ISASLGTGQR GCSMLVAVIS RSFKMRGNYL RX
Feature /domain: FADBR
Phenotype X91 0
//
ID @S344X386(1a); standard; MUTATION; FADBR
Accession A1152
Systematic name g.24946_24947insCT, c.1030_1031insCT, r.1030_1031inscu,
Systematic name p.Ala345fsX42
Description A frame shift insertion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: +ct
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 344
Feature /change: S ->
Feature /change: SPPLRKTSLV SISASLGTGQ RGCSMLVAVI SRSFKMRGNY LRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1153
//
ID @S344X386(1b); standard; MUTATION; FADBR
Accession A1153
Systematic name g.24946_24947insCT, c.1030_1031insCT, r.1030_1031inscu,
Systematic name p.Ala345fsX42
Description A frame shift insertion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 24947
Feature /change: +ct
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1045
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 344
Feature /change: S ->
Feature /change: SPPLRKTSLV SISASLGTGQ RGCSMLVAVI SRSFKMRGNY LRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1152
//
ID #P346X385(1a); standard; MUTATION; FADBR
Accession A0129
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Original code II-21 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0130 brother
//
ID #P346X385(1b); standard; MUTATION; FADBR
Accession A0130
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Original code II-21 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0129 brother
//
ID #P346X385(2); standard; MUTATION; FADBR
Accession A0161
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Original code II-22 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Oxidase act. 0
Sex XY
//
ID #P346X385(3); standard; MUTATION; FADBR
Accession A0318
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Sex XY
Family history Inherited, mother is carrier
//
ID #P346X385(4); standard; MUTATION; FADBR
Accession A1156
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #P346X385(5); standard; MUTATION; FADBR
Accession A1157
Systematic name g.24954delT, c.1038delT, r.1038delu, p.Glu347fsX39
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24954
Feature /change: -t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1052
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 346
Feature /change: P -> PRKTSLVSIS ASLGTGQRGC SMLVAVISRS FKMRGNYLRX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H354P(1); standard; MUTATION; FADBR
Accession A1158
Systematic name g.24977A>C, c.1061A>C, r.1061a>c, p.His354Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24977
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1075
Feature /codon: cat -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 354
Feature /change: H -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H354P(2); standard; MUTATION; FADBR
Accession A1159
Systematic name g.24977A>C, c.1061A>C, r.1061a>c, p.His354Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24977
Feature /change: a -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1075
Feature /codon: cat -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 354
Feature /change: H -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID H354R(1a); standard; MUTATION; FADBR
Accession A0399
Systematic name g.24977A>G, c.1061A>G, r.1061a>g, p.His354Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24977
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1075
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 354
Feature /change: H -> R
Feature /domain: FADBR
Phenotype X91 -
Sex XY
Relative CYBBbase; A0400
Comment Mother and aunt are carriers, sister is not.
//
ID H354R(1b); standard; MUTATION; FADBR
Accession A0400
Systematic name g.24977A>G, c.1061A>G, r.1061a>g, p.His354Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24977
Feature /change: a -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1075
Feature /codon: cat -> cgt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 354
Feature /change: H -> R
Feature /domain: FADBR
Phenotype X91 -
Sex XY
Relative CYBBbase; A0399
//
ID #H354X382(1); standard; MUTATION; FADBR
Accession A0207
Systematic name g.24978_24987delTATCCGCATC, c.1062_1071delTATCCGCATC,
Systematic name r.1062_1071deluauccgcauc, p.His354fsX29
Original code IV-18 ref [1]
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24978..24987
Feature /change: -tatccgcatc
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1076..1085
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 354..357
Feature /change: HIRI -> QLGTGQRGCS MLVAVISRSF KMRGNYLRX
Feature /domain: FADBR
Phenotype X91 0
Sex XY
//
ID #I355X369(1); standard; MUTATION; FADBR
Accession A1161
Systematic name g.24979_24986delATCCGCAT, c.1063_1070delATCCGCAT,
Systematic name r.1063_1070delauccgcau, p.Ile355fsX15
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24979..24986
Feature /change: -atccgcat
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1077..1084
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 355..357
Feature /change: IRI -> RWGLDRGAVQ CLWLX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #I355X385(1); standard; MUTATION; FADBR
Accession A1160
Systematic name g.24979delA, c.1063delA, r.1063dela, p.Ile355fsX31
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 24979
Feature /change: -a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1077
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 355
Feature /change: I -> SASLGTGQRG CSMLVAVISR SFKMRGNYLR X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID R356P(1); standard; MUTATION; FADBR
Accession A0454
Systematic name g.24983G>C, c.1067G>C, r.1067g>c, p.Arg356Pro
Original code IV-19 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24983
Feature /change: g -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1081
Feature /codon: cgc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 356
Feature /change: R -> P
Feature /domain: FADBR
//
ID G359A(1); standard; MUTATION; FADBR
Accession A0611
Systematic name g.24992G>C, c.1076G>C, r.1076g>c, p.Gly359Ala
Original code PiMa
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24992
Feature /change: g -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1090
Feature /codon: ggg -> gcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> A
Feature /domain: FADBR
mRNA level N.D.
Protein level Reduced
Activity Reduced
Diagnosis Classical X-linked CGD
Symptoms lung abscess
Age 1
Sex XY
Ethnic origin Caucasoid; Italy
Family history De novo
Relative Description of pedigree:mother not carrier
//
ID G359R(1a); standard; MUTATION; FADBR
Accession A0056
Systematic name g.24991G>A, c.1075G>A, r.1075g>a, p.Gly359Arg
Original code VII-25 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24991
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1089
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> R
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
Relative CYBBbase; A0378
//
ID G359R(1b); standard; MUTATION; FADBR
Accession A0378
Systematic name g.24991G>A, c.1075G>A, r.1075g>a, p.Gly359Arg
Original code VII-25 ref [1]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24991
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1089
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> R
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Relative CYBBbase; A0056
//
ID G359R(2); standard; MUTATION; FADBR
Accession A1162
Systematic name g.24991G>A, c.1075G>A, r.1075g>a, p.Gly359Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24991
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1089
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G359R(3); standard; MUTATION; FADBR
Accession A1163
Systematic name g.24991G>A, c.1075G>A, r.1075g>a, p.Gly359Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24991
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1089
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G359V(1); standard; MUTATION; FADBR
Accession A0379
Systematic name g.24992G>T, c.1076G>T, r.1076g>u, p.Gly359Val
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24992
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1090
Feature /codon: ggg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 359
Feature /change: G -> V
Feature /domain: FADBR
//
ID W361R(1); standard; MUTATION; FADBR
Accession A1164
Systematic name g.24997T>C, c.1081T>C, r.1081u>c, p.Trp361Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24997
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1095
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W361R(2); standard; MUTATION; FADBR
Accession A1165
Systematic name g.24997T>C, c.1081T>C, r.1081u>c, p.Trp361Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24997
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1095
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W361R(3); standard; MUTATION; FADBR
Accession A1166
Systematic name g.24997T>C, c.1081T>C, r.1081u>c, p.Trp361Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24997
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1095
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W361X(1); standard; MUTATION; FADBR
Accession A0484
Systematic name g.24999G>A, c.1083G>A, r.1083g>a, p.Trp361X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24999
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1097
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> X
Feature /domain: FADBR
Sex XY
Family history Inherited, mother carrier
Comment " + polymorfism G1002A (Lys334Lys); aunt and grandmother are carriers; greatgrandmother and -father are normal."
//
ID W361X(2); standard; MUTATION; FADBR
Accession A1167
Systematic name g.24998G>A, c.1082G>A, r.1082g>a, p.Trp361X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24998
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1096
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W361X(3); standard; MUTATION; FADBR
Accession A1168
Systematic name g.24999G>A, c.1083G>A, r.1083g>a, p.Trp361X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24999
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1097
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W361X(4); standard; MUTATION; FADBR
Accession A1169
Systematic name g.24999G>A, c.1083G>A, r.1083g>a, p.Trp361X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24999
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1097
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 361
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID T362I(1a); standard; MUTATION; FADBR
Accession A1170
Systematic name g.25001C>T, c.1085C>T, r.1085c>u, p.Thr362Ile
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25001
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1099
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 362
Feature /change: T -> I
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1171
//
ID T362I(1b); standard; MUTATION; FADBR
Accession A1171
Systematic name g.25001C>T, c.1085C>T, r.1085c>u, p.Thr362Ile
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25001
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1099
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 362
Feature /change: T -> I
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1170
//
ID T362I(2); standard; MUTATION; FADBR
Accession A1172
Systematic name g.25001C>T, c.1085C>T, r.1085c>u, p.Thr362Ile
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25001
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1099
Feature /codon: aca -> ata; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 362
Feature /change: T -> I
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID T362R(1); standard; MUTATION; FADBR
Accession A1173
Systematic name g.25001C>G, c.1085C>G, r.1085c>g, p.Thr362Arg
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25001
Feature /change: c -> g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1099
Feature /codon: aca -> aga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 362
Feature /change: T -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID L365P(1); standard; MUTATION; FADBR
Accession A0405
Systematic name g.25010T>C, c.1094T>C, r.1094u>c, p.Leu365Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25010
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1108
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 365
Feature /change: L -> P
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID L365P(2); standard; MUTATION; FADBR
Accession A1174
Systematic name g.25010T>C, c.1094T>C, r.1094u>c, p.Leu365Pro
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25010
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1108
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 365
Feature /change: L -> P
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #L365X385(1); standard; MUTATION; FADBR
Accession A1176
Systematic name g.25011delG, c.1095delG, r.1095delg, p.Phe366fsX20
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25011
Feature /change: -g
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1109
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 365
Feature /change: L -> LSMLVAVISR SFKMRGNYLR X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @L365X372(1); standard; MUTATION; FADBR
Accession A1175
Systematic name g.25010dupT, c.1094dupT, r.1094dupu, p.Phe366fsX7
Description A frame shift duplication mutation in the exon 9 leading to
Description a premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 25011
Feature /change: +t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1109
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 365
Feature /change: L -> LVQCLWLX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID C369R(1); standard; MUTATION; FADBR
Accession A0257
Systematic name g.25021T>C, c.1105T>C, r.1105u>c, p.Cys369Arg
Original code VII-26(F) ref [1];CE ref [2]
Description A point mutation in the exon 9 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10627478
RefAuthors Leusen, J. H., Meischl, C., Eppink, M. H., Hilarius, P.
RefAuthors M., de Boer, M., Weening, R. S., Ahlin, A., Sanders, L.,
RefAuthors Goldblatt, D., Skopczynska, H., Bernatowska, E., Palmblad,
RefAuthors J., Verhoeven, A. J., van Berkel, W. J., Roos, D.
RefTitle Four novel mutations in the gene encoding gp91-phox of
RefTitle human NADPH oxidase: consequences for oxidase assembly.
RefLoc Blood 95:666-673 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25021
Feature /change: t -> c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1119
Feature /codon: tgt -> cgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 369
Feature /change: C -> R
Feature /domain: FADBR
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 1.35
NBT-slide 4 %
Sex XX
Comment extremely lyonised carrier; other allele normal;
Comment mother not carrier, father not investigated.
//
ID Q374X(1); standard; MUTATION; FADBR
Accession A1177
Systematic name g.25036C>T, c.1120C>T, r.1120c>u, p.Gln374X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25036
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1134
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 374
Feature /change: Q -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Q374X(2); standard; MUTATION; FADBR
Accession A1178
Systematic name g.25036C>T, c.1120C>T, r.1120c>u, p.Gln374X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25036
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1134
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 374
Feature /change: Q -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID E375X(1); standard; MUTATION; FADBR
Accession A0610
Systematic name g.25039G>T, c.1123G>T, r.1123g>u, p.Glu375X
Original code SpMa
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 05-Mar-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25039
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1137
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 375
Feature /change: E -> X
Feature /domain: FADBR
mRNA level Absent
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms liver abscess, pneumonia
Age 2
Sex XY
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative Description of pedigree:mother carrier
//
ID E375X(2); standard; MUTATION; FADBR
Accession A1179
Systematic name g.25039G>T, c.1123G>T, r.1123g>u, p.Glu375X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25039
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1137
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 375
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID E375X(3); standard; MUTATION; FADBR
Accession A1180
Systematic name g.25039G>T, c.1123G>T, r.1123g>u, p.Glu375X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25039
Feature /change: g -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1137
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 375
Feature /change: E -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Q377X(1); standard; MUTATION; FADBR
Accession A0293
Systematic name g.25045C>T, c.1129C>T, r.1129c>u, p.Gln377X
Original code VIII-36 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25045
Feature /change: c -> t
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1143
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 377
Feature /change: Q -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID @A379X384(1); standard; MUTATION; FADBR
Accession A1181
Systematic name g.25052dupC, c.1136dupC, r.1136dupc, p.Trp380fsX5
Description A frame shift duplication mutation in the exon 9 leading to
Description a premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 25053
Feature /change: +c
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1151
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 379
Feature /change: A -> AVETTX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W380X(1); standard; MUTATION; FADBR
Accession A0086
Systematic name g.25055G>A, c.1139G>A, r.1139g>a, p.Trp380X
Original code III-24 ref [2]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25055
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1153
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID W380X(2); standard; MUTATION; FADBR
Accession A0174
Systematic name g.25055G>A, c.1139G>A, r.1139g>a, p.Trp380X
Original code III-25 ref [1]
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25055
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1153
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Phenotype X91 -
Protein level 0
Oxidase act. 0
Symptoms Mild CGD?
Sex XY
//
ID W380X(3); standard; MUTATION; FADBR
Accession A1182
Systematic name g.25055G>A, c.1139G>A, r.1139g>a, p.Trp380X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25055
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1153
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W380X(4); standard; MUTATION; FADBR
Accession A1183
Systematic name g.25056G>A, c.1140G>A, r.1140g>a, p.Trp380X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25056
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1154
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W380X(5); standard; MUTATION; FADBR
Accession A1184
Systematic name g.25056G>A, c.1140G>A, r.1140g>a, p.Trp380X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25056
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1154
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID W380X(6); standard; MUTATION; FADBR
Accession A1185
Systematic name g.25056G>A, c.1140G>A, r.1140g>a, p.Trp380X
Description A point mutation in the exon 9 leading to a premature stop
Description codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25056
Feature /change: g -> a
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1154
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 380
Feature /change: W -> X
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @L382X385(1); standard; MUTATION; FADBR
Accession A1186
Systematic name g.25060_25061insAGGT, c.1144_1145insAGGT,
Systematic name r.1144_1145insaggu, p.Leu382fsX4
Description A frame shift insertion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 25061
Feature /change: +aggt
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1159
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 382
Feature /change: L -> QVTX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #P383X384(1); standard; MUTATION; FADBR
Accession A0315
Systematic name g.25063_25066delCCTA, c.1147_1150delCCTA,
Systematic name r.1147_1150delccua, p.Pro383fsX2
Description A frame shift deletion mutation in the exon 9 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25063..25066
Feature /change: -ccta
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1161..1164
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 383..384
Feature /change: PK -> RX
Feature /domain: FADBR
Phenotype X 91 ?
Sex XY
Comment mother normal
//
ID I385R(1); standard; MUTATION; FADBR
Accession A1202
Systematic name g.25945T>G, c.1154T>G, r.1154u>g, p.Ile385Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25945
Feature /change: t -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1168
Feature /codon: ata -> aga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 385
Feature /change: I -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #D388X404(1); standard; MUTATION; FADBR
Accession A1203
Systematic name g.25954delA, c.1163delA, r.1163dela, p.Asp388fsX17
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25954
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1177
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 388
Feature /change: D -> VGPLALPVKM CSAMRWX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G389A(1); standard; MUTATION; FADBR
Accession A0004
Systematic name g.25957G>C, c.1166G>C, r.1166g>c, p.Gly389Ala
Original code VII-27 ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1710153
RefAuthors Bolscher, B. G., de Boer, M., de Klein, A., Weening, R.
RefAuthors S., Roos, D.
RefTitle Point mutations in the beta-subunit of cytochrome b558
RefTitle leading to X-linked chronic granulomatous disease.
RefLoc Blood 77:2482-2487 (1991)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25957
Feature /change: g -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1180
Feature /codon: ggg -> gcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> A
Feature /domain: FADBR
mRNA level Normal
Phenotype X91 -
Protein level Reduced, low Mr
Heme level Strongly reduced
Oxidase act. Strongly reduced
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
//
ID G389E(1); standard; MUTATION; FADBR
Accession A0380
Systematic name g.25957G>A, c.1166G>A, r.1166g>a, p.Gly389Glu
Original code 91-30 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25957
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1180
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> E
Feature /domain: FADBR
Phenotype X91 0
//
ID G389E(2); standard; MUTATION; FADBR
Accession A1205
Systematic name g.25957G>A, c.1166G>A, r.1166g>a, p.Gly389Glu
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25957
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1180
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> E
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G389R(1); standard; MUTATION; FADBR
Accession A1204
Systematic name g.25956G>A, c.1165G>A, r.1165g>a, p.Gly389Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25956
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1179
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> R
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID G389V(1); standard; MUTATION; FADBR
Accession A1206
Systematic name g.25957G>T, c.1166G>T, r.1166g>u, p.Gly389Val
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25957
Feature /change: g -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1180
Feature /codon: ggg -> gtg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> V
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #G389X404(1); standard; MUTATION; FADBR
Accession A1208
Systematic name g.25958delG, c.1167delG, r.1167delg, p.Phe391fsX14
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25958
Feature /change: -g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1181
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 389
Feature /change: G -> GPLALPVKMC SAMRWX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @G389+1(1); standard; MUTATION; FADBR
Accession A1207
Systematic name g.25957_25961delinsTGTTCAGC, c.1166_1170delinsTGTTCAGC,
Systematic name r.1166_1170delinsuguucagc, p.Asp388_Gly389insValPheSer
Description An indel mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 25957..25961
Feature /change: ggccc -> tgttcagc
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1180..1184
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 389..390
Feature /change: GP -> VFS
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID P390L(1a); standard; MUTATION; FADBR
Accession A0258
Systematic name g.25960C>T, c.1169C>T, r.1169c>u, p.Pro390Leu
Original code VII-28 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25960
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1183
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 390
Feature /change: P -> L
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Sex XY
Relative CYBBbase; A0418 brother
Comment Mother not carrier but brother with CGD, so mother germ-line carrier
//
ID P390L(1b); standard; MUTATION; FADBR
Accession A0418
Systematic name g.25960C>T, c.1169C>T, r.1169c>u, p.Pro390Leu
Original code VII-28 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25960
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1183
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 390
Feature /change: P -> L
Feature /domain: FADBR
Phenotype X91 0
Sex XY
Relative CYBBbase; A0258 brother
Comment Mother not carrier but brother with CGD, so mother germ-line carrier
//
ID P390L(2); standard; MUTATION; FADBR
Accession A1209
Systematic name g.25960C>T, c.1169C>T, r.1169c>u, p.Pro390Leu
Description A point mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25960
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1183
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 390
Feature /change: P -> L
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #T393X404(1); standard; MUTATION; FADBR
Accession A1210
Systematic name g.25968delA, c.1177delA, r.1177dela, p.Thr393fsX12
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25968
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1191
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 393
Feature /change: T -> LPVKMCSAMR WX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID @A394X395(1a); standard; MUTATION; FADBR
Accession A0072
Systematic name g.25971_25973delinsATGTGATGAACACAT,
Systematic name c.1180_1182delinsATGTGATGAACACAT,
Systematic name r.1180_1182delinsaugugaugaacacau,
Systematic name p.Thr393_Ala394insMetXXThrHis
Original code J8
Description An indel mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7927345
RefAuthors Ariga, T., Sakiyama, Y., Matsumoto, S.
RefTitle Two novel point mutations in the cytochrome b 558 heavy
RefTitle chain gene, detected in two Japanese patients with X-linked
RefTitle chronic granulomatous disease
RefLoc Hum. Genet. 94:441 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 25971..25973
Feature /change: gcc -> atgtgatgaa cacat
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1194..1196
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 394
Feature /change: A -> MXXTH
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Japan
Family history Inherited
Relative CYBBbase; A0073 maternal cousin
Comment Mother of the patient is the carrier
//
ID @A394X395(1b); standard; MUTATION; FADBR
Accession A0073
Systematic name g.25971_25973delinsATGTGATGAACACAT,
Systematic name c.1180_1182delinsATGTGATGAACACAT,
Systematic name r.1180_1182delinsaugugaugaacacau,
Systematic name p.Thr393_Ala394insMetXXThrHis
Original code J9
Description An indel mutation in the exon 10 leading to an amino acid
Description change in the FADBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7927345
RefAuthors Ariga, T., Sakiyama, Y., Matsumoto, S.
RefTitle Two novel point mutations in the cytochrome b 558 heavy
RefTitle chain gene, detected in two Japanese patients with X-linked
RefTitle chronic granulomatous disease
RefLoc Hum. Genet. 94:441 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 25971..25973
Feature /change: gcc -> atgtgatgaa cacat
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1194..1196
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 394
Feature /change: A -> MXXTH
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Japan
Family history Inherited
Relative CYBBbase; A0072 maternal cousin
Comment Mother of the patient is the carrier
//
ID #E396X401(1); standard; MUTATION; FADBR
Accession A1211
Systematic name g.25977_25986delGAAGATGTGT, c.1186_1195delGAAGATGTGT,
Systematic name r.1186_1195delgaagaugugu, p.Glu396fsX6
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the FADBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25977..25986
Feature /change: -gaagatgtgt
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1200..1209
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 396..399
Feature /change: EDVF -> SAMRWX
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID #D397X401(1); standard; MUTATION; FADBR
Accession A0213
Systematic name g.25981_25982delAT, c.1190_1191delAT, r.1190_1191delau,
Systematic name p.Asp397fsX5
Original code IV-26 ref [1]
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the FADBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 25981..25982
Feature /change: -at
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1204..1205
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 397
Feature /change: D -> GVQLX
Feature /domain: FADBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
//
ID M405R(1); standard; MUTATION; NADPHBR
Accession A0142
Systematic name g.26005T>G, c.1214T>G, r.1214u>g, p.Met405Arg
Original code IV-20 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26005
Feature /change: t -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1228
Feature /codon: atg -> agg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 405
Feature /change: M -> R
Feature /domain: NADPHBR
Sex XY
//
ID V407V(1); standard; MUTATION; NADPHBR
Accession A1422
Systematic name g.26012G>A, c.1221G>A, r.1221g>a, p.Val407Val
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 29-Oct-2012 (Rel. 2, Created)
Date 29-Oct-2012 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (29-Oct-2012) to CYBBbase.
RefLoc Mustafa Yavuz Köker; Departments of Immunology, BMT
RefLoc centre, University of Erciyes; Tel +905053478838; Fax
RefLoc +903522249327; e-mail kokabdul@hotmail.com
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26012
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1235
Feature /codon: gtg -> gta; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 407
Feature /change: V -> V
Feature /domain: NADPHBR
mRNA level Absent
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Age 11
Sex XY
Ethnic origin Caucasoid; Turkey
Family history Inherited
Relative Description of pedigree:5 years of old Brother has also
Relative same missense mutation
//
ID G408E(1); standard; MUTATION; NADPHBR
Accession A0013
Systematic name g.26014G>A, c.1223G>A, r.1223g>a, p.Gly408Glu
Original code "VI-14; VII-30 ref [1];MK" ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10627478
RefAuthors Leusen, J. H., Meischl, C., Eppink, M. H., Hilarius, P.
RefAuthors M., de Boer, M., Weening, R. S., Ahlin, A., Sanders, L.,
RefAuthors Goldblatt, D., Skopczynska, H., Bernatowska, E., Palmblad,
RefAuthors J., Verhoeven, A. J., van Berkel, W. J., Roos, D.
RefTitle Four novel mutations in the gene encoding gp91-phox of
RefTitle human NADPH oxidase: consequences for oxidase assembly.
RefLoc Blood 95:666-673 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26014
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1237
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> E
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0.05
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID G408E(2); standard; MUTATION; NADPHBR
Accession A0016
Systematic name g.26014G>A, c.1223G>A, r.1223g>a, p.Gly408Glu
Original code VII-29(F) ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26014
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1237
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> E
Feature /domain: NADPHBR
Oxidase act. Reduced
NBT-slide 16 %
Sex XX
Ethnic origin Caucasian (Netherlands)
//
ID G408E(3a); standard; MUTATION; NADPHBR
Accession A0190
Systematic name g.26014G>A, c.1223G>A, r.1223g>a, p.Gly408Glu
Original code IV-22 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26014
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1237
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> E
Feature /domain: NADPHBR
Sex XY
Relative CYBBbase; A0191 brother
//
ID G408E(3b); standard; MUTATION; NADPHBR
Accession A0191
Systematic name g.26014G>A, c.1223G>A, r.1223g>a, p.Gly408Glu
Original code IV-22 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26014
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1237
Feature /codon: gga -> gaa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> E
Feature /domain: NADPHBR
Sex XY
Relative CYBBbase; A0190 brother
//
ID G408R(1a); standard; MUTATION; NADPHBR
Accession A0157
Systematic name g.26013G>A, c.1222G>A, r.1222g>a, p.Gly408Arg
Original code IV-21 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26013
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1236
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> R
Feature /domain: NADPHBR
Sex XY
Relative CYBBbase; A0158 brother
//
ID G408R(1b); standard; MUTATION; NADPHBR
Accession A0158
Systematic name g.26013G>A, c.1222G>A, r.1222g>a, p.Gly408Arg
Original code IV-21 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26013
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1236
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> R
Feature /domain: NADPHBR
Sex XY
Relative CYBBbase; A0157 brother
//
ID G408R(2); standard; MUTATION; NADPHBR
Accession A1212
Systematic name g.26013G>A, c.1222G>A, r.1222g>a, p.Gly408Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26013
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1236
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID G408R(3); standard; MUTATION; NADPHBR
Accession A1213
Systematic name g.26013G>C, c.1222G>C, r.1222g>c, p.Gly408Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26013
Feature /change: g -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1236
Feature /codon: gga -> cga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 408
Feature /change: G -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID G412E(1); standard; MUTATION; NADPHBR
Accession A1217
Systematic name g.26026G>A, c.1235G>A, r.1235g>a, p.Gly412Glu
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26026
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1249
Feature /codon: ggg -> gag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 412
Feature /change: G -> E
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID G412R(1); standard; MUTATION; NADPHBR
Accession A1214
Systematic name g.26025G>A, c.1234G>A, r.1234g>a, p.Gly412Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26025
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1248
Feature /codon: ggg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 412
Feature /change: G -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID G412R(2a); standard; MUTATION; NADPHBR
Accession A1215
Systematic name g.26025G>C, c.1234G>C, r.1234g>c, p.Gly412Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26025
Feature /change: g -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1248
Feature /codon: ggg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 412
Feature /change: G -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1216
//
ID G412R(2b); standard; MUTATION; NADPHBR
Accession A1216
Systematic name g.26025G>C, c.1234G>C, r.1234g>c, p.Gly412Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26025
Feature /change: g -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1248
Feature /codon: ggg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 412
Feature /change: G -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1215
//
ID @G412+8(1); standard; MUTATION; NADPHBR
Accession A1218
Systematic name g.26024_26025insGGGGTCACACCCTTCGCATCCATT,
Systematic name c.1233_1234insGGGGTCACACCCTTCGCATCCATT,
Systematic name r.1233_1234insggggucacacccuucgcauccauu,
Systematic name p.Ile411_Gly412insGlyValThrProPheAlaSerIle
Description An inframe insertion in the exon 10 leading to an amino
Description acid change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 26025
Feature /change: +ggggtcacac ccttcgcatc catt
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1248
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 412
Feature /change: +GVTPFASI
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @V413X430(1); standard; MUTATION; NADPHBR
Accession A0144
Systematic name g.26028dupG, c.1237dupG, r.1237dupg, p.Val413fsX18
Original code II-23 ref [1]
Description A frame shift duplication mutation in the exon 10 leading
Description to a premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 26029
Feature /change: +g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1252
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 413
Feature /change: V -> GHTLRIHSQV SLVQILQX
Feature /domain: NADPHBR
Symptoms Classical CGD
Sex XY
//
ID @V413X430(2); standard; MUTATION; NADPHBR
Accession A1219
Systematic name g.26028dupG, c.1237dupG, r.1237dupg, p.Val413fsX18
Description A frame shift duplication mutation in the exon 10 leading
Description to a premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 26029
Feature /change: +g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1252
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 413
Feature /change: V -> GHTLRIHSQV SLVQILQX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID P415H(1a); standard; MUTATION; NADPHBR
Accession A0048
Systematic name g.26035C>A, c.1244C>A, r.1244c>a, p.Pro415His
Original code VII-32 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linkTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> H
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
Relative CYBBbase; A0049 brother
//
ID P415H(1b); standard; MUTATION; NADPHBR
Accession A0049
Systematic name g.26035C>A, c.1244C>A, r.1244c>a, p.Pro415His
Original code VII-32 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> H
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
Relative CYBBbase; A0048 brother
//
ID P415H(2a); standard; MUTATION; NADPHBR
Accession A0076
Systematic name g.26035C>A, c.1244C>A, r.1244c>a, p.Pro415His
Original code VII-31 ref [1];IV-24 ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> H
Feature /domain: NADPHBR
mRNA level Normal
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0077 brother
//
ID P415H(2b); standard; MUTATION; NADPHBR
Accession A0077
Systematic name g.26035C>A, c.1244C>A, r.1244c>a, p.Pro415His
Original code VII-31 ref [1];IV-24 ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> H
Feature /domain: NADPHBR
mRNA level Normal
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0076 brother
//
ID P415H(3); standard; MUTATION; NADPHBR
Accession A0107
Systematic name g.26035C>A, c.1244C>A, r.1244c>a, p.Pro415His
Original code IV-23 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> H
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal (100)
Oxidase act. 0
Symptoms Mild CGD
Sex XY
//
ID P415L(1); standard; MUTATION; NADPHBR
Accession A0112
Systematic name g.26035C>T, c.1244C>T, r.1244c>u, p.Pro415Leu
Original code IV-25 ref [1]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> L
Feature /domain: NADPHBR
Sex XY
//
ID P415L(2); standard; MUTATION; NADPHBR
Accession A1220
Systematic name g.26035C>T, c.1244C>T, r.1244c>u, p.Pro415Leu
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> L
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID P415L(3); standard; MUTATION; NADPHBR
Accession A1221
Systematic name g.26035C>T, c.1244C>T, r.1244c>u, p.Pro415Leu
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> ctc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> L
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID P415R(1); standard; MUTATION; NADPHBR
Accession A0419
Systematic name g.26035C>G, c.1244C>G, r.1244c>g, p.Pro415Arg
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26035
Feature /change: c -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1258
Feature /codon: ccc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 415
Feature /change: P -> R
Feature /domain: NADPHBR
Sex XY
//
ID S418Y(1); standard; MUTATION; NADPHBR
Accession A1222
Systematic name g.26044C>A, c.1253C>A, r.1253c>a, p.Ser418Tyr
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26044
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1267
Feature /codon: tcc -> tac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 418
Feature /change: S -> Y
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @I419X430(1); standard; MUTATION; NADPHBR
Accession A0574
Systematic name g.26046dupA, c.1255dupA, r.1255dupa, p.Ile419fsX12
Original code Patient H
Description A frame shift duplication mutation in the exon 10 leading
Description to a premature stop codon in the NADPHBR domain
Date 02-Nov-2006 (Rel. 2, Created)
Date 02-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 26047
Feature /change: +a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 1270
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 419
Feature /change: I -> NSQVSLVQIL QX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Skin and liver abscesses caused by Staphylococcus aureus
Sex XY
Ethnic origin Caucasoid; Chile
//
ID L420P(1); standard; MUTATION; NADPHBR
Accession A0406
Systematic name g.26050T>C, c.1259T>C, r.1259u>c, p.Leu420Pro
Original code 91-32 ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10068684
RefAuthors Kaneda, M., Sakuraba, H., Ohtake, A., Nishida, A., Kiryu,
RefAuthors C., Kakinuma, K.
RefTitle Missense mutations in the gp91-phox gene encoding
RefTitle cytochrome b558 in patients with cytochrome b positive and
RefTitle negative X-linked chronic granulomatous disease.
RefLoc Blood 93:2098-2104 (1999)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26050
Feature /change: t -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1273
Feature /codon: ctc -> ccc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 420
Feature /change: L -> P
Feature /domain: NADPHBR
Phenotype X91 0
//
ID S422P(1); standard; MUTATION; NADPHBR
Accession A0202
Systematic name g.26055T>C, c.1264T>C, r.1264u>c, p.Ser422Pro
Original code IV-26 ref [2]
Description A point mutation in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26055
Feature /change: t -> c
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1278
Feature /codon: tca -> cca; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 422
Feature /change: S -> P
Feature /domain: NADPHBR
Sex XY
Family history Inherited, mother carrier
//
ID S422X(1); standard; MUTATION; NADPHBR
Accession A1223
Systematic name g.26056C>A, c.1265C>A, r.1265c>a, p.Ser422X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26056
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1279
Feature /codon: tca -> taa; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 422
Feature /change: S -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #S422-3(1); standard; MUTATION; NADPHBR
Accession A1224
Systematic name g.26056_26064delCAGTCTGGT, c.1265_1273delCAGTCTGGT,
Systematic name r.1265_1273delcagucuggu, p.Ser422del
Description An inframe deletion in the exon 10 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26056..26064
Feature /change: -cagtctggt
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1279..1287
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 422..425
Feature /change: SVWY -> Y
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W424X(1); standard; MUTATION; NADPHBR
Accession A0622
Systematic name g.26063G>A, c.1272G>A, r.1272g>a, p.Trp424X
Original code P1
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 29-Apr-2008 (Rel. 2, Created)
Date 29-Apr-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18322777
RefAuthors Teimourian, S., Rezvani, Z., Badalzadeh, M.,
RefAuthors Kannengiesser, C., Mansouri, D., Movahedi, M., Zomorodian,
RefAuthors E., Parvaneh, N., Mamishi, S., Pourpak, Z., Moin, M.
RefTitle Molecular diagnosis of X-linked chronic granulomatous
RefTitle disease in iran.
RefLoc Int J Hematol (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26063
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1286
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Age 5
Sex XY
Ethnic origin Caucasoid; Iran
Family history Inherited
//
ID W424X(2); standard; MUTATION; NADPHBR
Accession A0623
Systematic name g.26063G>A, c.1272G>A, r.1272g>a, p.Trp424X
Original code P3
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 29-Apr-2008 (Rel. 2, Created)
Date 29-Apr-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18322777
RefAuthors Teimourian, S., Rezvani, Z., Badalzadeh, M.,
RefAuthors Kannengiesser, C., Mansouri, D., Movahedi, M., Zomorodian,
RefAuthors E., Parvaneh, N., Mamishi, S., Pourpak, Z., Moin, M.
RefTitle Molecular diagnosis of X-linked chronic granulomatous
RefTitle disease in iran.
RefLoc Int J Hematol (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26063
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1286
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Age 3
Sex XY
Ethnic origin Caucasoid; Iran
Family history Inherited
//
ID W424X(3); standard; MUTATION; NADPHBR
Accession A1225
Systematic name g.26062G>A, c.1271G>A, r.1271g>a, p.Trp424X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26062
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1285
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W424X(4); standard; MUTATION; NADPHBR
Accession A1226
Systematic name g.26063G>A, c.1272G>A, r.1272g>a, p.Trp424X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26063
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1286
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W424X(5); standard; MUTATION; NADPHBR
Accession A1227
Systematic name g.26063G>A, c.1272G>A, r.1272g>a, p.Trp424X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26063
Feature /change: g -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1286
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #W424X434(1); standard; MUTATION; NADPHBR
Accession A0330
Systematic name g.26063delG, c.1272delG, r.1272delg, p.Trp424fsX11
Original code II-24 ref [1]
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26063
Feature /change: -g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1286
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 424
Feature /change: W -> CTNIAITPPI X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID Y425X(1); standard; MUTATION; NADPHBR
Accession A0496
Systematic name g.26066C>G, c.1275C>G, r.1275c>g, p.Tyr425X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26066
Feature /change: c -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1289
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 425
Feature /change: Y -> X
Feature /domain: NADPHBR
//
ID Y427X(1); standard; MUTATION; NADPHBR
Accession A1228
Systematic name g.26072T>G, c.1281T>G, r.1281u>g, p.Tyr427X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26072
Feature /change: t -> g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1295
Feature /codon: tat -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 427
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID C428X(1); standard; MUTATION; NADPHBR
Accession A0598
Systematic name g.26075C>A, c.1284C>A, r.1284c>a, p.Cys428X
Original code DB
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 03-Apr-2007 (Rel. 2, Created)
Date 03-Apr-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (03-Apr-2007) to CYBBbase.
RefLoc A. Ferreira, M.C. Garcia Rodriguez, G. Fontan.; Unidad de
RefLoc Inmunologia-Hospital La Paz-Paseo de la Castellana
RefLoc 261-28046 Madrid-Spain; Tel 917277238; Fax 917277095;
RefLoc e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26075
Feature /change: c -> a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 1298
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 428
Feature /change: C -> X
Feature /domain: NADPHBR
mRNA level N.D.
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Recurrent infections by Salmonella
Age 6
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree: Uncle died at 3 years by hepatic
Relative failure
Comment Mother is carrier
//
ID #N429X451(1); standard; MUTATION; NADPHBR
Accession A0617
Systematic name g.26078_26085delinsAAGCCA, c.1287_1294delinsAAGCCA,
Systematic name r.1287_1294delinsaagcca, p.Asn429fsX23
Original code CaAn
Description A frame shift indel mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 20-Mar-2008 (Rel. 2, Created)
Date 20-Mar-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (20-Mar-2008) to CYBBbase.
RefLoc Di Matteo G., Finocchi A., Giordani L., Martire B.; Dep. of
RefLoc Public Health, Tor Vergata University - Via Montpellier,1 -
RefLoc 00133 Rome; Tel 39-0672596492; Fax 06-0672596822; e-mail
RefLoc andrea.finocchi@uniroma2.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 26078..26085
Feature /change: taacgcca -> aagcca
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1301..1308
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 429..432
Feature /change: NNAT -> KSHQSEAQKD LLLLAVPGHT CLX
Feature /domain: NADPHBR
mRNA level N.D.
Protein level Absent
Activity Much reduced
Diagnosis Classical X-linked CGD
Symptoms recurrent pneumonia and lymphadenitis
Age 2
Sex XY
Ethnic origin Caucasoid; ITALY
Family history Inherited
Relative Description of pedigree:mother carrier maternal grandmother
Relative and maternal aunt not carriers
Comment The maternal grandfather has not been analyzed yet
//
ID #T432X434(1); standard; MUTATION; NADPHBR
Accession A1229
Systematic name g.26085delA, c.1294delA, r.1294dela, p.Thr432fsX3
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26085
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1308
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 432
Feature /change: T -> PIX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID K437X(1); standard; MUTATION; NADPHBR
Accession A0403
Systematic name g.26100A>T, c.1309A>T, r.1309a>u, p.Lys437X
Original code 91-33 ref [1]
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26100
Feature /change: a -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1323
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 437
Feature /change: K -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID K437X(2); standard; MUTATION; NADPHBR
Accession A1230
Systematic name g.26100A>T, c.1309A>T, r.1309a>u, p.Lys437X
Description A point mutation in the exon 10 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26100
Feature /change: a -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1323
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 437
Feature /change: K -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #K438X501(1a); standard; MUTATION; NADPHBR
Accession A0053
Systematic name g.26104delA, c.1313delA, r.1313dela, p.Lys438fsX64
Original code IV-35 ref [1]
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26104
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1327
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: RSTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
mRNA level 0
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
Relative CYBBbase; A0054 cousin
Comment Maternal aunt carrier
//
ID #K438X501(1b); standard; MUTATION; NADPHBR
Accession A0054
Systematic name g.26104delA, c.1313delA, r.1313dela, p.Lys438fsX64
Original code IV-35 ref [1]
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26104
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1327
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: RSTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
mRNA level 0
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (Swiss)
Family history Inherited, mother is carrier
Relative CYBBbase; A0053 cousin
Comment Maternal aunt carrier
//
ID #K438X501(2); standard; MUTATION; NADPHBR
Accession A0091
Systematic name g.26104_26105delinsT, c.1313_1314delinsT,
Systematic name r.1313_1314delinsu, p.Lys438fsX64
Original code J8
Description A frame shift indel mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 26104..26105
Feature /change: ag -> t
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1327..1328
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: ISTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Japan
Comment Patient deceased
//
ID #K438X501(3); standard; MUTATION; NADPHBR
Accession A1231
Systematic name g.26104delA, c.1313delA, r.1313dela, p.Lys438fsX64
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26104
Feature /change: -a
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1327
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: RSTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #K438X501(4); standard; MUTATION; NADPHBR
Accession A1232
Systematic name g.26105delG, c.1314delG, r.1314delg, p.Ile439fsX63
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26105
Feature /change: -g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1328
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: KSTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #K438X501(5); standard; MUTATION; NADPHBR
Accession A1233
Systematic name g.26105delG, c.1314delG, r.1314delg, p.Ile439fsX63
Description A frame shift deletion mutation in the exon 10 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 26105
Feature /change: -g
Feature /genomic_region: exon; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1328
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 438
Feature /change: K ->
Feature /change: KSTSTGCAGT HMPLSGLQIC CNCWRARCRK GTMPASSATT
Feature /change: STSLAGMSLR PITLLCTMMR RKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #I439X501(1); standard; MUTATION; NADPHBR
Accession A0081
Systematic name g.27324delA, c.1315delA, r.1315dela, p.Ile439fsX63
Original code A.Z. ref [2]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9794433
RefAuthors Dusi, S., Nadalini, K. A., Donini, M., Zentilin, L.,
RefAuthors Wientjes, F. B., Roos, D., Giacca, M., Rossi, F.
RefTitle Nicotinamide-adenine dinucleotide phosphate oxidase
RefTitle assembly and activation in EBV-transformed B
RefTitle lymphoblastoid cell lines of normal and chronic
RefTitle granulomatous disease patients.
RefLoc J Immunol 161:4968-4974 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27324
Feature /change: -a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1329
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 439
Feature /change: I ->
Feature /change: STSTGCAGTH MPLSGLQICC NCWRARCRKG TMPASSATTS
Feature /change: TSLAGMSLRP ITLLCTMMRR KMX
Feature /domain: NADPHBR
Phenotype X91 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID Y440X(1); standard; MUTATION; NADPHBR
Accession A0151
Systematic name g.27329C>A, c.1320C>A, r.1320c>a, p.Tyr440X
Original code III-26 ref [2]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27329
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1334
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 440
Feature /change: Y -> X
Feature /domain: NADPHBR
Symptoms Classical CGD
Sex XY
//
ID Y440X(2); standard; MUTATION; NADPHBR
Accession A1240
Systematic name g.27329C>G, c.1320C>G, r.1320c>g, p.Tyr440X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27329
Feature /change: c -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1334
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 440
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Y442X(2); standard; MUTATION; NADPHBR
Accession A0589
Systematic name g.27335C>G, c.1326C>G, r.1326c>g, p.Tyr442X
Original code 11. G.P.
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27335
Feature /change: c -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 1340
Feature /codon: tac -> tag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 442
Feature /change: Y -> X
Feature /domain: NADPHBR
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pneumonia (Actinomyces israelii), breast abscess
Symptoms (Staphylococcus aureus), perianal abscess, urinary tract
Symptoms infection (Proteus mirabilis), lymphadenitis, granulomatous
Symptoms colitis
Age 14 mo
Family history Inherited
//
ID W443X(1); standard; MUTATION; NADPHBR
Accession A0168
Systematic name g.27338G>A, c.1329G>A, r.1329g>a, p.Trp443X
Original code III-28
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27338
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1343
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 443
Feature /change: W -> X
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID W443X(2); standard; MUTATION; NADPHBR
Accession A0485
Systematic name g.27338G>A, c.1329G>A, r.1329g>a, p.Trp443X
Original code III-27 ref [1]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27338
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1343
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 443
Feature /change: W -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID #W443X501(1); standard; MUTATION; NADPHBR
Accession A0630
Systematic name g.27336delT, c.1327delT, r.1327delu, p.Trp443fsX59
Original code P6
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27336
Feature /change: -t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1341
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 443
Feature /change: W ->
Feature /change: GCAGTHMPLS GLQICCNCWR ARCRKGTMPA SSATTSTSLA
Feature /change: GMSLRPITLL CTMMRRKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Pneumonia, perirectal abscess, lymphadenitis.
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID C445R(1); standard; MUTATION; NADPHBR
Accession A0605
Systematic name g.27342T>C, c.1333T>C, r.1333u>c, p.Cys445Arg
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 27-Sep-2007 (Rel. 2, Created)
Date 27-Sep-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (27-Sep-2007) to CYBBbase.
RefLoc Jianxin He; Nanlishi Road, Beijing, China.Asthma Centre of
RefLoc Beijing Children' Hospital; Tel 13701365712; e-mail
RefLoc hejianxin70@163.com
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27342
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 1347
Feature /codon: tgc -> cgc; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 445
Feature /change: C -> R
Feature /domain: NADPHBR
mRNA level N.D.
Protein level N.D.
Activity Normal
Diagnosis Mild X-linked CGD
Age 4
Sex XY
Ethnic origin Mongoloid; China
Family history Inherited
Relative Description of pedigree: mother, grandmother and sister are
Relative carriers
//
ID C445X(1); standard; MUTATION; NADPHBR
Accession A0361
Systematic name g.27344C>A, c.1335C>A, r.1335c>a, p.Cys445X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27344
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1349
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 445
Feature /change: C -> X
Feature /domain: NADPHBR
Phenotype X91 0
Heme level Normal
//
ID C445X(2a); standard; MUTATION; NADPHBR
Accession A1241
Systematic name g.27344C>A, c.1335C>A, r.1335c>a, p.Cys445X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27344
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1349
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 445
Feature /change: C -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1242
//
ID C445X(2b); standard; MUTATION; NADPHBR
Accession A1242
Systematic name g.27344C>A, c.1335C>A, r.1335c>a, p.Cys445X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27344
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1349
Feature /codon: tgc -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 445
Feature /change: C -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1241
//
ID #D447X501(1); standard; MUTATION; NADPHBR
Accession A1243
Systematic name g.27349delA, c.1340delA, r.1340dela, p.Asp447fsX55
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27349
Feature /change: -a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1354
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 447
Feature /change: D ->
Feature /change: AHMPLSGLQI CCNCWRARCR KGTMPASSAT TSTSLAGMSL
Feature /change: RPITLLCTMM RRKMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #A450X(1); standard; MUTATION; NADPHBR
Accession A0308
Systematic name g.27357_27361delGCCTT, c.1348_1352delGCCTT,
Systematic name r.1348_1352delgccuu, p.Ala450X
Description A deletion mutation in the exon 11 leading to a premature
Description stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27357..27361
Feature /change: -gcctt
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1362..1366
Feature /codon: gcc -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 450..451
Feature /change: AF -> X
Feature /domain: NADPHBR
//
ID #A450X501(1); standard; MUTATION; NADPHBR
Accession A0192
Systematic name g.27359delC, c.1350delC, r.1350delc, p.Phe451fsX51
Original code II-26 ref [2]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27359
Feature /change: -c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1364
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 450
Feature /change: A ->
Feature /change: ALSGLQICCN CWRARCRKGT MPASSATTST SLAGMSLRPI
Feature /change: TLLCTMMRRK MX
Feature /domain: NADPHBR
Sex XX
Family history Inherited, mother is carrier
Comment Affected fetus aborted
//
ID E452X(1); standard; MUTATION; NADPHBR
Accession A0373
Systematic name g.27363G>T, c.1354G>T, r.1354g>u, p.Glu452X
Original code 91-34 ref [1]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27363
Feature /change: g -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1368
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 452
Feature /change: E -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID W453R(1); standard; MUTATION; NADPHBR
Accession A0486
Systematic name g.27366T>C, c.1357T>C, r.1357u>c, p.Trp453Arg
Original code IV-27 ref [1]
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27366
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> R
Feature /domain: NADPHBR
Phenotype X91?
//
ID W453R(2); standard; MUTATION; NADPHBR
Accession A0487
Systematic name g.27366T>C, c.1357T>C, r.1357u>c, p.Trp453Arg
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27366
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> R
Feature /domain: NADPHBR
//
ID W453R(3a); standard; MUTATION; NADPHBR
Accession A0613
Systematic name g.27366T>A, c.1357T>A, r.1357u>a, p.Trp453Arg
Original code PaAn
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 05-Mar-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27366
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> R
Feature /domain: NADPHBR
mRNA level N.D.
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms visceral leishmaniasis
Age 3
Sex XY
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative CYBBbase; A1244
//
ID W453R(3b); standard; MUTATION; NADPHBR
Accession A1244
Systematic name g.27366T>A, c.1357T>A, r.1357u>a, p.Trp453Arg
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27366
Feature /change: t -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371
Feature /codon: tgg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative CYBBbase; A0613
//
ID W453R(4); standard; MUTATION; NADPHBR
Accession A1245
Systematic name g.27366T>C, c.1357T>C, r.1357u>c, p.Trp453Arg
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27366
Feature /change: t -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W453X(1); standard; MUTATION; NADPHBR
Accession A0488
Systematic name g.27367G>A, c.1358G>A, r.1358g>a, p.Trp453X
Original code III-29 ref [2]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27367
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1372
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID W453X(2); standard; MUTATION; NADPHBR
Accession A0489
Systematic name g.27368G>A, c.1359G>A, r.1359g>a, p.Trp453X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27368
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1373
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> X
Feature /domain: NADPHBR
Sex XY
Family history Inherited, mother carrier
Comment Found in mother and sister who are both carriers.
Comment patient died from P. cepacia infection
//
ID W453X(3a); standard; MUTATION; NADPHBR
Accession A1247
Systematic name g.27368G>A, c.1359G>A, r.1359g>a, p.Trp453X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27368
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1373
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1248
//
ID W453X(3b); standard; MUTATION; NADPHBR
Accession A1248
Systematic name g.27368G>A, c.1359G>A, r.1359g>a, p.Trp453X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27368
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1373
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1247
//
ID #W453X484(1); standard; MUTATION; NADPHBR
Accession A1246
Systematic name g.27366_27367delTG, c.1357_1358delTG, r.1357_1358delug,
Systematic name p.Trp453fsX32
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27366..27367
Feature /change: -tg
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1371..1372
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 453
Feature /change: W -> VCRSAATAGE PDAGKEQCRL PQLQHLPHWL GX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #A455X497(1); standard; MUTATION; NADPHBR
Accession A1249
Systematic name g.27372_27384delGCAGATCTGCTGC, c.1363_1375delGCAGATCTGCTGC,
Systematic name r.1363_1375delgcagaucugcugc, p.Ala455fsX43
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27372..27384
Feature /change: -gcagatctgc tgc
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1377..1389
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 455..459
Feature /change: ADLLQ ->
Feature /change: NCWRARCRKG TMPASSATTS TSLAGMSLRP ITLLCTMMRR KMX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q459X(1); standard; MUTATION; NADPHBR
Accession A1250
Systematic name g.27384C>T, c.1375C>T, r.1375c>u, p.Gln459X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27384
Feature /change: c -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1389
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 459
Feature /change: Q -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #Q459X501(1); standard; MUTATION; NADPHBR
Accession A1435
Systematic name g.27384delC, c.1375delC, r.1375delc, p.Gln459fsX43
Original code IGS
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27384
Feature /change: -c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1389
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 459
Feature /change: Q ->
Feature /change: NCWRARCRKG TMPASSATTS TSLAGMSLRP ITLLCTMMRR KMX
Feature /domain: NADPHBR
Protein level N.D.
Activity Inactive
Diagnosis Classical X-linked CGD
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier
//
ID #L461X501(1); standard; MUTATION; NADPHBR
Accession A1251
Systematic name g.27391delT, c.1382delT, r.1382delu, p.Leu461fsX41
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27391
Feature /change: -t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1396
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 461
Feature /change: L ->
Feature /change: RRARCRKGTM PASSATTSTS LAGMSLRPIT LLCTMMRRKM X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID E462X(1); standard; MUTATION; NADPHBR
Accession A0374
Systematic name g.27393G>T, c.1384G>T, r.1384g>u, p.Glu462X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27393
Feature /change: g -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1398
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 462
Feature /change: E -> X
Feature /domain: NADPHBR
Sex XY
//
ID E462X(2); standard; MUTATION; NADPHBR
Accession A1252
Systematic name g.27393G>T, c.1384G>T, r.1384g>u, p.Glu462X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27393
Feature /change: g -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1398
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 462
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q466X(1); standard; MUTATION; NADPHBR
Accession A0426
Systematic name g.27405C>T, c.1396C>T, r.1396c>u, p.Gln466X
Original code 91-35 ref [1]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27405
Feature /change: c -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1410
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 466
Feature /change: Q -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID Q466X(2); standard; MUTATION; NADPHBR
Accession A1253
Systematic name g.27405C>T, c.1396C>T, r.1396c>u, p.Gln466X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27405
Feature /change: c -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1410
Feature /codon: cag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 466
Feature /change: Q -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID E467X(1a); standard; MUTATION; NADPHBR
Accession A1254
Systematic name g.27408G>T, c.1399G>T, r.1399g>u, p.Glu467X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27408
Feature /change: g -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1413
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 467
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1255
//
ID E467X(1b); standard; MUTATION; NADPHBR
Accession A1255
Systematic name g.27408G>T, c.1399G>T, r.1399g>u, p.Glu467X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27408
Feature /change: g -> t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1413
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 467
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1254
//
ID #G472X501(1a); standard; MUTATION; NADPHBR
Accession A0092
Systematic name g.27424delG, c.1415delG, r.1415delg, p.Gly472fsX30
Original code II-27 ref [2]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27424
Feature /change: -g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1429
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 472
Feature /change: G -> ASSATTSTSL AGMSLRPITL LCTMMRRKMX
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0093 brother
//
ID #G472X501(1b); standard; MUTATION; NADPHBR
Accession A0093
Systematic name g.27424delG, c.1415delG, r.1415delg, p.Gly472fsX30
Original code II-27 ref [2]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27424
Feature /change: -g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1429
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 472
Feature /change: G -> ASSATTSTSL AGMSLRPITL LCTMMRRKMX
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0092 brother
//
ID L474R(1); standard; MUTATION; NADPHBR
Accession A1257
Systematic name g.27430T>G, c.1421T>G, r.1421u>g, p.Leu474Arg
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27430
Feature /change: t -> g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1435
Feature /codon: ctc -> cgc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 474
Feature /change: L -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Y476X(1); standard; MUTATION; NADPHBR
Accession A0071
Systematic name g.27437C>A, c.1428C>A, r.1428c>a, p.Tyr476X
Original code VIII-37 ref [2];91-36 ref [3]
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7927345
RefAuthors Ariga, T., Sakiyama, Y., Matsumoto, S.
RefTitle Two novel point mutations in the cytochrome b 558 heavy
RefTitle chain gene, detected in two japanese patients with X-
RefTitle linked chronic granulomatous disease.
RefLoc Hum Genet 94:441 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [4]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27437
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1442
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 476
Feature /change: Y -> X
Feature /domain: NADPHBR
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Japanese
//
ID Y479X(1); standard; MUTATION; NADPHBR
Accession A0631
Systematic name g.27446C>A, c.1437C>A, r.1437c>a, p.Tyr479X
Original code P7
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27446
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1451
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 479
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Perianal abscess, cervical abscess (CNS)
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID Y479X(2); standard; MUTATION; NADPHBR
Accession A1258
Systematic name g.27446C>A, c.1437C>A, r.1437c>a, p.Tyr479X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27446
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1451
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 479
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Y479X(3); standard; MUTATION; NADPHBR
Accession A1259
Systematic name g.27446C>A, c.1437C>A, r.1437c>a, p.Tyr479X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27446
Feature /change: c -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1451
Feature /codon: tac -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 479
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID T481P(1); standard; MUTATION; NADPHBR
Accession A1260
Systematic name g.27450A>C, c.1441A>C, r.1441a>c, p.Thr481Pro
Description A point mutation in the exon 11 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27450
Feature /change: a -> c
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1455
Feature /codon: act -> cct; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 481
Feature /change: T -> P
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W483X(1); standard; MUTATION; NADPHBR
Accession A0294
Systematic name g.27458G>A, c.1449G>A, r.1449g>a, p.Trp483X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27458
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1463
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 483
Feature /change: W -> X
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Swedish)
Family history Inherited, mother carrier
//
ID W483X(2); standard; MUTATION; NADPHBR
Accession A1261
Systematic name g.27457G>A, c.1448G>A, r.1448g>a, p.Trp483X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27457
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1462
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 483
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W483X(3); standard; MUTATION; NADPHBR
Accession A1262
Systematic name g.27457G>A, c.1448G>A, r.1448g>a, p.Trp483X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27457
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1462
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 483
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W483X(4); standard; MUTATION; NADPHBR
Accession A1263
Systematic name g.27457G>A, c.1448G>A, r.1448g>a, p.Trp483X
Description A point mutation in the exon 11 leading to a premature stop
Description codon in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27457
Feature /change: g -> a
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1462
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 483
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #W483X497(1); standard; MUTATION; NADPHBR
Accession A0331
Systematic name g.27456_27468delTGGGATGAGTCTC, c.1447_1459delTGGGATGAGTCTC,
Systematic name r.1447_1459delugggaugagucuc, p.Trp483fsX15
Original code 91-37 ref [1]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27456..27468
Feature /change: -tgggatgagt ctc
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1461..1473
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 483..487
Feature /change: WDESQ -> RPITLLCTMM RRKMX
Feature /domain: NADPHBR
Phenotype X91 0
//
ID #E485X501(1); standard; MUTATION; L
Accession A0165
Systematic name g.27464delG, c.1455delG, r.1455delg, p.Glu485fsX17
Original code II-28 ref [2]
Description A frame shift deletion mutation in the exon 11 leading to a
Description premature stop codon in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27464
Feature /change: -g
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1469
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 485
Feature /change: E -> DLRPITLLCT MMRRKMX
Feature /domain: L
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother is carrier
Comment Patient deceased
//
ID @S486X496(1a); standard; MUTATION; L
Accession A0184
Systematic name g.27465dupT, c.1456dupT, r.1456dupu, p.Ser486fsX11
Original code II-29 ref [2]
Description A frame shift duplication mutation in the exon 11 leading
Description to a premature stop codon in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 27466
Feature /change: +t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1471
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 486
Feature /change: S -> FSGQSLCCAP X
Feature /domain: L
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0185 brother
//
ID @S486X496(1b); standard; MUTATION; L
Accession A0185
Systematic name g.27465dupT, c.1456dupT, r.1456dupu, p.Ser486fsX11
Original code II-29 ref [2]
Description A frame shift duplication mutation in the exon 11 leading
Description to a premature stop codon in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 27466
Feature /change: +t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1471
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 486
Feature /change: S -> FSGQSLCCAP X
Feature /domain: L
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Relative CYBBbase; A0184 brother
//
ID @S486X496(2); standard; MUTATION; L
Accession A1264
Systematic name g.27465dupT, c.1456dupT, r.1456dupu, p.Ser486fsX11
Description A frame shift duplication mutation in the exon 11 leading
Description to a premature stop codon in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 27466
Feature /change: +t
Feature /genomic_region: exon; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1471
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 486
Feature /change: S -> FSGQSLCCAP X
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID A488D(1); standard; MUTATION; L
Accession A1417
Systematic name g.30505C>A, c.1463C>A, r.1463c>a, p.Ala488Asp
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 18-Nov-2011 (Rel. 2, Created)
Date 18-Nov-2011 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (18-Nov-2011) to CYBBbase.
RefLoc Prof Antonio Ferrante; Department of Immunopathology, SA
RefLoc Pathology, Women's and Childrens Hospitial, 72 King William
RefLoc Street, North Adelaide, 5006, Australia; e-mail
RefLoc antonio.ferrante@adelaide.edu.au
RefNumber [1]
Reference Manuscript submitted to Human Mutation journal.
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30505
Feature /change: c -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1477
Feature /codon: gcc -> gac; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 488
Feature /change: A -> D
Feature /domain: L
mRNA level N.D.
Protein level Normal
Activity Inactive
Diagnosis Classical X-linked CGD
Age 2
Sex XY
Family history Inherited
Relative Description of pedigree:Mother is a carrier.
//
ID #A488X501(1); standard; MUTATION; L
Accession A0114
Systematic name g.30506delC, c.1464delC, r.1464delc, p.Asn489fsX13
Original code II-30 ref [2]
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30506
Feature /change: -c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1478
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 488
Feature /change: A -> AITLLCTMMR RKMX
Feature /domain: L
Phenotype X91 0
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Denmark)
//
ID H495P(1a); standard; MUTATION; L
Accession A1272
Systematic name g.30526A>C, c.1484A>C, r.1484a>c, p.His495Pro
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30526
Feature /change: a -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1498
Feature /codon: cat -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 495
Feature /change: H -> P
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1273
//
ID H495P(1b); standard; MUTATION; L
Accession A1273
Systematic name g.30526A>C, c.1484A>C, r.1484a>c, p.His495Pro
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30526
Feature /change: a -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1498
Feature /codon: cat -> cct; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 495
Feature /change: H -> P
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1272
//
ID #D496-1(1); standard; MUTATION; L
Accession A1274
Systematic name g.30530_30532delTGA, c.1488_1490delTGA, r.1488_1490deluga,
Systematic name p.Asp496del
Description An inframe deletion in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30530..30532
Feature /change: -tga
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1502..1504
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 496..497
Feature /change: DE -> E
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID #K499X501(1); standard; MUTATION; L
Accession A0312
Systematic name g.30539delA, c.1497delA, r.1497dela, p.Asp500fsX2
Original code 91-38 ref [1]
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30539
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1511
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 499
Feature /change: K -> KMX
Feature /domain: L
Phenotype X91 0
//
ID D500E(1); standard; MUTATION; L
Accession A1280
Systematic name g.30542T>G, c.1500T>G, r.1500u>g, p.Asp500Glu
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30542
Feature /change: t -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1514
Feature /codon: gat -> gag; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> E
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID D500G(1); standard; MUTATION; L
Accession A0019
Systematic name g.30541A>G, c.1499A>G, r.1499a>g, p.Asp500Gly
Original code VII-33 ref [2]
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8182143
RefAuthors Leusen, J. H., de Boer, M., Bolscher, B. G., Hilarius, P.
RefAuthors M., Weening, R. S., Ochs, H. D., Roos, D., Verhoeven, A.
RefAuthors J.
RefTitle A point mutation in gp91-phox of cytochrome b558 of the
RefTitle human NADPH oxidase leading to defective translocation of
RefTitle the cytosolic proteins p47-phox and p67-phox.
RefLoc J Clin Invest 93:2120-2126 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30541
Feature /change: a -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1513
Feature /codon: gat -> ggt; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> G
Feature /domain: L
mRNA level Normal
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother is carrier
Comment Sister is carrier
//
ID D500H(1); standard; MUTATION; L
Accession A0632
Systematic name g.30540G>C, c.1498G>C, r.1498g>c, p.Asp500His
Original code P8
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> cat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> H
Feature /domain: L
Diagnosis Classical X-linked CGD
Symptoms Pneumonia, perianal abscess.
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID D500H(2); standard; MUTATION; L
Accession A1277
Systematic name g.30540G>C, c.1498G>C, r.1498g>c, p.Asp500His
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> cat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> H
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID D500N(1a); standard; MUTATION; L
Accession A0366
Systematic name g.30540G>A, c.1498G>A, r.1498g>a, p.Asp500Asn
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> N
Feature /domain: L
Phenotype X91 -
Relative CYBBbase; A1275
Relative CYBBbase; A1276
//
ID D500N(1b); standard; MUTATION; L
Accession A1275
Systematic name g.30540G>A, c.1498G>A, r.1498g>a, p.Asp500Asn
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> N
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0366
Relative CYBBbase; A1276
//
ID D500N(1c); standard; MUTATION; L
Accession A1276
Systematic name g.30540G>A, c.1498G>A, r.1498g>a, p.Asp500Asn
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> aat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> N
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0366
Relative CYBBbase; A1275
//
ID D500Y(1); standard; MUTATION; L
Accession A0367
Systematic name g.30540G>T, c.1498G>T, r.1498g>u, p.Asp500Tyr
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> Y
Feature /domain: L
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Polish)
//
ID D500Y(2a); standard; MUTATION; L
Accession A1278
Systematic name g.30540G>T, c.1498G>T, r.1498g>u, p.Asp500Tyr
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> Y
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1279
//
ID D500Y(2b); standard; MUTATION; L
Accession A1279
Systematic name g.30540G>T, c.1498G>T, r.1498g>u, p.Asp500Tyr
Description A point mutation in the exon 12 leading to an amino acid
Description change in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30540
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1512
Feature /codon: gat -> tat; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 500
Feature /change: D -> Y
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1278
//
ID #T503X505(1); standard; MUTATION; L
Accession A1281
Systematic name g.30551delA, c.1509delA, r.1509dela, p.Gly504fsX2
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30551
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1523
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 503
Feature /change: T -> TAX
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID #T503X505(2); standard; MUTATION; L
Accession A1282
Systematic name g.30551delA, c.1509delA, r.1509dela, p.Gly504fsX2
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the L domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30551
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1523
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 503
Feature /change: T -> TAX
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID L505P(1a); standard; MUTATION; NADPHBR
Accession A0407
Systematic name g.30556T>C, c.1514T>C, r.1514u>c, p.Leu505Pro
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30556
Feature /change: t -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1528
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 505
Feature /change: L -> P
Feature /domain: NADPHBR
Phenotype X91 -
Sex XY
Family history Inherited, mother is carrier
Relative CYBBbase; A1284
//
ID L505P(1b); standard; MUTATION; NADPHBR
Accession A1284
Systematic name g.30556T>C, c.1514T>C, r.1514u>c, p.Leu505Pro
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30556
Feature /change: t -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1528
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 505
Feature /change: L -> P
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Family history Inherited, mother is carrier
Relative CYBBbase; A0407
//
ID L505R(1); standard; MUTATION; NADPHBR
Accession A0408
Systematic name g.30556T>G, c.1514T>G, r.1514u>g, p.Leu505Arg
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11462241
RefAuthors Gerard, B., El Benna, J., Alcain, F., Gougerot-Pocidalo,
RefAuthors M. A., Grandchamp, B., Chollet-Martin, S.
RefTitle Characterization of 11 novel mutations in the X-linked
RefTitle chronic granulomatous disease (CYBB gene).
RefLoc Hum Mutat 18:163 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30556
Feature /change: t -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1528
Feature /codon: ctg -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 505
Feature /change: L -> R
Feature /domain: NADPHBR
Phenotype X91 0
Sex XY
//
ID L505R(2); standard; MUTATION; NADPHBR
Accession A0573
Systematic name g.30556T>G, c.1514T>G, r.1514u>g, p.Leu505Arg
Original code P10
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30556
Feature /change: t -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1528
Feature /codon: ctg -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 505
Feature /change: L -> R
Feature /domain: NADPHBR
Phenotype X91 +
Diagnosis Classical X-linked CGD
Symptoms Persistent and severe sepsis associated with hepato- and
Symptoms splenomegaly, pneumonia, anterior uveitis intrairidal
Symptoms granuloma
Sex XY
Family history Inherited
//
ID L505R(3); standard; MUTATION; NADPHBR
Accession A1283
Systematic name g.30556T>G, c.1514T>G, r.1514u>g, p.Leu505Arg
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30556
Feature /change: t -> g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1528
Feature /codon: ctg -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 505
Feature /change: L -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #L505X514(1); standard; MUTATION; NADPHBR
Accession A1285
Systematic name g.30557_30567delGAAACAAAAGA, c.1515_1525delGAAACAAAAGA,
Systematic name r.1515_1525delgaaacaaaaga, p.Lys506fsX9
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30557..30567
Feature /change: -gaaacaaaag a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1529..1539
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 505..509
Feature /change: LKQKT -> LFVWTAQLGX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q507X(1); standard; MUTATION; NADPHBR
Accession A0116
Systematic name g.30561C>T, c.1519C>T, r.1519c>u, p.Gln507X
Original code III-30 ref [1]
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30561
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1533
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 507
Feature /change: Q -> X
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Q507X(2); standard; MUTATION; NADPHBR
Accession A1286
Systematic name g.30561C>T, c.1519C>T, r.1519c>u, p.Gln507X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30561
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1533
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 507
Feature /change: Q -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q507X(3); standard; MUTATION; NADPHBR
Accession A1287
Systematic name g.30561C>T, c.1519C>T, r.1519c>u, p.Gln507X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30561
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1533
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 507
Feature /change: Q -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q507X(4); standard; MUTATION; NADPHBR
Accession A1288
Systematic name g.30561C>T, c.1519C>T, r.1519c>u, p.Gln507X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30561
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1533
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 507
Feature /change: Q -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @Q507+1(1); standard; MUTATION; NADPHBR
Accession A0068
Systematic name g.30563_30567delinsCATCTGGG, c.1521_1525delinsCATCTGGG,
Systematic name r.1521_1525delinscaucuggg, p.Lys506_Gln507insHisIleTrpAla
Original code J4
Description An indel mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7756659
RefAuthors Azuma, H., Oomi, H., Sasaki, K., Kawabata, I., Sakaino, T.,
RefAuthors Koyano, S., Suzutani, T., Nunoi, H., Okuno, A.
RefTitle A new mutation in exon 12 of the gp91-phox gene leading to
RefTitle cytochrome b-positive X-linked chronic granulomatous
RefTitle disease
RefLoc Blood 85:3274-7 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 30563..30567
Feature /change: aaaga -> catctggg
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe insertion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1535..1539
Feature aa; 3
Feature /rnalink: 2
Feature /name: insertion; inframe
Feature /loc: GenBank: NP_000388: 507..509
Feature /change: QKT -> HIWA
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Japan
Family history Inherited
Comment Mother of the patient is the carrier
//
ID #K508X517(1); standard; MUTATION; NADPHBR
Accession A0313
Systematic name g.30564_30565delAA, c.1522_1523delAA, r.1522_1523delaa,
Systematic name p.Lys508fsX10
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30564..30565
Feature /change: -aa
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1536..1537
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 508
Feature /change: K -> DFVWTAQLGX
Feature /domain: NADPHBR
//
ID #K508X531(1); standard; MUTATION; NADPHBR
Accession A1291
Systematic name g.30566_30569delGACT, c.1524_1527delGACT,
Systematic name r.1524_1527delgacu, p.Lys508fsX24
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30566..30569
Feature /change: -gact
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1538..1541
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 508..509
Feature /change: KT -> NCMDGPTGIM NSRQLQVNTL IPEX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #K508X532(1); standard; MUTATION; NADPHBR
Accession A0314
Systematic name g.30565delA, c.1523delA, r.1523dela, p.Lys508fsX25
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30565
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1537
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 508
Feature /change: K -> RLCMDGPTGI MNSRQLQVNT LIPEX
Feature /domain: NADPHBR
Phenotype X91 0
//
ID #K508X532(2a); standard; MUTATION; NADPHBR
Accession A1289
Systematic name g.30565delA, c.1523delA, r.1523dela, p.Lys508fsX25
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30565
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1537
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 508
Feature /change: K -> RLCMDGPTGI MNSRQLQVNT LIPEX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1290
//
ID #K508X532(2b); standard; MUTATION; NADPHBR
Accession A1290
Systematic name g.30565delA, c.1523delA, r.1523dela, p.Lys508fsX25
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30565
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1537
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 508
Feature /change: K -> RLCMDGPTGI MNSRQLQVNT LIPEX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1289
//
ID #L510X517(1); standard; MUTATION; NADPHBR
Accession A0143
Systematic name g.30570_30571delTT, c.1528_1529delTT, r.1528_1529deluu,
Systematic name p.Leu510fsX8
Original code II-31 ref [2]
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30570..30571
Feature /change: -tt
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1542..1543
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 510
Feature /change: L -> VWTAQLGX
Feature /domain: NADPHBR
Phenotype X91 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID #L510X517(2); standard; MUTATION; NADPHBR
Accession A1292
Systematic name g.30570_30571delTT, c.1528_1529delTT, r.1528_1529deluu,
Systematic name p.Leu510fsX8
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30570..30571
Feature /change: -tt
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1542..1543
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 510
Feature /change: L -> VWTAQLGX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #L510X517(3); standard; MUTATION; NADPHBR
Accession A1293
Systematic name g.30570_30571delTT, c.1528_1529delTT, r.1528_1529deluu,
Systematic name p.Leu510fsX8
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30570..30571
Feature /change: -tt
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1542..1543
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 510
Feature /change: L -> VWTAQLGX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #L510X517(4); standard; MUTATION; NADPHBR
Accession A1441
Systematic name g.30570_30571delTT, c.1528_1529delTT, r.1528_1529deluu,
Systematic name p.Leu510fsX8
Original code DML
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 13-Apr-2015 (Rel. 2, Created)
Date 13-Apr-2015 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (13-Apr-2015) to CYBBbase.
RefLoc Antonio Ferreira-MarAna Bravo; Unidad de Inmunologia-Planta
RefLoc sotano-Hospital Infantil_Hospital La Paz-Castellana
RefLoc 261-28046 Madrid-Spain; Tel 917277234; Fax 917277095;
RefLoc e-mail antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30570..30571
Feature /change: -tt
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1542..1543
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 510
Feature /change: L -> VWTAQLGX
Feature /domain: NADPHBR
mRNA level N.D.
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms thrush, lateral cervical lymphadenitis M.simiae, pneumonia,
Symptoms palpebral abscess
Age 4.3
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier
//
ID Y511X(1); standard; MUTATION; NADPHBR
Accession A1294
Systematic name g.30575T>A, c.1533T>A, r.1533u>a, p.Tyr511X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30575
Feature /change: t -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1547
Feature /codon: tat -> taa; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 511
Feature /change: Y -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #Y511-1(2); standard; MUTATION; NADPHBR
Accession A0645
Systematic name g.30574_30580delinsTTCA, c.1532_1538delinsTTCA,
Systematic name r.1532_1538delinsuuca, p.Tyr511_Arg513delinsPheGln
Original code patient
Description An indel mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 04-Jun-2008 (Rel. 2, Created)
Date 04-Jun-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18402299
RefAuthors Jirapongsananuruk, O., Noack, D., Boonchoo, S., Thepthai,
RefAuthors C., Chokephaibulkit, K., Visitsunthorn, N., Vichyanond,
RefAuthors P., Luangwedchakarn, V., Likasitwattanakul, S.,
RefAuthors Piboonpocanun, S.
RefTitle A novel mutation of the CYBB gene resulting in severe form
RefTitle of X-linked chronic granulomatous disease.
RefLoc Asian Pac J Allergy Immunol:249-252 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 30574..30580
Feature /change: atggacg -> ttca
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1546..1552
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 511..513
Feature /change: YGR -> FQ
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Multiple Salmonella septicemia, Aspergillus pneumonia and
Symptoms brain abscesses
Sex XY
Ethnic origin Mongoloid
Family history De novo
//
ID G512R(1); standard; MUTATION; NADPHBR
Accession A1428
Systematic name g.30576G>A, c.1534G>A, r.1534g>a, p.Gly512Arg
Original code AGR
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 21-Oct-2013 (Rel. 2, Created)
Date 21-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (21-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia. Planta sAntano
RefLoc Hospital Infantil. Hospital La Paz. Castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30576
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1548
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 512
Feature /change: G -> R
Feature /domain: NADPHBR
Protein level Much reduced
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Meningitis by Samonella, perianal abscesses and recurrent
Symptoms pneumonias
Age 0.3
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier with discoid lupus
Relative who died due to respiratory infection by extreme negative
Relative lyonization. Brother CGD
//
ID G512R(2); standard; MUTATION; NADPHBR
Accession A1429
Systematic name g.30576G>A, c.1534G>A, r.1534g>a, p.Gly512Arg
Original code CGR
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 21-Oct-2013 (Rel. 2, Created)
Date 21-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (21-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia. Planta sAntano
RefLoc Hospital Infantil. Hospital La Paz. Castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30576
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1548
Feature /codon: gga -> aga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 512
Feature /change: G -> R
Feature /domain: NADPHBR
Protein level Much reduced
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms perianal abscesse,liver abscesse, spleen abscesse,renal
Symptoms abscesse
Age 0.3
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother carrier with discoid lupus
Relative who died due to respiratory infection by extreme negative
Relative lyonization. Brother CGD
Comment Exitus
//
ID W516C(1); standard; MUTATION; NADPHBR
Accession A0094
Systematic name g.30590G>T, c.1548G>T, r.1548g>u, p.Trp516Cys
Original code IV-28 ref [1]
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30590
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1562
Feature /codon: tgg -> tgt; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> C
Feature /domain: NADPHBR
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID W516R(1); standard; MUTATION; NADPHBR
Accession A0494
Systematic name g.30588T>C, c.1546T>C, r.1546u>c, p.Trp516Arg
Original code 91-40 ref [2]
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10068684
RefAuthors Kaneda, M., Sakuraba, H., Ohtake, A., Nishida, A., Kiryu,
RefAuthors C., Kakinuma, K.
RefTitle Missense mutations in the gp91-phox gene encoding
RefTitle cytochrome b558 in patients with cytochrome b positive and
RefTitle negative X-linked chronic granulomatous disease.
RefLoc Blood 93:2098-2104 (1999)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30588
Feature /change: t -> c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1560
Feature /codon: tgg -> cgg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> R
Feature /domain: NADPHBR
Phenotype X91 0
//
ID W516R(2); standard; MUTATION; NADPHBR
Accession A1295
Systematic name g.30588T>A, c.1546T>A, r.1546u>a, p.Trp516Arg
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30588
Feature /change: t -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1560
Feature /codon: tgg -> agg; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W516X(1); standard; MUTATION; NADPHBR
Accession A0295
Systematic name g.30590G>A, c.1548G>A, r.1548g>a, p.Trp516X
Original code E.O. ref [2]
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9794433
RefAuthors Dusi, S., Nadalini, K. A., Donini, M., Zentilin, L.,
RefAuthors Wientjes, F. B., Roos, D., Giacca, M., Rossi, F.
RefTitle Nicotinamide-adenine dinucleotide phosphate oxidase
RefTitle assembly and activation in EBV-transformed B
RefTitle lymphoblastoid cell lines of normal and chronic
RefTitle granulomatous disease patients.
RefLoc J Immunol 161:4968-4974 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30590
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1562
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Italian)
//
ID W516X(2); standard; MUTATION; NADPHBR
Accession A0296
Systematic name g.30590G>A, c.1548G>A, r.1548g>a, p.Trp516X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefLoc Dr. Dirk Roos, CLB, Plesmanlaan 125, 1066 CX Amsterdam,
RefLoc The Netherlands., Tel 31-20-5123377, Fax 31-20-5123474,
RefLoc e-mail d_roos@clb.nl
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30590
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1562
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Sex XY
Ethnic origin Caucasian (Italian)
//
ID W516X(3); standard; MUTATION; NADPHBR
Accession A0570
Systematic name g.30589G>A, c.1547G>A, r.1547g>a, p.Trp516X
Original code P7
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30589
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 1561
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Sepsis associated with probable liver abscesses, fungal
Symptoms esophageal necrosis, limb abscess
Sex XY
Family history Inherited
//
ID W516X(4); standard; MUTATION; NADPHBR
Accession A1296
Systematic name g.30589G>A, c.1547G>A, r.1547g>a, p.Trp516X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30589
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1561
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W516X(5); standard; MUTATION; NADPHBR
Accession A1297
Systematic name g.30589G>A, c.1547G>A, r.1547g>a, p.Trp516X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30589
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1561
Feature /codon: tgg -> tag; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID W516X(6); standard; MUTATION; NADPHBR
Accession A1298
Systematic name g.30590G>A, c.1548G>A, r.1548g>a, p.Trp516X
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30590
Feature /change: g -> a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1562
Feature /codon: tgg -> tga; 3
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 516
Feature /change: W -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #D517X532(1); standard; MUTATION; NADPHBR
Accession A1299
Systematic name g.30591delG, c.1549delG, r.1549delg, p.Asp517fsX16
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30591
Feature /change: -g
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1563
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 517
Feature /change: D -> IMNSRQLQVN TLIPEX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID E519X(1); standard; MUTATION; NADPHBR
Accession A0059
Systematic name g.30597G>T, c.1555G>T, r.1555g>u, p.Glu519X
Original code pat. 6 ref [1]
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8916969
RefAuthors Hui, Y. F., Chan, S. Y., Lau, Y. L.
RefTitle Identification of mutations in seven chinese patients with
RefTitle X-linked chronic granulomatous disease.
RefLoc Blood 88:4021-4028 (1996)
RefNumber [2]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30597
Feature /change: g -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1569
Feature /codon: gaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 519
Feature /change: E -> X
Feature /domain: NADPHBR
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level Normal
NBT-slide 0
Symptoms Classical CGD
Sex XY
Ethnic origin Chinese
//
ID K521X(1); standard; MUTATION; NADPHBR
Accession A0025
Systematic name g.30603A>T, c.1561A>T, r.1561a>u, p.Lys521X
Original code VIII-38 ref [1]
Description A point mutation in the exon 12 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30603
Feature /change: a -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1575
Feature /codon: aag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 521
Feature /change: K -> X
Feature /domain: NADPHBR
mRNA level 0
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Belgian)
//
ID #T522X532(1); standard; MUTATION; NADPHBR
Accession A0326
Systematic name g.30607delC, c.1565delC, r.1565delc, p.Thr522fsX11
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30607
Feature /change: -c
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1579
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 522
Feature /change: T -> KLQVNTLIPE X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID A524V(1); standard; MUTATION; NADPHBR
Accession A1301
Systematic name g.30613C>T, c.1571C>T, r.1571c>u, p.Ala524Val
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30613
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1585
Feature /codon: gca -> gta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 524
Feature /change: A -> V
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID A524V(2); standard; MUTATION; NADPHBR
Accession A1302
Systematic name g.30613C>T, c.1571C>T, r.1571c>u, p.Ala524Val
Description A point mutation in the exon 12 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30613
Feature /change: c -> t
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1585
Feature /codon: gca -> gta; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 524
Feature /change: A -> V
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #Q526X532(1); standard; MUTATION; NADPHBR
Accession A0319
Systematic name g.30620delA, c.1578delA, r.1578dela, p.Gln526fsX7
Description A frame shift deletion mutation in the exon 12 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 15577746
RefAuthors Jurkowska, M., Kurenko-Deptuch, M., Bal, J., Roos, D.
RefTitle The search for a genetic defect in polish patients with
RefTitle chronic granulomatous disease.
RefLoc Arch Immunol Ther Exp (Warsz):441-446 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 30620
Feature /change: -a
Feature /genomic_region: exon; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1592
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 526
Feature /change: Q -> HTLIPEX
Feature /domain: NADPHBR
Phenotype X91 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Polish)
//
ID #G533-1(1); standard; MUTATION; NADPHBR
Accession A1308
Systematic name g.31739_31741delGAG, c.1598_1600delGAG, r.1598_1600delgag,
Systematic name p.Gly533del
Description An inframe deletion in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31739..31741
Feature /change: -gag
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1612..1614
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 533..534
Feature /change: GV -> V
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #G533-1(2); standard; MUTATION; NADPHBR
Accession A1309
Systematic name g.31739_31741delGAG, c.1598_1600delGAG, r.1598_1600delgag,
Systematic name p.Gly533del
Description An inframe deletion in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31739..31741
Feature /change: -gag
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1612..1614
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 533..534
Feature /change: GV -> V
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID V534D(1); standard; MUTATION; NADPHBR
Accession A0147
Systematic name g.31742T>A, c.1601T>A, r.1601u>a, p.Val534Asp
Original code IV-29 ref [2]
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31742
Feature /change: t -> a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1615
Feature /codon: gtt -> gat; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 534
Feature /change: V -> D
Feature /domain: NADPHBR
Symptoms Classical CGD
Sex XY
Family history Inherited, mother carrier
//
ID #V534-5(1); standard; MUTATION; NADPHBR
Accession A0329
Systematic name g.31741_31755delGTTTTCCTCTGTGGA,
Systematic name c.1600_1614delGTTTTCCTCTGTGGA,
Systematic name r.1600_1614delguuuuccucugugga, p.Val534_Pro539del
Description An inframe deletion in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31741..31755
Feature /change: -gttttcctct gtgga
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1614..1628
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: GenBank: NP_000388: 534..538
Feature /change: -VFLCG
Feature /domain: NADPHBR
Phenotype X91 -
//
ID #F535X544(1); standard; MUTATION; NADPHBR
Accession A1310
Systematic name g.31744_31750delTTCCTCT, c.1603_1609delTTCCTCT,
Systematic name r.1603_1609deluuccucu, p.Phe535fsX10
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31744..31750
Feature /change: -ttcctct
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1617..1623
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 535..537
Feature /change: FLC -> VDLKPWLKPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @L536X540(1); standard; MUTATION; NADPHBR
Accession A0345
Systematic name g.31748dupT, c.1607dupT, r.1607dupu, p.Cys537fsX4
Description A frame shift duplication mutation in the exon 13 leading
Description to a premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31749
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1622
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 536
Feature /change: L -> LLWTX
Feature /domain: NADPHBR
//
ID C537R(1); standard; MUTATION; NADPHBR
Accession A0199
Systematic name g.31750T>C, c.1609T>C, r.1609u>c, p.Cys537Arg
Original code IV-30 ref [1]
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31750
Feature /change: t -> c
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1623
Feature /codon: tgt -> cgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 537
Feature /change: C -> R
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal (100%)
Heme level Normal
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID C537R(2); standard; MUTATION; NADPHBR
Accession A0545
Systematic name g.31750T>C, c.1609T>C, r.1609u>c, p.Cys537Arg
Original code Ref. [1] X91+ patient, Ref. [2] Patient 1
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 19-Oct-2006 (Rel. 2, Created)
Date 09-Apr-2008 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 12139950
RefAuthors Jirapongsananuruk, O., Niemela, J. E., Malech, H. L.,
RefAuthors Fleisher, T. A.
RefTitle CYBB mutation analysis in X-linked chronic granulomatous
RefTitle disease.
RefLoc Clin Immunol 104:73-76 (2002)
RefNumber [2]
RefCrossRef PUBMED; 12589359
RefAuthors Jirapongsananuruk, O., Malech, H. L., Kuhns, D. B.,
RefAuthors Niemela, J. E., Brown, M. R., Anderson-Cohen, M.,
RefAuthors Fleisher, T. A.
RefTitle Diagnostic paradigm for evaluation of male patients with
RefTitle chronic granulomatous disease, based on the
RefTitle dihydrorhodamine 123 assay.
RefLoc J Allergy Clin Immunol 111:374-379 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31750
Feature /change: t -> c
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025: 1623
Feature /codon: tgt -> cgt; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 537
Feature /change: C -> R
Feature /domain: NADPHBR
Phenotype X91 +
Diagnosis Classical X-linked CGD
//
ID #C537X539(1); standard; MUTATION; NADPHBR
Accession A1311
Systematic name g.31752_31753delTG, c.1611_1612delTG, r.1611_1612delug,
Systematic name p.Cys537fsX3
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31752..31753
Feature /change: -tg
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1625..1626
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 537..538
Feature /change: CG -> WTX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #E540X546(1); standard; MUTATION; NADPHBR
Accession A0537
Systematic name g.31759delG, c.1618delG, r.1618delg, p.Glu540fsX7
Original code J.V.V.
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 12-Apr-2004 (Rel. 7, Created)
Date 12-Apr-2004 (Rel. 7, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (12-Apr-2004) to CYBBbase.
RefLoc A.Ferreira, M.C. Garcia Rodriguez, G.Fontan; Servicio de
RefLoc Inmunologia-Edificio Anatomia Patologica-Hospital La
RefLoc Paz-Castellana 261-28046 Madrid-Espana; Tel 917277238; Fax
RefLoc 917277095; e-mail aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31759
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025: 1632
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 540
Feature /change: E -> KPWLKPX
Feature /domain: NADPHBR
mRNA level N.D.
Protein level Absent
Sex XY
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Carriers: mother and sister
//
ID #E540X546(2a); standard; MUTATION; NADPHBR
Accession A1312
Systematic name g.31759delG, c.1618delG, r.1618delg, p.Glu540fsX7
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31759
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1632
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 540
Feature /change: E -> KPWLKPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1313
//
ID #E540X546(2b); standard; MUTATION; NADPHBR
Accession A1313
Systematic name g.31759delG, c.1618delG, r.1618delg, p.Glu540fsX7
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31759
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1632
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 540
Feature /change: E -> KPWLKPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1312
//
ID L542S(1); standard; MUTATION; NADPHBR
Accession A0082
Systematic name g.31766T>C, c.1625T>C, r.1625u>c, p.Leu542Ser
Original code HA ref [Gahr]
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31766
Feature /change: t -> c
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1639
Feature /codon: ttg -> tcg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 542
Feature /change: L -> S
Feature /domain: NADPHBR
Phenotype X91 0
Oxidase act. 0
NBT-slide 0
Symptoms Mild CGD
Sex XY
//
ID @L542X545(1); standard; MUTATION; NADPHBR
Accession A0183
Systematic name g.31763_31766dup, c.1622_1625dup, r.1622_1625dup,
Systematic name p.Leu542fsX4
Original code II-32 ref [2]
Description A frame shift duplication mutation in the exon 13 leading
Description to a premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31767
Feature /change: +cctt
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1640
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 542
Feature /change: L -> FLGX
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID L546P(1); standard; MUTATION; NADPHBR
Accession A0409
Systematic name g.31778T>C, c.1637T>C, r.1637u>c, p.Leu546Pro
Original code VP1 ref [1]
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31778
Feature /change: t -> c
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1651
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 546
Feature /change: L -> P
Feature /domain: NADPHBR
Phenotype X91 +
Protein level 100% (7D5)
Oxidase act. 2,1-7,2% (H2O2-prod.)
//
ID L546R(1); standard; MUTATION; NADPHBR
Accession A1314
Systematic name g.31778T>G, c.1637T>G, r.1637u>g, p.Leu546Arg
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31778
Feature /change: t -> g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1651
Feature /codon: ctg -> cgg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 546
Feature /change: L -> R
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID K548X(1); standard; MUTATION; NADPHBR
Accession A1315
Systematic name g.31783A>T, c.1642A>T, r.1642a>u, p.Lys548X
Description A point mutation in the exon 13 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31783
Feature /change: a -> t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1656
Feature /codon: aaa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 548
Feature /change: K -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Q549X(1); standard; MUTATION; NADPHBR
Accession A0297
Systematic name g.31786C>T, c.1645C>T, r.1645c>u, p.Gln549X
Description A point mutation in the exon 13 leading to a premature stop
Description codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31786
Feature /change: c -> t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1659
Feature /codon: caa -> taa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 549
Feature /change: Q -> X
Feature /domain: NADPHBR
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID #N553X576(1); standard; MUTATION; NADPHBR
Accession A1316
Systematic name g.31799delA, c.1658delA, r.1658dela, p.Asn553fsX24
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31799
Feature /change: -a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1672
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 553
Feature /change: N -> TLSLALGECI SFSTRKTSNL SLPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID S554X(1); standard; MUTATION; NADPHBR
Accession A1317
Systematic name g.31802_31803delCT, c.1661_1662delCT, r.1661_1662delcu,
Systematic name p.Ser554X
Description A deletion mutation in the exon 13 leading to a premature
Description stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31802..31803
Feature /change: -ct
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1675..1676
Feature /codon: tct -> tga; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 554
Feature /change: S -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @S554X564(1); standard; MUTATION; NADPHBR
Accession A0300
Systematic name g.31802_31803insGAGTCTGGCCCTCGGGGAGTGCATTTCA,
Systematic name c.1661_1662insGAGTCTGGCCCTCGGGGAGTGCATTTCA,
Systematic name r.1661_1662insgagucuggcccucggggagugcauuuca, p.Glu555fsX10
Description A frame shift insertion mutation in the exon 13 leading to
Description a premature stop codon in the NADPHBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7579466
RefAuthors Bu-Ghanim, H. N., Segal, A. W., Keep, N. H., Casimir, C. M.
RefTitle Molecular analysis in three cases of X91- variant chronic
RefTitle granulomatous disease
RefLoc Blood 86:3575-82 (1995)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 31803
Feature /change: +gagtctggcc ctcggggagt gcatttca
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1676
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 554
Feature /change: S -> SSLALGECIS X
Feature /domain: NADPHBR
Protein struct. Premature stop
Diagnosis Classical X-linked CGD
Sex XY
//
ID @S554X564(2); standard; MUTATION; NADPHBR
Accession A1321
Systematic name g.31802_31803insGAGTCTGGCCCTCGGGGAGTGCATTTCA,
Systematic name c.1661_1662insGAGTCTGGCCCTCGGGGAGTGCATTTCA,
Systematic name r.1661_1662insgagucuggcccucggggagugcauuuca, p.Glu555fsX10
Description A frame shift insertion mutation in the exon 13 leading to
Description a premature stop codon in the NADPHBR domain
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 31803
Feature /change: +gagtctggcc ctcggggagt gcatttca
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1676
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 554
Feature /change: S -> SSLALGECIS X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @E555X(1); standard; MUTATION; NADPHBR
Accession A0302
Systematic name g.31803dupT, c.1662dupT, r.1662dupu, p.Glu555X
Description A duplication mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1677
Feature /codon: gag -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> X
Feature /domain: NADPHBR
Phenotype X91 0
Protein level 0
NBT-slide 0
Sex XY
Family history Inherited, mother is carrier
//
ID @E555X(2); standard; MUTATION; NADPHBR
Accession A0348
Systematic name g.31803dupT, c.1662dupT, r.1662dupu, p.Glu555X
Description A duplication mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1677
Feature /codon: gag -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> X
Feature /domain: NADPHBR
Phenotype X91 0
//
ID @E555X(3); standard; MUTATION; NADPHBR
Accession A0556
Systematic name g.31803dupT, c.1662dupT, r.1662dupu, p.Glu555X
Original code Patient 1
Description A duplication mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15082894
RefAuthors Oh, H. B., Park, J. S., Lee, W., Yoo, S. J., Yang, J. H.,
RefAuthors Oh, S. Y.
RefTitle Molecular analysis of X-linked chronic granulomatous
RefTitle disease in five unrelated korean patients.
RefLoc J Korean Med Sci:218-222 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025: 1677
Feature /codon: gag -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Recurrent anal abscesses and inguinal lymphadenopathy,
Symptoms pneumonia, sepsis, disseminated intravascular coagulation,
Symptoms acute renal failure, and hepatitis
Ethnic origin Mongoloid; Korea
Comment Patient died of septic shock
//
ID @E555X(4); standard; MUTATION; NADPHBR
Accession A1318
Systematic name g.31803dupT, c.1662dupT, r.1662dupu, p.Glu555X
Description A duplication mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1677
Feature /codon: gag -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @E555X(5); standard; MUTATION; NADPHBR
Accession A1319
Systematic name g.31803dupT, c.1662dupT, r.1662dupu, p.Glu555X
Description A duplication mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1677
Feature /codon: gag -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID @E555X577(1); standard; MUTATION; NADPHBR
Accession A1320
Systematic name g.31803_31804insGT, c.1662_1663insGT, r.1662_1663insgu,
Systematic name p.Glu555fsX23
Description A frame shift insertion mutation in the exon 13 leading to
Description a premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 31804
Feature /change: +gt
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1677
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 555
Feature /change: E -> VSLALGECIS FSTRKTSNLS LPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID G560X(1); standard; MUTATION; NADPHBR
Accession A1322
Systematic name g.31819G>T, c.1678G>T, r.1678g>u, p.Gly560X
Description A point mutation in the exon 13 leading to a premature stop
Description codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31819
Feature /change: g -> t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1692
Feature /codon: gga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 560
Feature /change: G -> X
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #G560X576(1); standard; MUTATION; NADPHBR
Accession A0307
Systematic name g.31820delG, c.1679delG, r.1679delg, p.Gly560fsX17
Original code patient 2 ref [?]
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11997079
RefAuthors Lin, S. J., Huang, Y. F., Chen, J. Y., Heyworth, P. G.,
RefAuthors Noack, D., Wang, J. Y., Lin, C. Y., Chiang, B. L., Yang,
RefAuthors C. M., Liu, C. C., Shieh, C. C.
RefTitle Molecular quality control machinery contributes to the
RefTitle leukocyte NADPH oxidase deficiency in chronic
RefTitle granulomatous disease.
RefLoc Biochim Biophys Acta:275-286 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31820
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1693
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 560
Feature /change: G -> ECISFSTRKT SNLSLPX
Feature /domain: NADPHBR
mRNA level Normal
Phenotype X91 0
Sex XY
Family history Inherited, mother is carrier
//
ID #G560X576(2); standard; MUTATION; NADPHBR
Accession A1323
Systematic name g.31820delG, c.1679delG, r.1679delg, p.Gly560fsX17
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31820
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1693
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 560
Feature /change: G -> ECISFSTRKT SNLSLPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #G560X576(3); standard; MUTATION; NADPHBR
Accession A1324
Systematic name g.31820delG, c.1679delG, r.1679delg, p.Gly560fsX17
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31820
Feature /change: -g
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1693
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 560
Feature /change: G -> ECISFSTRKT SNLSLPX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID #V561X566(1); standard; MUTATION; NADPHBR
Accession A0155
Systematic name g.31823_31853del, c.1682_1712del, r.1682_1712del,
Systematic name p.Val561fsX6
Original code I-12 ref [2]
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31823..31853
Feature /change: -tgcatttcat tttcaacaag gaaaacttct a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1696..1726
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 561..571
Feature /change: VHFIFNKENF X -> DLSLPX
Feature /domain: NADPHBR
Phenotype X91 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother is carrier
Comment Patient deceased
//
ID #V561X566(2); standard; MUTATION; NADPHBR
Accession A1325
Systematic name g.31823_31853del, c.1682_1712del, r.1682_1712del,
Systematic name p.Val561fsX6
Description A frame shift deletion mutation in the exon 13 leading to a
Description premature stop codon in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 31823..31853
Feature /change: -tgcatttcat tttcaacaag gaaaacttct a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1696..1726
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 561..571
Feature /change: VHFIFNKENF X -> DLSLPX
Feature /domain: NADPHBR
Diagnosis Mild X-linked CGD
//
ID @F565X593(1); standard; MUTATION; NADPHBR
Accession A1326
Systematic name g.31835dupT, c.1694dupT, r.1694dupu, p.Asn566fsX28
Description A frame shift duplication mutation in the exon 13 leading
Description to a premature stop codon in the NADPHBR domain
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 31836
Feature /change: +t
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1709
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 565
Feature /change: F -> FQQGKLLTCL FHEEINVGCA AKCSNNANX
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID E568K(1); standard; MUTATION; NADPHBR
Accession A0259
Systematic name g.31843G>A, c.1702G>A, r.1702g>a, p.Glu568Lys
Original code DG ref [1]
Description A point mutation in the exon 13 leading to an amino acid
Description change in the NADPHBR domain
Date 26-Jul-2002 (Rel. 2, Created)
Date 12-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10627478
RefAuthors Leusen, J. H., Meischl, C., Eppink, M. H., Hilarius, P.
RefAuthors M., de Boer, M., Weening, R. S., Ahlin, A., Sanders, L.,
RefAuthors Goldblatt, D., Skopczynska, H., Bernatowska, E., Palmblad,
RefAuthors J., Verhoeven, A. J., van Berkel, W. J., Roos, D.
RefTitle Four novel mutations in the gene encoding gp91-phox of
RefTitle human NADPH oxidase: consequences for oxidase assembly.
RefLoc Blood 95:666-673 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31843
Feature /change: g -> a
Feature /genomic_region: exon; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0025; GI:6996021; CYBBC: 1716
Feature /codon: gaa -> aaa; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: GenBank: NP_000388: 568
Feature /change: E -> K
Feature /domain: NADPHBR
Phenotype X91 +
Protein level Normal
Heme level Normal
Oxidase act. 0.07
NBT-slide 0
Symptoms Classical CGD
Sex XY
Family history Inherited, mother is carrier
Comment Maternal mother is carrier
//
ID Upstream(1a); standard; MUTATION;
Accession A0089
Systematic name g.946A>C, c.A>C, r.a>c
Original code VII-01 ref [2];VI-01 ref [3]
Description Point mutation in the promoter region 55 bp to upstream
Description from cDNA start point
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8083361
RefAuthors Newburger, P. E., Skalnik, D. G., Hopkins, P. J., Eklund,
RefAuthors E. A., Curnutte, J. T.
RefTitle Mutations in the promoter region of the gene for gp91-phox
RefTitle in X-linked chronic granulomatous disease with decreased
RefTitle expression of cytochrome b558.
RefLoc J Clin Invest 94:1205-1211 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 946
Feature /change: a -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -55
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Phenotype X91 -
Protein level Strongly decreased
Oxidase act. Strongly decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0090; brother
//
ID Upstream(1b); standard; MUTATION;
Accession A0090
Systematic name g.946A>C, c.A>C, r.a>c
Original code VII-01 ref [2];VI-01 ref [3]
Description Point mutation in the promoter region 55 bp to upstream
Description from cDNA start point
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8083361
RefAuthors Newburger, P. E., Skalnik, D. G., Hopkins, P. J., Eklund,
RefAuthors E. A., Curnutte, J. T.
RefTitle Mutations in the promoter region of the gene for gp91-phox
RefTitle in X-linked chronic granulomatous disease with decreased
RefTitle expression of cytochrome b558.
RefLoc J Clin Invest 94:1205-1211 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /name: point
Feature /loc: IDRefSeq: D0025: 946
Feature /change: a -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -55
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Phenotype X91 -
Protein level Strongly decreased
Oxidase act. Strongly decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0089; brother
//
ID Upstream(2); standard; MUTATION;
Accession A0166
Systematic name g.948T>C, c.T>C, r.u>c
Original code M.P. ref [1];VII-02 ref [2];VI-02 ref [3]
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8083361
RefAuthors Newburger, P. E., Skalnik, D. G., Hopkins, P. J., Eklund,
RefAuthors E. A., Curnutte, J. T.
RefTitle Mutations in the promoter region of the gene for gp91-phox
RefTitle in X-linked chronic granulomatous disease with decreased
RefTitle expression of cytochrome b558.
RefLoc J Clin Invest 94:1205-1211 (1994)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [3]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 948
Feature /change: t -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -53
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
//
ID Upstream(3); standard; MUTATION;
Accession A0472
Systematic name g.950C>T, c.C>T, r.c>u
Original code 91-1 ref [3]
Description Point mutation in the promoter region 51 bp to upstream
Description from cDNA start point
Date 26-Jul-2002 (Rel. 2, Created)
Date 30-Oct-2006 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 7726828
RefAuthors Kuribayashi, F., Kumatori, A., Suzuki, S., Nakamura, M.,
RefAuthors Matsumoto, T., Tsuji, Y.
RefTitle Human peripheral eosinophils have a specific mechanism to
RefTitle express gp91-phox, the large subunit of cytochrome b558.
RefLoc Biochem Biophys Res Commun 209:146-152 (1995)
RefNumber [2]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [3]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 950
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -51
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Phenotype X91 -
//
ID Upstream(4a); standard; MUTATION;
Accession A0546
Systematic name g.951C>T, c.C>T, r.c>u
Original code Family A; III-4
Description Point mutation in the promoter region 50 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 11122248
RefAuthors Weening, R. S., De Boer, M., Kuijpers, T. W., Neefjes, V.
RefAuthors M., Hack, W. W., Roos, D.
RefTitle Point mutations in the promoter region of the CYBB gene
RefTitle leading to mild chronic granulomatous disease.
RefLoc Clin Exp Immunol:410-417 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9600921
RefAuthors Suzuki, S., Kumatori, A., Haagen, I. A., Fujii, Y., Sadat,
RefAuthors M. A., Jun, H. L., Tsuji, Y., Roos, D., Nakamura, M.
RefTitle PU.1 as an essential activator for the expression of
RefTitle gp91(phox) gene in human peripheral neutrophils,
RefTitle monocytes, and B lymphocytes.
RefLoc Proc Natl Acad Sci U S A:6085-6090 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 951
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -50
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0547; uncle
Relative CYBBbase; A0646; uncle
//
ID Upstream(4b); standard; MUTATION;
Accession A0547
Systematic name g.951C>T, c.C>T, r.c>u
Original code Family A; II-1
Description Point mutation in the promoter region 50 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 2)
RefNumber [1]
RefCrossRef PUBMED; 11122248
RefAuthors Weening, R. S., De Boer, M., Kuijpers, T. W., Neefjes, V.
RefAuthors M., Hack, W. W., Roos, D.
RefTitle Point mutations in the promoter region of the CYBB gene
RefTitle leading to mild chronic granulomatous disease.
RefLoc Clin Exp Immunol:410-417 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9600921
RefAuthors Suzuki, S., Kumatori, A., Haagen, I. A., Fujii, Y., Sadat,
RefAuthors M. A., Jun, H. L., Tsuji, Y., Roos, D., Nakamura, M.
RefTitle PU.1 as an essential activator for the expression of
RefTitle gp91(phox) gene in human peripheral neutrophils,
RefTitle monocytes, and B lymphocytes.
RefLoc Proc Natl Acad Sci U S A:6085-6090 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 951
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -50
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0546; nephew
Relative CYBBbase; A0646; brother
//
ID Upstream(4c); standard; MUTATION;
Accession A0646
Systematic name g.951C>T, c.C>T, r.c>u
Original code Family A; II-2
Description Point mutation in the promoter region 50 bp to upstream
Description from cDNA start point
Date 13-Aug-2010 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11122248
RefAuthors Weening, R. S., De Boer, M., Kuijpers, T. W., Neefjes, V.
RefAuthors M., Hack, W. W., Roos, D.
RefTitle Point mutations in the promoter region of the CYBB gene
RefTitle leading to mild chronic granulomatous disease.
RefLoc Clin Exp Immunol:410-417 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9600921
RefAuthors Suzuki, S., Kumatori, A., Haagen, I. A., Fujii, Y., Sadat,
RefAuthors M. A., Jun, H. L., Tsuji, Y., Roos, D., Nakamura, M.
RefTitle PU.1 as an essential activator for the expression of
RefTitle gp91(phox) gene in human peripheral neutrophils,
RefTitle monocytes, and B lymphocytes.
RefLoc Proc Natl Acad Sci U S A:6085-6090 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 951
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -50
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Sex XY
Relative CYBBbase; A0546; nephew
Relative CYBBbase; A0547; brother
Comment Died of nocardia infection at the age of 34 years
Comment Daughterof the patient was carrier of the mutation but
Comment the wife was not.
//
ID Upstream(5a); standard; MUTATION;
Accession A0548
Systematic name g.950C>T, c.C>T, r.c>u
Original code Family B; III-4
Description Point mutation in the promoter region 51 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11122248
RefAuthors Weening, R. S., De Boer, M., Kuijpers, T. W., Neefjes, V.
RefAuthors M., Hack, W. W., Roos, D.
RefTitle Point mutations in the promoter region of the CYBB gene
RefTitle leading to mild chronic granulomatous disease.
RefLoc Clin Exp Immunol:410-417 (2000)
RefNumber [2]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 950
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -51
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0549; brother
//
ID Upstream(5b); standard; MUTATION;
Accession A0549
Systematic name g.950C>T, c.C>T, r.c>u
Original code Family B; III-5
Description Point mutation in the promoter region 51 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11122248
RefAuthors Weening, R. S., De Boer, M., Kuijpers, T. W., Neefjes, V.
RefAuthors M., Hack, W. W., Roos, D.
RefTitle Point mutations in the promoter region of the CYBB gene
RefTitle leading to mild chronic granulomatous disease.
RefLoc Clin Exp Immunol:410-417 (2000)
RefNumber [2]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 950
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -51
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0548; brother
//
ID Upstream(6a); standard; MUTATION;
Accession A0550
Systematic name g.948T>C, c.T>C, r.u>c
Original code Patient A
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14624387
RefAuthors Stasia, M. J., Brion, J. P., Boutonnat, J., Morel, F.
RefTitle Severe clinical forms of cytochrome b-negative chronic
RefTitle granulomatous disease (X91-) in 3 brothers with a point
RefTitle mutation in the promoter region of CYBB.
RefLoc J Infect Dis:1593-1604 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 948
Feature /change: t -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -53
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0551; brother
Relative CYBBbase; A0552; brother
//
ID Upstream(6b); standard; MUTATION;
Accession A0551
Systematic name g.948T>C, c.T>C, r.u>c
Original code Patient B
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14624387
RefAuthors Stasia, M. J., Brion, J. P., Boutonnat, J., Morel, F.
RefTitle Severe clinical forms of cytochrome b-negative chronic
RefTitle granulomatous disease (X91-) in 3 brothers with a point
RefTitle mutation in the promoter region of CYBB.
RefLoc J Infect Dis:1593-1604 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 948
Feature /change: t -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -53
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0550; brother
Relative CYBBbase; A0552; brother
//
ID Upstream(6c); standard; MUTATION;
Accession A0552
Systematic name g.948T>C, c.T>C, r.u>c
Original code Patient C
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14624387
RefAuthors Stasia, M. J., Brion, J. P., Boutonnat, J., Morel, F.
RefTitle Severe clinical forms of cytochrome b-negative chronic
RefTitle granulomatous disease (X91-) in 3 brothers with a point
RefTitle mutation in the promoter region of CYBB.
RefLoc J Infect Dis:1593-1604 (2003)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 948
Feature /change: t -> c
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -53
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0550; brother
Relative CYBBbase; A0551; brother
//
ID Upstream (7a); standard; MUTATION;
Accession A0649
Systematic name g.948dupT, c._insT, r._insu
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 950
Feature /genomic_region: 5' gene flanking region
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -51
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0650;
//
ID Upstream (7b); standard; MUTATION;
Accession A0650
Systematic name g.948dupT, c._insT, r._insu
Description Point mutation in the promoter region 53 bp to upstream
Description from cDNA start point
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /loc: IDRefSeq: D0025: 950
Feature /genomic_region: 5' gene flanking region
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -51
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0649;
//
ID Upstream(8a); standard; MUTATION;
Accession A0651
Systematic name g.951C>T, c.C>T, r.c>u
Description Point mutation in the promoter region 50 bp to upstream
Description from cDNA start point
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 951
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -50
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Relative CYBBbase; A0652;
//
ID Upstream(8b); standard; MUTATION;
Accession A0652
Systematic name g.951C>T, c.C>T, r.c>u
Description Point mutation in the promoter region 50 bp to upstream
Description from cDNA start point
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 951
Feature /change: c -> t
Feature /genomic_region: promoter
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: upstream
Feature /inexloc: -50
Feature aa; 3
Feature /rnalink: 2
Feature /name: no translation
Diagnosis Mild X-linked CGD
Relative CYBBbase; A0651;
//
ID Intron 1(1); standard; MUTATION; NTERM
Accession A0003
Systematic name g.1064G>A, c.45+5G>A, r.45+5g>a
Original code VI-01 ref [1]
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1064
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level Reduced
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
//
ID Intron 1(2a); standard; MUTATION; NTERM
Accession A0134
Systematic name g.1065T>C, c.45+6T>C, r.45+6u>c
Original code V-01 ref [1]
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [2]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1065
Feature /change: t -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0135; brother
//
ID Intron 1(2b); standard; MUTATION; NTERM
Accession A0135
Systematic name g.1065T>C, c.45+6T>C, r.45+6u>c
Original code V-01 ref [1]
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [2]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1065
Feature /change: t -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 -
Protein level Decreased
Oxidase act. Decreased
Symptoms Mild CGD
Sex XY
Relative CYBBbase; A0134; brother
//
ID Intron 1(3); standard; MUTATION; NTERM
Accession A0223
Systematic name g.1060G>C, c.45+1G>C, r.45+1g>c
Original code CP2 ref [2]
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: g -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0% (7D5)
Oxidase act. 0% (H2O2-prod.)
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian (German)
Family history Inherited, mother carrier
//
ID Intron 1(4); standard; MUTATION; NTERM
Accession A0224
Systematic name g.3024G>A, c.46-1G>A, r.46-1g>a
Original code VI-02 ref [2]
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1520880
RefAuthors de Boer, M., Bolscher, B. G., Dinauer, M. C., Orkin, S.
RefAuthors H., Smith, C. I., Ahlin, A., Weening, R. S., Roos, D.
RefTitle Splice site mutations are a common cause of X-linked
RefTitle chronic granulomatous disease.
RefLoc Blood 80:1553-1558 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3024
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Swedish)
//
ID Intron 1(5); standard; MUTATION; NTERM
Accession A0498
Systematic name g.3023A>G, c.46-2A>G, r.46-2a>g
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3023
Feature /change: a -> g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
Family history Inherited, mother carrier
//
ID Intron 1(6); standard; MUTATION; NTERM
Accession A0499
Systematic name g.3023A>G, c.46-2A>G, r.46-2a>g
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3023
Feature /change: a -> g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
Comment Mother is carrier
//
ID Intron 1(7); standard; MUTATION; NTERM
Accession A0500
Systematic name g.3024G>A, c.46-1G>A, r.46-1g>a
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3024
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 1(8); standard; MUTATION; NTERM
Accession A0592
Systematic name g.IVS1+1G>A, c.45+1G>A, r.45+1g>a
Original code 14. A.K.
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Pulmonary aspergillosis, recurrent fever, anemia,
Symptoms lymphadenopathy, lymph node abscesses (Staphylococcus
Symptoms aureus)
Age 8 mo
Family history Inherited
//
ID Intron 1(9); standard; MUTATION; NTERM
Accession A0593
Systematic name g.IVS1-1G>T, c.46-1G>T, r.46-1g>u
Original code 15. D.A.
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3024
Feature /change: g -> t
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 ?
Diagnosis Classical X-linked CGD
Symptoms Recurrent lymphadenitis
Family history Inherited
//
ID Intron 1(10); standard; MUTATION; NTERM
Accession A0625
Systematic name g.IVS1-1G>C, c.46-1G>C, r.46-1g>c
Original code P1
Description A point mutation in the intron 1 leading to an amino acid
Description change in the NTERM domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3024
Feature /change: g -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent pneumonia, perianal pustules
Sex XY
Ethnic origin Mongoloid
Family history Inherited
//
ID Intron 1(11); standard; MUTATION; NTERM
Accession A0661
Systematic name g.1060G>C, c.45+1G>C, r.45+1g>c
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: g -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(12); standard; MUTATION; NTERM
Accession A0662
Systematic name g.1060G>C, c.45+1G>C, r.45+1g>c
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: g -> c
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(13); standard; MUTATION; NTERM
Accession A0663
Systematic name g.1060G>T, c.45+1G>T, r.45+1g>u
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: g -> t
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(14); standard; MUTATION; NTERM
Accession A0664
Systematic name g.1060delG, c.45+1delG, r.45+1delg
Description A deletion in the intron 1 leading to aberrant splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 1060
Feature /change: -g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(15); standard; MUTATION; NTERM
Accession A0665
Systematic name g.1064G>A, c.45+5G>A, r.45+5g>a
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 1064
Feature /change: g -> a
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(16); standard; MUTATION; NTERM
Accession A0666
Systematic name g.1064_1066delGTA, c.45+5_45+7delGTA, r.45+5_45+7delgua
Description A deletion in the intron 1 leading to aberrant splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 1064..1066
Feature /change: -gta
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(17); standard; MUTATION; NTERM
Accession A0668
Systematic name g.3011_3014delinsGAA, c.46-14_46-11delinsGAA,
Systematic name r.46-14_46-11delinsgaa
Description An indel in the intron 1 leading to aberrant splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 3011..3014
Feature /change: ttct -> gaa
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -14
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(18); standard; MUTATION; NTERM
Accession A0669
Systematic name g.3014T>G, c.46-11T>G, r.46-11u>g
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3014
Feature /change: t -> g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -11
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 1(19a); standard; MUTATION; NTERM
Accession A0670
Systematic name g.3023A>G, c.46-2A>G, r.46-2a>g
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3023
Feature /change: a -> g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0671;
//
ID Intron 1(19b); standard; MUTATION; NTERM
Accession A0671
Systematic name g.3023A>G, c.46-2A>G, r.46-2a>g
Description A point mutation in the intron 1 leading to aberrant
Description splicing
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3023
Feature /change: a -> g
Feature /genomic_region: intron; 1
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0670;
//
ID Intron 2(1); standard; MUTATION; NTERM
Accession A0105
Systematic name g.4425A>G, c.142-2A>G, r.142-2a>g
Original code V-02 ref [1]
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4425
Feature /change: a -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Intron 2(2); standard; MUTATION; NTERM
Accession A0216
Systematic name g.3121delG, c.141+1delG, r.141+1delg
Description A deletion in the intron 2 leading to aberrant splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: -g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Polish
Family history Inherited
Comment Patient's mother is the carrier
//
ID Intron 2(3); standard; MUTATION; NTERM
Accession A0225
Systematic name g.3125_3126delGT, c.141+5_141+6delGT, r.141+5_141+6delgu
Description A deletion in the intron 2 leading to aberrant splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 3125..3126
Feature /change: -gt
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comment Patient's mother is the carrier
//
ID Intron 2(4); standard; MUTATION; NTERM
Accession A0501
Systematic name g.3122T>G, c.141+2T>G, r.141+2u>g
Original code V-04 ref [1]
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 2(5); standard; MUTATION; NTERM
Accession A0131
Systematic name g.3121G>A, c.141+1G>A, r.141+1g>a
Original code V-05 ref [2]
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Intron 2(6); standard; MUTATION; NTERM
Accession A0138
Systematic name g.3121G>T, c.141+1G>T, r.141+1g>u
Original code V-06 ref [2]
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Intron 2(7); standard; MUTATION; NTERM
Accession A0154
Systematic name g.3121G>T, c.141+1G>T, r.141+1g>u
Original code V-03 ref [1]
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID Intron 2(8); standard; MUTATION; NTERM
Accession A0502
Systematic name g.3121G>A, c.141+1G>A, r.141+1g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 2(9); standard; MUTATION; NTERM
Accession A0503
Systematic name g.3121G>A, c.141+1G>A, r.141+1g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
//
ID Intron 2(10); standard; MUTATION; NTERM
Accession A0504
Systematic name g.3122T>G, c.141+2T>G, r.141+2u>g
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 2(11); standard; MUTATION; NTERM
Accession A0505
Systematic name g.3122T>G, c.141+2T>G, r.141+2u>g
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 2(12); standard; MUTATION; NTERM
Accession A0506
Systematic name g.3122T>C, c.141+2T>C, r.141+2u>c
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> c
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 2(13); standard; MUTATION; NTERM
Accession A0615
Systematic name g.IVS2+5G>T, c.141+5G>T, r.141+5g>u
Original code VaAn
Description A point mutation in the intron 2 leading to an amino acid
Description change in the NTERM domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 05-Mar-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3125
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
mRNA level Reduced
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms liver abscess, lynphadenitis, pneumonia
Age 1
Sex XY
Ethnic origin Caucasoid; Italy
Family history Inherited
Relative Description of pedigree:mother carrier
//
ID Intron 2(14); standard; MUTATION; NTERM
Accession A0616
Systematic name g.IVS2-1G>A, c.142-1G>A, r.142-1g>a
Original code CaDa
Description A point mutation in the intron 2 leading to an amino acid
Description change in the NTERM domain
Date 05-Mar-2008 (Rel. 2, Created)
Date 05-Mar-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (05-Mar-2008) to CYBBbase.
RefLoc Giordani L., Di Matteo G., Ventura A. and Martire B.; Dept.
RefLoc Biomedicine of Evolutive Age - Univ. of Bari - p.zza
RefLoc G.Cesare, 11 - 70124 Bari Italy; Tel +39 80 5593075; Fax
RefLoc +39 80 5592290; e-mail l.giordani@endobiomol.uniba.it
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4426
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
mRNA level Much reduced
Protein level N.D.
Diagnosis Classical X-linked CGD
Symptoms abscess, adenitis
Age 6
Sex XY
Ethnic origin Caucasoid; Italy
Family history Not known
//
ID Intron 2(15); standard; MUTATION; NTERM
Accession A0693
Systematic name g.3121G>A, c.141+1G>A, r.141+1g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(16); standard; MUTATION; NTERM
Accession A0694
Systematic name g.3121G>A, c.141+1G>A, r.141+1g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(17); standard; MUTATION; NTERM
Accession A0695
Systematic name g.3121G>T, c.141+1G>T, r.141+1g>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(18); standard; MUTATION; NTERM
Accession A0696
Systematic name g.3121G>T, c.141+1G>T, r.141+1g>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(19); standard; MUTATION; NTERM
Accession A0697
Systematic name g.3121G>T, c.141+1G>T, r.141+1g>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3121
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(20); standard; MUTATION; NTERM
Accession A0698
Systematic name g.3122T>C, c.141+2T>C, r.141+2u>c
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> c
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(21); standard; MUTATION; NTERM
Accession A0699
Systematic name g.3122T>C, c.141+2T>C, r.141+2u>c
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3122
Feature /change: t -> c
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(22); standard; MUTATION; NTERM
Accession A0700
Systematic name g.3125G>A, c.141+5G>A, r.141+5g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3125
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(23); standard; MUTATION; NTERM
Accession A0701
Systematic name g.3125G>A, c.141+5G>A, r.141+5g>a
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3125
Feature /change: g -> a
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(24); standard; MUTATION; NTERM
Accession A0702
Systematic name g.3125G>T, c.141+5G>T, r.141+5g>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 3125
Feature /change: g -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(25); standard; MUTATION; NTERM
Accession A0703
Systematic name g.4399_4415del, c.142-28_-12del, r.142-28_-12del
Description A deletion mutation in the intron 2 leading to deletion
Description of exon 3
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 4399_4415
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
//
ID Intron 2(26); standard; MUTATION; NTERM
Accession A0704
Systematic name g.4415C>T, c.142-12C>T, r.142-12c>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4415
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -12
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(27); standard; MUTATION; NTERM
Accession A0705
Systematic name g.4415delinsACCTCTTCTAG, c.142-12delinsACCTCTTCTAG,
Systematic name r.142-12delinsaccucuucuag
Description An indel in the intron 2 leading to aberrant splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: indel
Feature /loc: IDRefSeq: D0025: 4415
Feature /change: c -> acctcttcta g
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -12
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(28); standard; MUTATION; NTERM
Accession A0706
Systematic name g.4425A>T, c.142-2A>T, r.142-2a>u
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4425
Feature /change: a -> t
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 2(29a); standard; MUTATION; NTERM
Accession A0707
Systematic name g.4426G>C, c.142-1G>C, r.142-1g>c
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4426
Feature /change: g -> c
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0708;
//
ID Intron 2(29b); standard; MUTATION; NTERM
Accession A0708
Systematic name g.4426G>C, c.142-1G>C, r.142-1g>c
Description A point mutation in the intron 2 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4426
Feature /change: g -> c
Feature /genomic_region: intron; 2
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0707;
//
ID Intron 3(1); standard; MUTATION; NTERM
Accession A0023
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Original code R.W. ref [1];VI-09(5) ref [2]
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1520880
RefAuthors de Boer, M., Bolscher, B. G., Dinauer, M. C., Orkin, S.
RefAuthors H., Smith, C. I., Ahlin, A., Weening, R. S., Roos, D.
RefTitle Splice site mutations are a common cause of X-linked
RefTitle chronic granulomatous disease.
RefLoc Blood 80:1553-1558 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
Comment "Maternal aunt is carrier; older brother died; prenatal diagnosis in family"
//
ID Intron 3(2); standard; MUTATION; NTERM
Accession A0148
Systematic name g.4542G>C, c.252+5G>C, r.252+5g>c
Original code J.L. ref [1];V-13 ref [2]
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
//
ID Intron 3(3); standard; MUTATION; NTERM
Accession A0507
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID Intron 3(4); standard; MUTATION; NTERM
Accession A0508
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 3(5); standard; MUTATION; NTERM
Accession A0509
Systematic name g.4538G>T, c.252+1G>T, r.252+1g>u
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4538
Feature /change: g -> t
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 3(6); standard; MUTATION; NTERM
Accession A0510
Systematic name g.4538G>A, c.252+1G>A, r.252+1g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4538
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 3(7); standard; MUTATION; NTERM
Accession A0594
Systematic name g.IVS3+5G>A, c.252+5G>A, r.252+5g>a
Original code 16. E.B.
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion; loss of exon sequence
Feature /loc: IDRefSeq: C0025: 156..266
Feature /change: -tcagcactgg cactggccag ggcccctgca gcctgcctga
Feature /change: atttcaactg catgctgatt ctcttgccag tctgtcgaaa
Feature /change: tctgctgtcc ttcctcaggg gttccagtgc g
Feature /note: skipping of exon 3
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /loc: GenBank: NP_000388: 48..84
Feature /name: deletion; inframe
Feature /change: -SALALARAPA ACLNFNCMLI LLPVCRNLLS FLRGSSA
Feature /domain: NTERM
Phenotype X91 -
Diagnosis Classical X-linked CGD
Symptoms Liver abscess (Staphylococcus aureus), septicemia
Symptoms (Salmonella enteritidis), iridocyclitis, cholecystis,
Symptoms pneumonia
Age 40
Family history Inherited
Comment late onset "adult" CGD
//
ID Intron 3(8); standard; MUTATION; NTERM
Accession A0626
Systematic name g.IVS3-1G>A, c.253-1G>A, r.253-1g>a
Original code P2
Description A point mutation in the intron 3 leading to an amino acid
Description change in the NTERM domain
Date 22-May-2008 (Rel. 2, Created)
Date 22-May-2008 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 18277931
RefAuthors Lee, P. P., Chan, K. W., Jiang, L., Chen, T., Li, C., Lee,
RefAuthors T. L., Mak, P. H., Fok, S. F., Yang, X., Lau, Y. L.
RefTitle Susceptibility to mycobacterial infections in children
RefTitle with X-linked chronic granulomatous disease: a review of
RefTitle 17 patients living in a region endemic for tuberculosis.
RefLoc Pediatr Infect Dis J:224-230 (2008)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12907
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent pneumonia, lymphadenopathy, meningitis
Sex XY
Ethnic origin Mongoloid
//
ID Intron 3(9); standard; MUTATION; NTERM
Accession A0780
Systematic name g.4538G>A, c.252+1G>A, r.252+1g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4538
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(10); standard; MUTATION; NTERM
Accession A0781
Systematic name g.4538G>A, c.252+1G>A, r.252+1g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4538
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(11); standard; MUTATION; NTERM
Accession A0782
Systematic name g.4538G>C, c.252+1G>C, r.252+1g>c
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4538
Feature /change: g -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(12); standard; MUTATION; NTERM
Accession A0783
Systematic name g.4539T>C, c.252+2T>C, r.252+2u>c
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4539
Feature /change: t -> c
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(13); standard; MUTATION; NTERM
Accession A0784
Systematic name g.4539dupT, c.252+2dupT, r.252+2dupu
Description A duplication in the intron 3 leading to aberrant splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4540
Feature /change: +t
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(14); standard; MUTATION; NTERM
Accession A0785
Systematic name g.4539dupT, c.252+2dupT, r.252+2dupu
Description A duplication in the intron 3 leading to aberrant splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 4540
Feature /change: +t
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(15a); standard; MUTATION; NTERM
Accession A0786
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(15b); standard; MUTATION; NTERM
Accession A0787
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(16a); standard; MUTATION; NTERM
Accession A0788
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(16b); standard; MUTATION; NTERM
Accession A0789
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(17); standard; MUTATION; NTERM
Accession A0790
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(18); standard; MUTATION; NTERM
Accession A0791
Systematic name g.4542G>A, c.252+5G>A, r.252+5g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 4542
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(19); standard; MUTATION; NTERM
Accession A0792
Systematic name g.12900A>G, c.253-8A>G, r.253-8a>g
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12900
Feature /change: a -> g
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -8
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(20); standard; MUTATION; NTERM
Accession A0793
Systematic name g.12905A>G, c.253-3A>G, r.253-3a>g
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12905
Feature /change: a -> g
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(21); standard; MUTATION; NTERM
Accession A0794
Systematic name g.12905A>G, c.253-3A>G, r.253-3a>g
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12905
Feature /change: a -> g
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(22); standard; MUTATION; NTERM
Accession A0795
Systematic name g.12907G>A, c.253-1G>A, r.253-1g>a
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12907
Feature /change: g -> a
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 3(23); standard; MUTATION; NTERM
Accession A0796
Systematic name g.12907G>T, c.253-1G>T, r.253-1g>u
Description A point mutation in the intron 3 leading to aberrant
Description splicing
Date 30-Aug-2010 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12907
Feature /change: g -> t
Feature /genomic_region: intron; 3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(1); standard; MUTATION; NTERM
Accession A0232
Systematic name g.14596A>C, c.338-2A>C, r.338-2a>c
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14596
Feature /change: a -> c
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Italian)
//
ID Intron 4(3); standard; MUTATION; NTERM
Accession A0512
Systematic name g.14597G>A, c.338-1G>A, r.338-1g>a
Original code patient 6 ref [1];91-10 ref [2]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14597
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 4(4); standard; MUTATION; NTERM
Accession A0513
Systematic name g.14597G>A, c.338-1G>A, r.338-1g>a
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14597
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 4(5); standard; MUTATION; NTERM
Accession A0514
Systematic name g.14596G>A, c.338-2G>A, r.338-2g>a
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14596
Feature /change: a -> g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Comment Mother not carrier
//
ID Intron 4(6); standard; MUTATION; NTERM
Accession A0595
Systematic name g.IVS4+1G>C, c.337+1G>C, r.337+1g>c
Original code 17. L.G.
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 03-Nov-2006 (Rel. 2, Created)
Date 03-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16569599
RefAuthors von Goessel, H., Hossle, J. P., Seger, R., Gungor, T.
RefTitle Characterization of 17 new cases of X-linked chronic
RefTitle granulomatous disease with seven novel mutations in the
RefTitle CYBB gene.
RefLoc Exp Hematol:528-535 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12993
Feature /change: g -> c
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 ?
Diagnosis Classical X-linked CGD
Symptoms Iridocyclitis
Age 1
//
ID Intron 4(7); standard; MUTATION; NTERM
Accession A0821
Systematic name g.12993G>A, c.337+1G>A, r.337+1g>a
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12993
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(8); standard; MUTATION; NTERM
Accession A0822
Systematic name g.12993G>A, c.337+1G>A, r.337+1g>a
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12993
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(9); standard; MUTATION; NTERM
Accession A0823
Systematic name g.12993G>T, c.337+1G>T, r.337+1g>u
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 12993
Feature /change: g -> t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(10); standard; MUTATION; NTERM
Accession A0824
Systematic name g.12994dupT, c.337+2dupT, r.337+2dupu
Description A duplication in the intron 4 leading to aberrant splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 12995
Feature /change: +t
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(11); standard; MUTATION; NTERM
Accession A0825
Systematic name g.12997dupG, c.337+5dupG, r.337+5dupg
Description A duplication in the intron 4 leading to aberrant splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: duplication
Feature /loc: IDRefSeq: D0025: 12998
Feature /change: +g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 4(12); standard; MUTATION; NTERM
Accession A0826
Systematic name g.14596A>G, c.338-2A>G, r.338-2a>g
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14596
Feature /change: a -> g
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(1); standard; MUTATION; NTERM
Accession A0009
Systematic name g.14746A>T, c.483+3A>T, r.483+3a>u
Original code DD ref [1];VI-13 ref [2]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1520880
RefAuthors de Boer, M., Bolscher, B. G., Dinauer, M. C., Orkin, S.
RefAuthors H., Smith, C. I., Ahlin, A., Weening, R. S., Roos, D.
RefTitle Splice site mutations are a common cause of X-linked
RefTitle chronic granulomatous disease.
RefLoc Blood 80:1553-1558 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14746
Feature /change: a -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Netherlands)
Family history Inherited, mother carrier
Comment Sister carrier
//
ID Intron 5(2); standard; MUTATION; NTERM
Accession A0115
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Original code V-16 ref [1]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
Symptoms Classical CGD
Sex XY
Ethnic origin Caucasian
//
ID Intron 5(3a); standard; MUTATION; NTERM
Accession A0140
Systematic name g.14748G>A, c.483+5G>A, r.483+5g>a
Original code V-17 ref [1];VP5 ref [2]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14748
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Protein level 5-17% (7D5)
Oxidase act. 2,4-8% (H2O2-prod.)
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0141; step-brother
//
ID Intron 5(3b); standard; MUTATION; NTERM
Accession A0141
Systematic name g.14748G>A, c.483+5G>A, r.483+5g>a
Original code V-17 ref [1];VP5 ref [2]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10089913
RefAuthors Roesler, J., Heyden, S., Burdelski, M., Schafer, H.,
RefAuthors Kreth, H. W., Lehmann, R., Paul, D., Marzahn, J., Gahr,
RefAuthors M., Rosen-Wolff, A.
RefTitle Uncommon missense and splice mutations and resulting
RefTitle biochemical phenotypes in german patients with X-linked
RefTitle chronic granulomatous disease.
RefLoc Exp Hematol 27:505-511 (1999)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14748
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Protein level 5-17% (7D5)
Oxidase act. 2,4-8% (H2O2-prod.)
Sex XY
Family history Inherited, mother carrier
Relative CYBBbase; A0140; step-brother
//
ID Intron 5(4); standard; MUTATION; NTERM
Accession A0164
Systematic name g.14745T>C, c.483+2T>C, r.483+2u>c
Original code V-15 ref [1]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14745
Feature /change: t -> c
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID Intron 5(5); standard; MUTATION; NTERM
Accession A0234
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Original code VI-11 ref [1];N.G. ref [2]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
RefNumber [2]
RefCrossRef PUBMED; 8615831
RefAuthors Porter, C. D., Kuribayashi, F., Parkar, M. H., Roos, D.,
RefAuthors Kinnon, C.
RefTitle Detection of gp91-phox precursor protein in B-cell lines
RefTitle from patients with X-linked chronic granulomatous disease
RefTitle as an indicator for mutations impairing cytochrome b558
RefTitle biosynthesis.
RefLoc Biochem J 315 ( Pt 2):571-575 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
//
ID Intron 5(6); standard; MUTATION; NTERM
Accession A0515
Systematic name g.14744G>A, c.483+1G>A, r.483+1g>a
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
Family history Inherited, mother carrier
Comment Grandmother is carrier
//
ID Intron 5(7); standard; MUTATION; NTERM
Accession A0516
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
//
ID Intron 5(8); standard; MUTATION; NTERM
Accession A0517
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 5(9); standard; MUTATION; NTERM
Accession A0606
Systematic name g.IVS5+978G>T, c.483+978G>T, r.483+978g>u
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 23-Oct-2007 (Rel. 2, Created)
Date 23-Oct-2007 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 17544093
RefAuthors Bustamante, J., Aksu, G., Vogt, G., de Beaucoudrey, L.,
RefAuthors Genel, F., Chapgier, A., Filipe-Santos, O., Feinberg, J.,
RefAuthors Emile, J. F., Kutukculer, N., Casanova, J. L.
RefTitle BCG-osis and tuberculosis in a child with chronic
RefTitle granulomatous disease.
RefLoc J Allergy Clin Immunol:32-38 (2007)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 15721
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +978
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Recurrent BCG-osis and disseminated tuberculosis
Age 12
Sex XY
Ethnic origin Caucasoid; Turkey
Comment The patient was vaccinated with mycobacterium bovis BCG at
Comment birth. He has two healthy brothers who were vaccinated with
Comment BCG with no adverse effect
//
ID Intron 5(10); standard; MUTATION; NTERM
Accession A0889
Systematic name g.14744G>A, c.483+1G>A, r.483+1g>a
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(11); standard; MUTATION; NTERM
Accession A0890
Systematic name g.14744G>A, c.483+1G>A, r.483+1g>a
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(12); standard; MUTATION; NTERM
Accession A0891
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(13); standard; MUTATION; NTERM
Accession A0892
Systematic name g.14744G>T, c.483+1G>T, r.483+1g>u
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14744
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(14); standard; MUTATION; NTERM
Accession A0893
Systematic name g.14748G>A, c.483+5G>A, r.483+5g>a
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 14748
Feature /change: g -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(15); standard; MUTATION; NTERM
Accession A0894
Systematic name g.15721G>T, c.483+978G>T, r.483+978g>u
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 15721
Feature /change: g -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +978
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(16a); standard; MUTATION; NTERM
Accession A0895
Systematic name g.16881C>A, c.484-3C>A, r.484-3c>a
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16881
Feature /change: c -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0896;
//
ID Intron 5(16b); standard; MUTATION; NTERM
Accession A0896
Systematic name g.16881C>A, c.484-3C>A, r.484-3c>a
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16881
Feature /change: c -> a
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0895;
//
ID Intron 5(17); standard; MUTATION; NTERM
Accession A0897
Systematic name g.16882A>T, c.484-2A>T, r.484-2a>u
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16882
Feature /change: a -> t
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 5(18); standard; MUTATION; NTERM
Accession A1426
Systematic name g.16876T>G, c.484-8T>G, r.484-8u>g
Original code IGG
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 09-Oct-2013 (Rel. 2, Created)
Date 09-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (09-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil.Hospital La Paz. Castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16876
Feature /change: t -> g
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -8
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Protein level Much reduced
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Adenitis, pericarditis, abdominal lymphadenopathy,anal
Symptoms fistula, splenic granulomas
Age 5
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Brother CGD Mother and three aunts
Relative carriers
//
ID Intron 5(19); standard; MUTATION; NTERM
Accession A1427
Systematic name g.16876T>G, c.484-8T>G, r.484-8u>g
Original code AGG
Description A point mutation in the intron 5 leading to aberrant
Description splicing
Date 09-Oct-2013 (Rel. 2, Created)
Date 09-Oct-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (09-Oct-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil.Hospital La Paz. Castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc aferreira.hulp@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 16876
Feature /change: t -> g
Feature /genomic_region: intron; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -8
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Protein level Much reduced
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms pneumonia, submandubular adenomegalia, candidiasis,
Symptoms inguinal adenopaty, perianal abscess
Age 2.5
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Brother CGD (A1426) Mother and
Relative three aunts carriers
Comment exon 6 skipping. exon 5-6 skipping
//
ID Intron 6(1a); standard; MUTATION; NTERM
Accession A0051
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Swiss
Family history Inherited
Relative CYBBbase; A0052; cousin
Comment Patient's mother, grandmother and aunt are carriers
//
ID Intron 6(1b); standard; MUTATION; NTERM
Accession A0052
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Swiss
Family history Inherited
Relative CYBBbase; A0051; cousin
Comment Patient's mother, grandmother and aunt are carriers
//
ID Intron 6(2); standard; MUTATION; NTERM
Accession A0106
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Sex XY
//
ID Intron 6(3); standard; MUTATION; NTERM
Accession A0235
Systematic name g.17079G>A, c.674+5G>A, r.674+5g>a
Original code VI-15 ref [1]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Sex XY
Ethnic origin Caucasian (Swedish)
//
ID Intron 6(4); standard; MUTATION; NTERM
Accession A0518
Systematic name g.17080T>A, c.674+6T>A, r.674+6u>a
Original code V-19 ref [1]
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17080
Feature /change: t -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 6(5); standard; MUTATION; NTERM
Accession A0519
Systematic name g.17079G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 4 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
//
ID Intron 6(6a); standard; MUTATION; NTERM
Accession A0561
Systematic name g.IVS6+5G>C, c.674+5G>C, r.674+5g>c
Original code 7-year-old boy
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15468310
RefAuthors Barese, C. N., Copelli, S. B., De Matteo, E., Zandomeni,
RefAuthors R., Salgueiro, F., Di Giovanni, D., Heyworth, P., Rivas,
RefAuthors E. M.
RefTitle Molecular characterization of a novel splice site mutation
RefTitle within the CYBB gene leading to X-linked chronic
RefTitle granulomatous disease.
RefLoc Pediatr Blood Cancer:420-422 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0025: 498..688
Feature /change: -aaccctgaag gaggcctgta cctggctgtg accctgttgg
Feature /change: caggcatcac tggagttgtc atcacgctgt gcctcatatt
Feature /change: aattatcact tcctccacca aaaccatccg gaggtcttac
Feature /change: tttgaagtct tttggtacac acatcatctc tttgtgatct
Feature /change: tcttcattgg ccttgccatc catggagctg a
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 162..225
Feature /change: NPEGGLYLAV TLLAGITGVV ITLCLILIIT SSTKTIRRSY
Feature /change: FEVFWYTHHL FVIFFIGLAI HGAE
Feature /change: ->
Feature /change: TNCTWADRRE FGCAX
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Fever, abdominal pain, recurrent suppurative adenitis,
Symptoms urinary tract infection, recurrent lower respiratory
Symptoms infections, gastroenteritis, perirectal abscess
Sex XY
Family history Inherited
Relative CYBBbase; A0562 brother
//
ID Intron 6(6b); standard; MUTATION; NTERM
Accession A0562
Systematic name g.IVS6+5G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15468310
RefAuthors Barese, C. N., Copelli, S. B., De Matteo, E., Zandomeni,
RefAuthors R., Salgueiro, F., Di Giovanni, D., Heyworth, P., Rivas,
RefAuthors E. M.
RefTitle Molecular characterization of a novel splice site mutation
RefTitle within the CYBB gene leading to X-linked chronic
RefTitle granulomatous disease.
RefLoc Pediatr Blood Cancer:420-422 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0025: 498..688
Feature /change: -aaccctgaag gaggcctgta cctggctgtg accctgttgg
Feature /change: caggcatcac tggagttgtc atcacgctgt gcctcatatt
Feature /change: aattatcact tcctccacca aaaccatccg gaggtcttac
Feature /change: tttgaagtct tttggtacac acatcatctc tttgtgatct
Feature /change: tcttcattgg ccttgccatc catggagctg a
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 162..225
Feature /change: NPEGGLYLAV TLLAGITGVV ITLCLILIIT SSTKTIRRSY
Feature /change: FEVFWYTHHL FVIFFIGLAI HGAE
Feature /change: ->
Feature /change: TNCTWADRRE FGCAX
Feature /domain: NTERM
Phenotype X91 0
Diagnosis Classical X-linked CGD
Symptoms Neonatal septicemia caused by Staphylococcus aureus
Sex XY
Family history Inherited
Relative CYBBbase; A0561 brother
//
ID Intron 6(7); standard; MUTATION; NTERM
Accession A0581
Systematic name g.IVS6-1157A>G, c.675-1157A>G
Original code 5-year-old boy
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 02-Nov-2006 (Rel. 2, Created)
Date 02-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16516412
RefAuthors Rump, A., Rosen-Wolff, A., Gahr, M., Seidenberg, J., Roos,
RefAuthors C., Walter, L., Gunther, V., Roesler, J.
RefTitle A splice-supporting intronic mutation in the last bp
RefTitle position of a cryptic exon within intron 6 of the CYBB
RefTitle gene induces its incorporation into the mRNA causing
RefTitle chronic granulomatous disease (CGD).
RefLoc Gene:174-181 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 18731
Feature /change: a -> g
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: cryptic site activation; insertion; frameshift
Feature /loc: IDRefSeq: C0025: 689
Feature /change: +ctgaaggaac tgaggctcag aagaagttaa ataatttgcc
Feature /change: tgagtccacc aaacta
Feature /inexloc: -1157
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 225
Feature /change: E -> DX
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Symptoms Moderate hepatomegaly, anemia, low body weight, high fever
Symptoms and dyspnea, lobal pneumonia on the left side,
Symptoms intrabronchial granulomatosis, obstruction of the right
Symptoms lower lobe, bronchiectasis, secondary pneumonia, and
Symptoms infection with Nocardia asteroides
Sex XY
Family history Inherited
//
ID Intron 6(8); standard; MUTATION; NTERM
Accession A0935
Systematic name g.17075G>T, c.674+1G>T, r.674+1g>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17075
Feature /change: g -> t
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(9); standard; MUTATION; NTERM
Accession A0936
Systematic name g.17075G>A, c.674+1G>A, r.674+1g>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17075
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(10); standard; MUTATION; NTERM
Accession A0937
Systematic name g.17075G>A, c.674+1G>A, r.674+1g>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17075
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(11); standard; MUTATION; NTERM
Accession A0938
Systematic name g.17077G>C, c.674+3G>C, r.674+3g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17077
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(12); standard; MUTATION; NTERM
Accession A0939
Systematic name g.17078A>G, c.674+4A>G, r.674+4a>g
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> g
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(13); standard; MUTATION; NTERM
Accession A0940
Systematic name g.17078A>G, c.674+4A>G, r.674+4a>g
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> g
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(14a); standard; MUTATION; NTERM
Accession A0941
Systematic name g.17078A>T, c.674+4A>T, r.674+4a>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> t
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0942;
//
ID Intron 6(14b); standard; MUTATION; NTERM
Accession A0942
Systematic name g.17078A>T, c.674+4A>T, r.674+4a>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> t
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0941;
//
ID Intron 6(15a); standard; MUTATION; NTERM
Accession A0943
Systematic name g.17078A>C, c.674+4A>C, r.674+4a>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0944;
//
ID Intron 6(15b); standard; MUTATION; NTERM
Accession A0944
Systematic name g.17078A>C, c.674+4A>C, r.674+4a>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17078
Feature /change: a -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0943;
//
ID Intron 6(16); standard; MUTATION; NTERM
Accession A0945
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(17); standard; MUTATION; NTERM
Accession A0946
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(18); standard; MUTATION; NTERM
Accession A0947
Systematic name g.17078_17081delAGTG, c.674+4_674+7delAGTG,
Systematic name r.674+4_674+7delagug
Description A deletion in the intron 6 leading to aberrant splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 17078..17081
Feature /change: -agtg
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(19a); standard; MUTATION; NTERM
Accession A0948
Systematic name g.17079G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0949;
//
ID Intron 6(19b); standard; MUTATION; NTERM
Accession A0949
Systematic name g.17079G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0948;
//
ID Intron 6(20a); standard; MUTATION; NTERM
Accession A0950
Systematic name g.17079G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0951;
//
ID Intron 6(20b); standard; MUTATION; NTERM
Accession A0951
Systematic name g.17079G>C, c.674+5G>C, r.674+5g>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17079
Feature /change: g -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
Relative CYBBbase; A0950;
//
ID Intron 6(21); standard; MUTATION; NTERM
Accession A0952
Systematic name g.17080T>C, c.674+6T>C, r.674+6u>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 17080
Feature /change: t -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +6
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(22); standard; MUTATION; NTERM
Accession A0953
Systematic name g.18889A>G, c.675-999A>G, r.675-999a>g
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 18889
Feature /change: t -> g
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -999
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(23); standard; MUTATION; NTERM
Accession A0954
Systematic name g.19886A>C, c.675-2A>C, r.675-2a>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19886
Feature /change: a -> c
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 6(24); standard; MUTATION; NTERM
Accession A0955
Systematic name g.19887G>A, c.675-1G>A, r.675-1g>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 19887
Feature /change: g -> a
Feature /genomic_region: intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(1); standard; MUTATION; NTERM
Accession A0005
Systematic name g.20019T>A, c.804+2T>A, r.804+2u>a
Original code CB ref [1];VI-17 ref [2]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1520880
RefAuthors de Boer, M., Bolscher, B. G., Dinauer, M. C., Orkin, S.
RefAuthors H., Smith, C. I., Ahlin, A., Weening, R. S., Roos, D.
RefTitle Splice site mutations are a common cause of X-linked
RefTitle chronic granulomatous disease.
RefLoc Blood 80:1553-1558 (1992)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
mRNA level Normal
Phenotype X91 0
Protein level 0
Heme level 0
Oxidase act. 0
Sex XY
Ethnic origin Caucasian (Netherlands)
//
ID Intron 7(2a); standard; MUTATION; NTERM
Accession A0236
Systematic name g.20019T>C, c.804+2T>C, r.804+2u>c
Original code VI-18 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Ethnic origin Caucasian (Greek)
Family history Inherited, mother carrier
Relative CYBBbase; A0237; brother
Comment "Sister is carrier, one healthy and one affected brother; liver abscess and surgery in 1985"
//
ID Intron 7(2b); standard; MUTATION; NTERM
Accession A0237
Systematic name g.20019T>C, c.804+2T>C, r.804+2u>c
Original code VI-18 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K.,
RefAuthors Hossle, J. P., Bernatowska-Matuszkiewicz, E., Middleton-
RefAuthors Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease.
RefLoc Blood 87:1663-1681 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Sex XY
Ethnic origin Caucasian (Greek)
Family history Inherited, mother carrier
Relative CYBBbase; A0236; brother
Comment "Sister is carrier, one healthy and one affected brother; liver abscess and surgery in 1985"
//
ID Intron 7(3); standard; MUTATION; NTERM
Accession A0238
Systematic name g.22187A>C, c.805-2A>C, r.805-2a>c
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22187
Feature /change: a -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
Protein level 0
Oxidase act. 0
NBT-slide 0
Sex XY
Family history Inherited, mother carrier
//
ID Intron 7(4); standard; MUTATION; NTERM
Accession A0520
Systematic name g.22187A>G, c.805-2A>G, r.805-2a>g
Original code 91-22 ref [2]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9667376
RefAuthors Ariga, T., Furuta, H., Cho, K., Sakiyama, Y.
RefTitle Genetic analysis of 13 families with X-linked chronic
RefTitle granulomatous disease reveals a low proportion of sporadic
RefTitle patients and a high proportion of sporadic carriers.
RefLoc Pediatr Res 44:85-92 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22187
Feature /change: a -> g
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 7(5); standard; MUTATION; NTERM
Accession A0521
Systematic name g.22188G>A, c.805-1G>A, r.805-1g>a
Original code V-20 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22188
Feature /change: g -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Family history Inherited, mother carrier
//
ID Intron 7(6); standard; MUTATION; NTERM
Accession A0522
Systematic name g.20018G>A, c.804+1G>A, r.804+1g>a
Original code patient 1 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11997079
RefAuthors Lin, S. J., Huang, Y. F., Chen, J. Y., Heyworth, P. G.,
RefAuthors Noack, D., Wang, J. Y., Lin, C. Y., Chiang, B. L., Yang,
RefAuthors C. M., Liu, C. C., Shieh, C. C.
RefTitle Molecular quality control machinery contributes to the
RefTitle leukocyte NADPH oxidase deficiency in chronic
RefTitle granulomatous disease.
RefLoc Biochim Biophys Acta:275-286 (2002)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20018
Feature /change: g -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
mRNA level 24.90 %
Phenotype X91 0
Sex XY
Family history Inherited, mother carrier
//
ID Intron 7(7); standard; MUTATION; NTERM
Accession A0523
Systematic name g.20018G>T, c.804+1G>T, r.804+1g>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20018
Feature /change: g -> t
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Phenotype X91 0
//
ID Intron 7(8); standard; MUTATION; NTERM
Accession A1043
Systematic name g.20018G>A, c.804+1G>A, r.804+1g>a
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20018
Feature /change: g -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(9); standard; MUTATION; NTERM
Accession A1044
Systematic name g.20018G>T, c.804+1G>T, r.804+1g>u
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20018
Feature /change: g -> t
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(10); standard; MUTATION; NTERM
Accession A1045
Systematic name g.20018G>T, c.804+1G>T, r.804+1g>u
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20018
Feature /change: g -> t
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(11); standard; MUTATION; NTERM
Accession A1046
Systematic name g.20019T>C, c.804+2T>C, r.804+2u>c
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(12); standard; MUTATION; NTERM
Accession A1047
Systematic name g.20019T>C, c.804+2T>C, r.804+2u>c
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(13); standard; MUTATION; NTERM
Accession A1048
Systematic name g.22187A>T, c.805-2A>T, r.805-2a>u
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22187
Feature /change: a -> t
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(14); standard; MUTATION; NTERM
Accession A1049
Systematic name g.22188G>A, c.805-1G>A, r.805-1g>a
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22188
Feature /change: g -> a
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(15); standard; MUTATION; NTERM
Accession A1050
Systematic name g.22188G>C, c.805-1G>C, r.805-1g>c
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22188
Feature /change: g -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Diagnosis Classical X-linked CGD
//
ID Intron 7(16); standard; MUTATION; NTERM
Accession A1434
Systematic name g.20019T>C, c.804+2T>C, r.804+2u>c
Original code EFP
Description A point mutation in the intron 7 leading to aberrant
Description splicing
Date 07-Nov-2013 (Rel. 2, Created)
Date 07-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (07-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta sotano
RefLoc Hospital Infantil. Hospital La Paz. castellana 261. 28046
RefLoc Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 20019
Feature /change: t -> c
Feature /genomic_region: intron; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NTERM
Protein level N.D.
Activity Inactive
Diagnosis Classical X-linked CGD
Sex male
Ethnic origin Caucasoid; Spain
Family history Inherited
Relative Description of pedigree:Mother and aunt carriers.
//
ID Intron 8(1a); standard; MUTATION; NTERM
Accession A0239
Systematic name g.22282G>T, c.897+1G>T, r.897+1g>u
Original code VI-19
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> t
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0303; brother
Comment Mother is carrier
//
ID Intron 8(1b); standard; MUTATION; NTERM
Accession A0303
Systematic name g.22282G>T, c.897+1G>T, r.897+1g>u
Original code VI-19
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> t
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0239; brother
Comment Mother is carrier
//
ID Intron 8(2); standard; MUTATION; FADBR
Accession A0240
Systematic name g.22282G>T, c.897+1G>T, r.897+1g>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> t
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Phenotype X91 0
Sex ??
Family history Inherited, mother carrier
//
ID Intron 8(3); standard; MUTATION; FADBR
Accession A0524
Systematic name g.22282G>A, c.897+1G>A, r.897+1g>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> a
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Phenotype X91 0
//
ID Intron 8(4); standard; MUTATION; FADBR
Accession A1083
Systematic name g.22282G>A, c.897+1G>A, r.897+1g>a
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> a
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 8(5); standard; MUTATION; FADBR
Accession A1084
Systematic name g.22282G>T, c.897+1G>T, r.897+1g>u
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 22282
Feature /change: g -> t
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 8(6); standard; MUTATION; FADBR
Accession A1085
Systematic name g.24813G>A, c.898-1G>A, r.898-1g>a
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24813
Feature /change: g -> a
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 8(7); standard; MUTATION; FADBR
Accession A1086
Systematic name g.24813G>A, c.898-1G>A, r.898-1g>a
Description A point mutation in the intron 8 leading to aberrant
Description splicing
Date 03-Sep-2010 (Rel. 2, Created)
Date 03-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 24813
Feature /change: g -> a
Feature /genomic_region: intron; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(1); standard; MUTATION; FADBR
Accession A0525
Systematic name g.25072G>A, c.1151+5G>A, r.1151+5g>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25072
Feature /change: g -> a
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Phenotype X91 0
//
ID Intron 9(2); standard; MUTATION; FADBR
Accession A0580
Systematic name g.25941A>G, c.1152-2A>G, r.1152-2a>g
Original code Patient L
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 02-Nov-2006 (Rel. 2, Created)
Date 02-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25941
Feature /change: a -> g
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Symptoms Skin infection on his second day of life, a BCG vaccination
Symptoms took 5 months to heal, pneumonia, chronic otitis,
Symptoms sinusitis, cervical lymphadenitis, and Staphylococcus
Symptoms aureus liver abscesses
Sex XY
Ethnic origin Caucasoid/Negroid; Brazil
//
ID Intron 9(3); standard; MUTATION; FADBR
Accession A1194
Systematic name g.25071A>T, c.1151+4A>T, r.1151+4a>u
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25071
Feature /change: a -> t
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(4); standard; MUTATION; FADBR
Accession A1195
Systematic name g.25072G>A, c.1151+5G>A, r.1151+5g>a
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25072
Feature /change: g -> a
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(5a); standard; MUTATION; FADBR
Accession A1196
Systematic name g.25932T>G, c.1152-11T>G, r.1152-11u>g
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25932
Feature /change: t -> g
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -11
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1197;
//
ID Intron 9(5b); standard; MUTATION; FADBR
Accession A1197
Systematic name g.25932T>G, c.1152-11T>G, r.1152-11u>g
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25932
Feature /change: t -> g
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -11
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1196;
//
ID Intron 9(6); standard; MUTATION; FADBR
Accession A1198
Systematic name g.25941A>T, c.1152-2A>T, r.1152-2a>u
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25941
Feature /change: a -> t
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(7); standard; MUTATION; FADBR
Accession A1199
Systematic name g.25941A>T, c.1152-2A>T, r.1152-2a>u
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25941
Feature /change: a -> t
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(8); standard; MUTATION; FADBR
Accession A1200
Systematic name g.25942G>A, c.1152-1G>A, r.1152-1g>a
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25942
Feature /change: g -> a
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 9(9); standard; MUTATION; FADBR
Accession A1201
Systematic name g.25942G>A, c.1152-1G>A, r.1152-1g>a
Description A point mutation in the intron 9 leading to aberrant
Description splicing
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 25942
Feature /change: g -> a
Feature /genomic_region: intron; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: FADBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(1); standard; MUTATION; NADPHBR
Accession A0526
Systematic name g.26106G>A, c.1314+1G>A, r.1314+1g>a
Original code V-22 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26106
Feature /change: g -> a
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Phenotype het
Sex XX
//
ID Intron 10(2); standard; MUTATION; NADPHBR
Accession A0527
Systematic name g.26107T>A, c.1314+2T>A, r.1314+2u>a
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26107
Feature /change: t -> a
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Phenotype X91 0
//
ID Intron 10(3); standard; MUTATION; NADPHBR
Accession A0528
Systematic name g.27320G>C, c.1315-4G>C, r.1315-4g>c
Original code V-21 ref [1]
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 9585602
RefAuthors Rae, J., Newburger, P. E., Dinauer, M. C., Noack, D.,
RefAuthors Hopkins, P. J., Kuruto, R., Curnutte, J. T.
RefTitle X-linked chronic granulomatous disease: mutations in the
RefTitle CYBB gene encoding the gp91-phox component of respiratory-
RefTitle burst oxidase.
RefLoc Am J Hum Genet 62:1320-1331 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27320
Feature /change: t -> c
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Phenotype X91 0
//
ID Intron 10(4); standard; MUTATION; NADPHBR
Accession A0529
Systematic name g.26106G>T, c.1314+1G>T, r.1314+1g>u
Description A point mutation in the intron 6 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26106
Feature /change: g -> t
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
//
ID Intron 10(5); standard; MUTATION; NADPHBR
Accession A0579
Systematic name g.IVS10+1G>A, c.1314+1G>A, r.1314+1g>a
Original code Patient G
Description A point mutation in the intron 10 leading to aberrant
Description splicing
Date 02-Nov-2006 (Rel. 2, Created)
Date 02-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 16123991
RefAuthors Agudelo-Florez, P., Prando-Andrade, C. C., Lopez, J. A.,
RefAuthors Costa-Carvalho, B. T., Quezada, A., Espinosa, F. J., de
RefAuthors Souza Paiva, M. A., Roxo, P., Grumach, A., Jacob, C. A.,
RefAuthors Carneiro-Sampaio, M. M., Newburger, P. E., Condino-Neto,
RefAuthors A.
RefTitle Chronic granulomatous disease in latin american patients:
RefTitle clinical spectrum and molecular genetics.
RefLoc Pediatr Blood Cancer:243-252 (2006)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26106
Feature /change: g -> a
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Symptoms Cervical lymphadenitis caused by Staphylococcus aureus,
Symptoms skin infection and recurrent diarrhea, pneumonia with S.
Symptoms aureus and Pseudomonas sp. isolated from his upper right
Symptoms lobe, left upper lobe bronchiectasis and Nocardia pneumonia
Sex XY
Ethnic origin Caucasoid; Chile
//
ID Intron 10(6); standard; MUTATION; NADPHBR
Accession A1234
Systematic name g.26106G>C, c.1314+1G>C, r.1314+1g>c
Description A point mutation in the intron 10 leading to aberrant
Description splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26106
Feature /change: g -> c
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(7); standard; MUTATION; NADPHBR
Accession A1235
Systematic name g.26107T>G, c.1314+2T>G, r.1314+2u>g
Description A point mutation in the intron 10 leading to aberrant
Description splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 26107
Feature /change: t -> g
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(8); standard; MUTATION; NADPHBR
Accession A1236
Systematic name g.26109_26110delinsGC, c.1314+4_1314+5delinsGC,
Systematic name r.1314+4_1314+5delinsgc
Description A complex in the intron 10 leading to aberrant splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 26109..26110
Feature /change: ag -> gc
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +4
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(9); standard; MUTATION; NADPHBR
Accession A1237
Systematic name g.27322delinsC, c.1315-2delinsC, r.1315-2delinsc
Description A complex in the intron 10 leading to aberrant splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 27322
Feature /change: a -> c
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(10); standard; MUTATION; NADPHBR
Accession A1238
Systematic name g.27322delinsC, c.1315-2delinsC, r.1315-2delinsc
Description A complex in the intron 10 leading to aberrant splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 27322
Feature /change: a -> c
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 10(11); standard; MUTATION; NADPHBR
Accession A1239
Systematic name g.27323delinsT, c.1315-1delinsT, r.1315-1delinsu
Description A complex in the intron 10 leading to aberrant splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: complex
Feature /loc: IDRefSeq: D0025: 27323
Feature /change: g -> t
Feature /genomic_region: intron; 10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 11(1a); standard; MUTATION; NTERM
Accession A0078
Systematic name g.30502A>G, c.1462-2A>G, r.1462-2a>g
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1719419
RefAuthors Schapiro, B. L., Newburger, P. E., Klempner, M. S.,
RefAuthors Dinauer, M. C.
RefTitle Chronic granulomatous disease presenting in a 69-year-old
RefTitle man
RefLoc N. Engl. J. Med. 325:1786-90 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30502
Feature /change: a -> g
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
Sex XY
Relative CYBBbase; A0104; grandson
Comment Daughter is carrier
//
ID Intron 11(1b); standard; MUTATION; NTERM
Accession A0104
Systematic name g.30502A>G, c.1462-2A>G, r.1462-2a>g
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 15-Jun-1996 (Rel. 1, Created)
Date 25-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1719419
RefAuthors Schapiro, B. L., Newburger, P. E., Klempner, M. S.,
RefAuthors Dinauer, M. C.
RefTitle Chronic granulomatous disease presenting in a 69-year-old
RefTitle man
RefLoc N. Engl. J. Med. 325:1786-90 (1991)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30502
Feature /change: a -> g
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Relative CYBBbase; A0078; grandfather
Comment Mother and two sisters were carriers
//
ID Intron 11(2); standard; MUTATION; L
Accession A0241
Systematic name g.27471G>A, c.1461+1G>A, r.1461+1g>a
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8961628
RefAuthors Roos, D.
RefTitle X-CGDbase: a database of X-CGD-causing mutations.
RefLoc Immunol Today 17:517-521 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> a
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Protein level 0
Sex XY
//
ID Intron 11(3); standard; MUTATION; L
Accession A0530
Systematic name g.27471G>T, c.1461+1G>T, r.1461+1g>u
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Phenotype X91 0
//
ID Intron 11(4); standard; MUTATION; L
Accession A0531
Systematic name g.30502A>G, c.1462-2A>G, r.1462-2a>g
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30502
Feature /change: a -> g
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Sex XY
Comment mother and grandmother are carriers
//
ID Intron 11(5); standard; MUTATION; L
Accession A0532
Systematic name g.30503G>A, c.1462-1G>A, r.1462-1g>a
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 11162142
RefAuthors Heyworth, P. G., Curnutte, J. T., Rae, J., Noack, D.,
RefAuthors Roos, D., van Koppen, E., Cross, A. R.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (second update).
RefLoc Blood Cells Mol Dis 27:16-26 (2001)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30503
Feature /change: g -> a
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
//
ID Intron 11(6); standard; MUTATION; L
Accession A0560
Systematic name g.IVS11+1G>T, c.1461+1G>T, r.1461+1g>u
Original code Patient 2
Description A point mutation in the intron 11 leading to an amino acid
Description change in the L domain
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15082894
RefAuthors Oh, H. B., Park, J. S., Lee, W., Yoo, S. J., Yang, J. H.,
RefAuthors Oh, S. Y.
RefTitle Molecular analysis of X-linked chronic granulomatous
RefTitle disease in five unrelated korean patients.
RefLoc J Korean Med Sci:218-222 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
Symptoms Recurrent subcutaneous abscesses, enteric fever, pneumonia,
Symptoms liver abscesses, lymphadenopathy, osteomyelitis, otitis
Symptoms media, Guillain-Barre syndrome, bacteremia, bacteriuria
Sex XY
Ethnic origin Mongoloid; Korea
//
ID Intron 11(7); standard; MUTATION; L
Accession A1265
Systematic name g.27471G>A, c.1461+1G>A, r.1461+1g>a
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> a
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID Intron 11(8a); standard; MUTATION; L
Accession A1266
Systematic name g.27471G>T, c.1461+1G>T, r.1461+1g>u
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1267;
//
ID Intron 11(8b); standard; MUTATION; L
Accession A1267
Systematic name g.27471G>T, c.1461+1G>T, r.1461+1g>u
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 27471
Feature /change: g -> t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1266;
//
ID Intron 11(9); standard; MUTATION; L
Accession A1268
Systematic name g.27472delT, c.1461+2delT, r.1461+2delu
Description A deletion in the intron 11 leading to aberrant splicing
Date 07-Sep-2010 (Rel. 2, Created)
Date 07-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0025: 27472
Feature /change: -t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Diagnosis Classical X-linked CGD
//
ID Intron 11(10); standard; MUTATION; L
Accession A1431
Systematic name g.30503G>T, c.1462-1G>T, r.1462-1g>u
Original code SRB
Description A point mutation in the intron 11 leading to aberrant
Description splicing
Date 06-Nov-2013 (Rel. 2, Created)
Date 06-Nov-2013 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefLoc Submitted (06-Nov-2013) to CYBBbase.
RefLoc Antonio Ferreira; Unidad de Inmunologia.Planta
RefLoc sotano-Hospital Infantil.Hospital La Paz. Castellana 261.
RefLoc 28046 Madrid. Spain; Tel 917277238; Fax 917277095; e-mail
RefLoc antonio.ferreira@salud.madrid.org
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30503
Feature /change: g -> t
Feature /genomic_region: intron; 11
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: L
Protein level Absent
Activity Inactive
Diagnosis Classical X-linked CGD
Symptoms Gastroenteritis by Salmonella,laterocevical abscess,liver
Symptoms abscess,intestinal perforation,laterocervical adenoflemon
Age 1.2
Sex male
Ethnic origin Caucasoid; Spain
Family history De novo
Comment Deletion of the first 30bp of the exon 12
//
ID Intron 12(1); standard; MUTATION; NADPHBR
Accession A0533
Systematic name g.31726A>G, c.1587-2A>G, r.1587-2a>g
Original code 91-42 ref [1]
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 26-Jul-2002 (Rel. 2, Created)
Date 13-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31726
Feature /change: a -> g
Feature /genomic_region: intron; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Phenotype X91 0
//
ID Intron 12(2); standard; MUTATION; NADPHBR
Accession A0572
Systematic name g.30627_30637delAAGTAAGGAGT
Original code P9
Description A deletion of 2 bp in the end of exon 12 and 9 bp in
Description the beginning of intron 12 leading to cryptic site Description activation
Date 01-Nov-2006 (Rel. 2, Created)
Date 01-Nov-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15538631
RefAuthors Stasia, M. J., Bordigoni, P., Floret, D., Brion, J. P.,
RefAuthors Bost-Bru, C., Michel, G., Gatel, P., Durant-Vital, D.,
RefAuthors Voelckel, M. A., Li, X. J., Guillot, M., Maquet, E.,
RefAuthors Martel, C., Morel, F.
RefTitle Characterization of six novel mutations in the CYBB gene
RefTitle leading to different sub-types of X-linked chronic
RefTitle granulomatous disease.
RefLoc Hum Genet:72-82 (2005)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion; splicing
Feature /loc: IDRefSeq: D0025: 30627..30637
Feature /change: -aagtaaggag t
Feature /genomic_region: exon; 12, intron; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; cryptic site activation; frameshift
Feature /loc: IDRefSeq: C0025: 1584..1600
Feature /change: -gcaagtcaac accctaa
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: GenBank: NP_000388: 524..529
Feature /change: ASQHPN -> YQNRSFPLWT X
Feature /domain: NADPHBR
Phenotype X91 -
Diagnosis Classical X-linked CGD
Symptoms Serratia marcescens-associated severe sepsis with liver and
Symptoms splenic abscesses, phimosis, purulent rhinitis,
Symptoms pyodermitis, impetigo recurrent diarrhea
Sex XY
Family history Inherited
//
ID Intron 12(3); standard; MUTATION; NADPHBR
Accession A1303
Systematic name g.30629G>C, c.1586+1G>C, r.1586+1g>c
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30629
Feature /change: g -> c
Feature /genomic_region: intron; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 12(4); standard; MUTATION; NADPHBR
Accession A1304
Systematic name g.30631A>T, c.1586+3A>T, r.1586+3a>u
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 30631
Feature /change: a -> t
Feature /genomic_region: intron; 12
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: +3
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 12(5); standard; MUTATION; NADPHBR
Accession A1305
Systematic name g.31726A>G, c.1587-2A>G, r.1587-2a>g
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31726
Feature /genomic_region: intron; 12
Feature /genomic_region: 3'UTR
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
//
ID Intron 12(6a); standard; MUTATION; NADPHBR
Accession A1306
Systematic name g.31726A>G, c.1587-2A>G, r.1587-2a>g
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31726
Feature /genomic_region: intron; 12
Feature /genomic_region: 3'UTR
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1307;
//
ID Intron 12(6b); standard; MUTATION; NADPHBR
Accession A1307
Systematic name g.31726A>G, c.1587-2A>G, r.1587-2a>g
Description A point mutation in the intron 12 leading to aberrant
Description splicing
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0025: 31726
Feature /genomic_region: intron; 12
Feature /genomic_region: 3'UTR
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /inexloc: -2
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Feature /domain: NADPHBR
Diagnosis Classical X-linked CGD
Relative CYBBbase; A1306;
//
ID Deletion(1); standard; MUTATION;
Accession A0026
Systematic name c.(253-?_1151+?)del
Original code S.B.
Description Deletion of ~14 kb including exons 4_9
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 4_9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Belgian)
//
ID Deletion(2a); standard; MUTATION;
Accession A0027
Systematic name c.(338-?_483+?)del
Original code IV-15a
Description Deletion of ~3 kb including exon 5
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9414292
RefAuthors de Boer, M., Bakker, E., Van Lierde, S., Roos, D.
RefTitle Somatic triple mosaicism in a carrier of X-linked chronic
RefTitle granulomatous disease.
RefLoc Blood:252-257 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Belgian)
Family history Inherited, mother is carrier
Relative CYBBbase; A0028; brother
//
ID Deletion(2b); standard; MUTATION;
Accession A0028
Systematic name c.(484-?_804+?)del
Original code IV-15a
Description Deletion of ~3.5 kb including exon 6_7
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
RefNumber [2]
RefCrossRef PUBMED; 9414292
RefAuthors de Boer, M., Bakker, E., Van Lierde, S., Roos, D.
RefTitle Somatic triple mosaicism in a carrier of X-linked chronic
RefTitle granulomatous disease.
RefLoc Blood:252-257 (1998)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Belgian)
Family history Inherited, mother is carrier
Relative CYBBbase; A0027; brother
//
ID Deletion(3); standard; MUTATION;
Accession A0030
Systematic name c.(1-?_1710+?)del
Original code B.B.
Description Deletion of ~5000 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 4039107
RefAuthors Francke, U., Ochs, H. D., de Martinville, B., Giacalone,
RefAuthors J., Lindgren, V., Disteche, C., Pagon, R. A., Hofker, M.
RefAuthors H., van Ommen, G. J., Pearson, P. L.
RefTitle Minor xp21 chromosome deletion in a male associated with
RefTitle expression of duchenne muscular dystrophy, chronic
RefTitle granulomatous disease, retinitis pigmentosa, and mcLeod
RefTitle syndrome.
RefLoc Am J Hum Genet:250-267 (1985)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Symptoms Duchenne muscular dystrophy; Retinitis pigmentosa;
Symptoms McLeod syndrome;
Sex XY
//
ID Deletion(4); standard; MUTATION;
Accession A0031
Systematic name c.(1-?_1710+?)del
Original code N.F.
Description Deletion of ~5000 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 3472714
RefAuthors Royer-Pokora, B., Kunkel, L. M., Monaco, A. P., Goff, S.
RefAuthors C., Newburger, P. E., Baehner, R. L., Cole, F. S.,
RefAuthors Curnutte, J. T., Orkin, S. H.
RefTitle Cloning the gene for the inherited disorder chronic
RefTitle granulomatous disease on the basis of its chromosomal
RefTitle location.
RefLoc Cold Spring Harb Symp Quant Biol:177-183 (1986)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(5); standard; MUTATION;
Accession A0032
Systematic name c.(1-?_1710+?)del
Original code O.M.
Description Deletion of ~800 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 3334897
RefAuthors Frey, D., Machler, M., Seger, R., Schmid, W., Orkin, S. H.
RefTitle Gene deletion in a patient with chronic granulomatous
RefTitle disease and mcLeod syndrome: fine mapping of the xk gene
RefTitle locus.
RefLoc Blood:252-255 (1988)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comments Mother and sister of the patient are carriers
//
ID Deletion(6); standard; MUTATION;
Accession A0033
Systematic name c.(1-?_1710+?)del
Original code S.B.
Description Deletion of unknown size including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 3417309
RefAuthors de Saint-Basile, G., Bohler, M. C., Fischer, A., Cartron,
RefAuthors J., Dufier, J. L., Griscelli, C., Orkin, S. H.
RefTitle Xp21 DNA microdeletion in a patient with chronic
RefTitle granulomatous disease, retinitis pigmentosa, and McLeod
RefTitle phenotype
RefLoc Hum. Genet. 80:85-9 (1988)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Symptoms Retinitis pigmentosa; McLeod syndrome
Sex XY
//
ID Deletion(7); standard; MUTATION;
Accession A0034
Systematic name c.(1-?_1710+?)del
Original code Ken
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7525551
RefAuthors Nanda, A., Romanek, R., Curnutte, J. T., Grinstein, S.
RefTitle Assessment of the contribution of the cytochrome b moiety
RefTitle of the NADPH oxidase to the transmembrane H+ conductance
RefTitle of leukocytes.
RefLoc J Biol Chem:27280-27285 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(8); standard; MUTATION;
Accession A0035
Systematic name c.(1-?_1710+?)del
Original code IV-5
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Finnish)
//
ID Deletion(9); standard; MUTATION;
Accession A0036
Systematic name c.(1-?_1710+?)del
Original code IV-6
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comments Mother and maternal grandmother of the patient were carriers
//
ID Deletion(10); standard; MUTATION;
Accession A0037
Systematic name c.(1-?_1710+?)del
Original code IV-7
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(11a); standard; MUTATION;
Accession A0038
Systematic name c.(1-?_1710+?)del
Original code IV-8a
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited
Relative CYBBbase; A0039; brother
//
ID Deletion(11b); standard; MUTATION;
Accession A0039
Systematic name c.(1-?_1314+?)del
Original code IV-8b
Description Deletion of >20 kb including exons 1_10
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_10
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Hungarian)
Family history Inherited
Relative CYBBbase; A0038; brother
//
ID Deletion(12); standard; MUTATION;
Accession A0040
Systematic name c.(253-?_1710+?)del
Original code IV-9
Description Deletion of >15 kb including exons 4_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 4_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (Hungarian)
//
ID Deletion(13); standard; MUTATION;
Accession A0041
Systematic name c.(253-?_1710+?)del
Original code IV-11
Description Deletion of >13 kb including exons 6_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 1974472
RefAuthors Pelham, A., O'Reilly, M. A., Malcolm, S., Levinsky, R. J.,
RefAuthors Kinnon, C.
RefTitle RFLP and deletion analysis for X-linked chronic
RefTitle granulomatous disease using the cDNA probe: potential for
RefTitle improved prenatal diagnosis and carrier determination
RefLoc Blood 76:820-4 (1990)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 6_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian (British)
Comment Patient's mother and sister are the carriers
//
ID Deletion(14); standard; MUTATION;
Accession A0042
Systematic name c.(805-?_1710+?)del
Original code IV-12
Description Deletion of >10 kb including exons 8_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 8_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(15); standard; MUTATION;
Accession A0043
Systematic name c.(1315-?_1710+?)del
Original code IV-13
Description Deletion of >6.5 kb including exons 11_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 11_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comment Patient's mother is the carrier
//
ID Deletion(16); standard; MUTATION;
Accession A0044
Systematic name c.(1462-?_1710+?)del
Original code IV-14
Description Deletion of >6 kb including exons 12_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7907031
RefAuthors Ariga, T., Sakiyama, Y., Furuta, H., Matsumoto, S.
RefTitle Molecular genetic studies of two families with X-linked
RefTitle chronic granulomatous disease: mutation analysis and
RefTitle definitive determination of carrier status in patients'
RefTitle sisters
RefLoc Eur. J. Haematol. 52:99-102 (1994)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 12_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Japanese
Family history Inherited
Comments Mother of the patient was carrier
//
ID Deletion(17); standard; MUTATION;
Accession A0066
Systematic name c.(1-?_1710+?)del
Original code J2
Description Deletion of 500 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 10914676
RefAuthors Ishibashi, F., Nunoi, H., Endo, F., Matsuda, I.,
RefAuthors Kanegasaki, S.
RefTitle Statistical and mutational analysis of chronic
RefTitle granulomatous disease in japan with special reference to
RefTitle gp91-phox and p22-phox deficiency.
RefLoc Hum Genet 106:473-481 (2000)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comment Patient's mother is the carrier
//
ID Deletion(18); standard; MUTATION;
Accession A0119
Systematic name c.(1-?_1710+?)del
Description Deletion of >>30 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein absent
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(19); standard; MUTATION;
Accession A00153
Systematic name c.(1-?_1710+?)del
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein absent
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(20); standard; MUTATION;
Accession A0156
Systematic name c.(1150_1151+2)delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Curnutte '95
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(21); standard; MUTATION;
Accession A0167
Systematic name c.(1-?_1710+?)del
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein absent
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(22); standard; MUTATION;
Accession A0169
Systematic name c.(1-?_1710+?)del
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein absent
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(23a); standard; MUTATION;
Accession A0172
Systematic name c.(1315-?_1710+?)del
Description Deletion of ~4.3 kb including exons 11_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Curnutte '95
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 11_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Relative CYBBbase; A0173; brother
//
ID Deletion(23b); standard; MUTATION;
Accession A0173
Systematic name c.(1315-?_1710+?)del
Description Deletion of ~4.3 kb including exons 11_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Curnutte '95
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 11_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Incomplete protein
Diagnosis Classical X-linked CGD
Sex XY
Relative CYBBbase; A0172; brother
//
ID Deletion(24); standard; MUTATION;
Accession A0181
Systematic name c.(482_483+4)delaggtaa
Description Deletion of 6 bp in exon 5 and intron 5
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(25); standard; MUTATION;
Accession A0201
Systematic name c.(1-?_1710+?)del
Description Deletion of >27 kb including exons 1_13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
Reference Rae '98
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. No protein present
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(26); standard; MUTATION;
Accession A0203
Systematic name c.(1587-?_1710+?)del
Description Deletion of <1 kb including exons 13
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 2425263
RefAuthors Royer-Pokora, B., Kunkel, L. M., Monaco, A. P., Goff, S.
RefAuthors C., Newburger, P. E., Baehner, R. L., Cole, F. S.,
RefAuthors Curnutte, J. T., Orkin, S. H.
RefTitle Cloning the gene for an inherited human disorder--chronic
RefTitle granulomatous disease--on the basis of its chromosomal
RefTitle location
RefLoc Nature 322:32-8 (1986)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 13
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(27); standard; MUTATION;
Accession A00204
Systematic name c.(1-?_252+?)del
Description Deletion of >5.3 kb including exons 1_3
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1_3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
Family history Inherited
Comment Mother is the carrier
//
ID Deletion(28); standard; MUTATION;
Accession A0205
Systematic name c.(675-?_804+?)del
Description Deletion of >27 kb including exon 7
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Polish
Family history Inherited
Comment Mother is the carrier
//
ID Deletion(29); standard; MUTATION;
Accession A0206
Systematic name c.(1-?_1710+?)del
Description Deletion of >27 kb including exon 5
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Protein incomplete
Diagnosis Classical X-linked CGD
Sex XY
//
ID Deletion(30a); standard; MUTATION; NADPHBR
Accession A0554
Original code 13268
Description Deletion of unknown size including exons 1-3
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15577746
RefAuthors Jurkowska, M., Kurenko-Deptuch, M., Bal, J., Roos, D.
RefTitle The search for a genetic defect in polish patients with
RefTitle chronic granulomatous disease.
RefLoc Arch Immunol Ther Exp (Warsz):441-446 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1-3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasoid; Poland
Relative CYBBbase; A0555; brother
//
ID Deletion(30b); standard; MUTATION; NADPHBR
Accession A0555
Original code 13268
Description Deletion of unknown size including exons 1-3
Date 31-Oct-2006 (Rel. 2, Created)
Date 31-Oct-2006 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 15577746
RefAuthors Jurkowska, M., Kurenko-Deptuch, M., Bal, J., Roos, D.
RefTitle The search for a genetic defect in polish patients with
RefTitle chronic granulomatous disease.
RefLoc Arch Immunol Ther Exp (Warsz):441-446 (2004)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 1-3
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Sex XY
Ethnic origin Caucasoid; Poland
Relative CYBBbase; A0554; brother
//
ID Deletion(31); standard; MUTATION; NADPHBR
Accession A0797
Systematic name g.12033_12992+?del, c.253-875_337+~800del
Description Deletion of unknown size including exon 4
Date 31-Oct-2006 (Rel. 2, Created)
Date 30-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exon; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(32); standard; MUTATION; NADPHBR
Accession A0899
Systematic name g.16784_17365del581, c.484-100_674+291del581
Description Deletion of 581 bp including exon 6
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(33); standard; MUTATION; NADPHBR
Accession A0956
Systematic name c.674+?_804+?del
Description Deletion of unknown size including exon 7
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(34); standard; MUTATION; NADPHBR
Accession A1051
Systematic name c.805-?
Description Deletion of unknown size including exon 8
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(35); standard; MUTATION; NADPHBR
Accession A1187
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(36); standard; MUTATION; NADPHBR
Accession A1188
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(37); standard; MUTATION; NADPHBR
Accession A1189
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(38); standard; MUTATION; NADPHBR
Accession A1190
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(39); standard; MUTATION; NADPHBR
Accession A1191
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(40); standard; MUTATION; NADPHBR
Accession A1192
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(41); standard; MUTATION; NADPHBR
Accession A1193
Systematic name c.1150_1151+2delaagt
Description Deletion of 4 bp in exon 9 and intron 9
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(42); standard; MUTATION; NADPHBR
Accession A1270
Systematic name c.1461+668_1462-807del1558
Description Deletion of 1558 bp in intron 11
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(43); standard; MUTATION; NADPHBR
Accession A1271
Systematic name c.1462-?
Description Deletion of unknown size including exon 12
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(44); standard; MUTATION; NADPHBR
Accession A1300
Systematic name c.1570_1586+?del
Description Deletion of unknown size
Date 06-Sep-2010 (Rel. 2, Created)
Date 06-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(45); standard; MUTATION;
Accession A1327
Description Deletion of ~6000 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(46); standard; MUTATION;
Accession A1328
Description Deletion of ~5650 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(47); standard; MUTATION;
Accession A1329
Description Deletion of ~3900 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(48); standard; MUTATION;
Accession A1330
Description Deletion of ~3500 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(49); standard; MUTATION;
Accession A1331
Systematic name 1-?_45+?del
Description Deletion of 913 kb including promoter region and exon 1
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(50); standard; MUTATION;
Accession A1332
Description Deletion of ~800 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(51); standard; MUTATION;
Accession A1333
Description Deletion of ~550 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(52); standard; MUTATION;
Accession A1334
Description Deletion of ~500 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(53); standard; MUTATION;
Accession A1335
Description Deletion of ~500 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(54a); standard; MUTATION;
Accession A1336
Description Deletion of ~450 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(54b); standard; MUTATION;
Accession A1337
Description Deletion of ~450 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(55); standard; MUTATION;
Accession A1338
Description Deletion of ~450 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(55); standard; MUTATION;
Accession A1339
Description Deletion of ~450 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(56); standard; MUTATION;
Accession A1340
Description Deletion of unknown size
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(57); standard; MUTATION;
Accession A1341
Description Deletion of unknown size
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(58); standard; MUTATION;
Accession A1342
Description Deletion of unknown size
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(59); standard; MUTATION;
Accession A1343
Systematic name 1-?_1710+?del
Description Deletion of the whole gene
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(60); standard; MUTATION;
Accession A1344
Systematic name 1-?_1710+?del
Description Deletion of the whole gene
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(61); standard; MUTATION;
Accession A1345
Systematic name 1-?_1710+?del
Description Deletion of the whole gene
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(62); standard; MUTATION;
Accession A1346
Systematic name 1-?_1710+?del
Description Deletion of the whole gene
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(63); standard; MUTATION;
Accession A1347
Description Deletion of ~320 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(64); standard; MUTATION;
Accession A1348
Description Deletion of ~320 kb
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(65); standard; MUTATION;
Accession A1349
Systematic name 1-?_1710+?del
Description Deletion of >300 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(66); standard; MUTATION;
Accession A1350
Systematic name 1-?_1710+?del
Description Deletion of >300 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(67); standard; MUTATION;
Accession A1351
Systematic name 1-?_1710+?del
Description Deletion of >150 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(68); standard; MUTATION;
Accession A1352
Systematic name 1-?_1710+?del
Description Deletion of >150 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(69); standard; MUTATION;
Accession A1353
Systematic name 1-?_1710+?del
Description Deletion of >100 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(70); standard; MUTATION;
Accession A1354
Systematic name 1-?_1710+?del
Description Deletion of >100 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(71); standard; MUTATION;
Accession A1355
Systematic name 1-?_1710+?del
Description Deletion of ~100 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(72); standard; MUTATION;
Accession A1356
Systematic name 1-?_1710+?del
Description Deletion of ~80 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(73); standard; MUTATION;
Accession A1357
Systematic name 1-?_252+?del
Description Deletion of >60 kb including exons 1_3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(74); standard; MUTATION;
Accession A1358
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(75); standard; MUTATION;
Accession A1359
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(76); standard; MUTATION;
Accession A1360
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(77); standard; MUTATION;
Accession A1361
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(78); standard; MUTATION;
Accession A1362
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(79); standard; MUTATION;
Accession A1363
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(80); standard; MUTATION;
Accession A1364
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(81); standard; MUTATION;
Accession A1365
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(82); standard; MUTATION;
Accession A1366
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(83); standard; MUTATION;
Accession A1367
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(84); standard; MUTATION;
Accession A1368
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(85); standard; MUTATION;
Accession A1369
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(86); standard; MUTATION;
Accession A1370
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(87); standard; MUTATION;
Accession A1371
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(88); standard; MUTATION;
Accession A1372
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(89); standard; MUTATION;
Accession A1373
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(90); standard; MUTATION;
Accession A1374
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(91); standard; MUTATION;
Accession A1375
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(92); standard; MUTATION;
Accession A1376
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(93); standard; MUTATION;
Accession A1377
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(94); standard; MUTATION;
Accession A1378
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(95); standard; MUTATION;
Accession A1379
Systematic name 1-?_1710+?del
Description Deletion of >27 kb including exons 1_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(96); standard; MUTATION;
Accession A1380
Systematic name 1-?_804+?del
Description Deletion of 25 kb including promoter region and exons 1_7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(97); standard; MUTATION;
Accession A1381
Systematic name 1-?_1314+?del
Description Deletion of >20 kb including promoter region and
Description exons 1_10
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(98); standard; MUTATION;
Accession A1382
Systematic name 1-?_337+?del
Description Deletion of unknown size including promoter region and
Description exons 1_4
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(99); standard; MUTATION;
Accession A1383
Systematic name 484-?_1710+?del
Description Deletion of ~19 kb including exons 6_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(100); standard; MUTATION;
Accession A1384
Systematic name 484-?_1710+?del
Description Deletion of >13 kb including exons 6_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(101); standard; MUTATION;
Accession A1385
Systematic name 675-?_1710+?del
Description Deletion of unknown size including exons 7_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(102); standard; MUTATION;
Accession A1386
Systematic name 805-?_1710+?del
Description Deletion of >10 kb including exons 8_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(103); standard; MUTATION;
Accession A1387
Systematic name 675-?_1586+?del
Description Deletion of ~10 kb including exons 7_12
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(104); standard; MUTATION;
Accession A1388
Systematic name 898-?_1710+?del
Description Deletion of >9 kb including exons 9_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(105); standard; MUTATION;
Accession A1389
Systematic name 484-?_897+?del
Description Deletion of unknown size including exons 6_8
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(106); standard; MUTATION;
Accession A1390
Systematic name 253-?_674+?del
Description Deletion of unknown size including exons 4_6
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(107); standard; MUTATION;
Accession A1391
Systematic name 142-?_337+?del
Description Deletion of 7 kb including exons 3_4
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(108); standard; MUTATION;
Accession A1392
Systematic name 1-?_252+?del
Description Deletion of unknown size including exons 1_3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(109); standard; MUTATION;
Accession A1393
Systematic name 1315-?_1710+?del
Description Deletion of unknown size including exons 11_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(110); standard; MUTATION;
Accession A1394
Systematic name 675-?_804+?del
Description Deletion of unknown size including exons 6_7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(111); standard; MUTATION;
Accession A1395
Systematic name 484-?_674+?del
Description Deletion of ~3.2 kb including exon 6
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(112a); standard; MUTATION;
Accession A1396
Systematic name 675-?_804+?del
Description Deletion of ~3 kb including exon 7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1397;
//
ID Deletion(112b); standard; MUTATION;
Accession A1397
Systematic name 675-?_804+?del
Description Deletion of ~3 kb including exon 7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1396;
//
ID Deletion(113); standard; MUTATION;
Accession A1398
Systematic name c.142-?_252+?del
Description Deletion of ~2 kb including exon 3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(114); standard; MUTATION;
Accession A1399
Systematic name c.675-?_804+?del
Description Deletion of ~2 kb including exon 7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(115); standard; MUTATION;
Accession A1400
Systematic name c.142-?_252+?del
Description Deletion of unknown size including exon 3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(116); standard; MUTATION;
Accession A1401
Systematic name c.1-?_45+?del
Description Deletion of ~2 kb including promotor region and
Description exon 1
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(117); standard; MUTATION;
Accession A1402
Systematic name c.1-?_45+?del
Description Deletion of unknown size including promoter region and
Description exon 1
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(118); standard; MUTATION;
Accession A1403
Systematic name c.805-?_897+?del
Description Deletion of ~2 kb including exon 8
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(119); standard; MUTATION;
Accession A1404
Systematic name c.805-?_897+?del
Description Deletion of ~2 kb including exon 8
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(120); standard; MUTATION;
Accession A1405
Systematic name c.1462-?_1710+?del
Description Deletion of 2 kb including exon 12_13
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(121); standard; MUTATION;
Accession A1406
Systematic name c.675-?_804+?del
Description Deletion of ~2 kb including exon 7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(122); standard; MUTATION;
Accession A1407
Systematic name c.675-?_804+?del
Description Deletion of unknown size including exon 7
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(123a); standard; MUTATION;
Accession A1408
Systematic name c.484-?_674+?del
Description Deletion of ~1.1 kb including exon 6
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1409;
//
ID Deletion(123b); standard; MUTATION;
Accession A1409
Systematic name c.484-?_674+?del
Description Deletion of ~1.1 kb including exon 6
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1408;
//
ID Deletion(124); standard; MUTATION;
Accession A1410
Systematic name c.898-?_1151+?del
Description Deletion of unknown size including exon 9
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(125); standard; MUTATION;
Accession A1411
Systematic name c.898-?_1151+?del
Description Deletion of unknown size including exon 9
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Deletion(126a); standard; MUTATION;
Accession A1412
Systematic name c.898-?_1151+?del
Description Deletion of 0.35 kb including exon 3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1413;
//
ID Deletion(126b); standard; MUTATION;
Accession A1413
Systematic name c.898-?_1151+?del
Description Deletion of 0.35 kb including exon 3
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
Relative CYBBbase; A1412;
//
ID Deletion(127); standard; MUTATION;
Accession A1414
Description Deletion of 0.22 kb including promoter region
Date 10-Sep-2010 (Rel. 2, Created)
Date 10-Sep-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Insertion(1); standard; MUTATION;
Accession A00299
Systematic name c.262_263ins~2100
Description Insertion of 2.1 kb in exon 4
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /genomic_region: exons; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Dutch
Family history De novo
//
ID Insertion(2); standard; MUTATION;
Accession A00301
Systematic name c.675-24_690ins
Original code P.E., V-5
Description Insertion of 40 bp in exon 7
Date 15-Jun-1996 (Rel. 1, Created)
Date 24-Aug-2010 (Rel. 2, Last updated, Version 3)
RefNumber [1]
RefCrossRef PUBMED; 7694872
RefAuthors Rabbani, H., de Boer, M., Ahlin, A., Sundin, U., Elinder,
RefAuthors G., Hammarstrom, L., Palmblad, J., Smith, C. I., Roos, D.
RefTitle A 40-base-pair duplication in the gp91-phox gene leading to
RefTitle X-linked chronic granulomatous disease
RefLoc Eur. J. Haematol. 51:218-22 (1993)
RefNumber [2]
RefCrossRef PUBMED; 8634410
RefAuthors Roos, D., de Boer, M., Kuribayashi, F., Meischl, C.,
RefAuthors Weening, R. S., Segal, A. W., Ahlin, A., Nemet, K., Hossle,
RefAuthors J. P., Bernatowska-Matuszkiewicz, E., Middleton-Price, H.
RefTitle Mutations in the X-linked and autosomal recessive forms of
RefTitle chronic granulomatous disease
RefLoc Blood 87:1663-81 (1996)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /genomic_region: exons; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Protein struct. Premature stop
Diagnosis Classical X-linked CGD
Sex XY
Ethnic origin Caucasian; Swedish
Family history Inherited
Comment Patient's mother is the carrier
//
ID Insertion(3); standard; MUTATION;
Accession A0667
Systematic name c.45+907_908ins~5800
Description Insertion of a retrogene in intron 1 resulting in an
Description extra exon between exon 1 and 2
Date 27-Aug-2010 (Rel. 2, Created)
Date 27-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Insertion(4); standard; MUTATION; NADPHBR
Accession A0898
Systematic name g.16623_16624ins836, c.483+1880_+1881ins836
Description Insertion of 836 bp in intron 5
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
ID Insertion(5); standard; MUTATION; NADPHBR
Accession A0900
Systematic name c.484-?_897+?
Description Insertion of unknown size in intron 5 leading to
Description duplication of exons 6_8
Date 31-Aug-2010 (Rel. 2, Created)
Date 31-Aug-2010 (Rel. 2, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 20729109
RefAuthors Roos, D., Kuhns, D. B., Maddalena, A., Roesler, J., Lopez,
RefAuthors J. A., Ariga, T., Avcin, T., de Boer, M., Bustamante, J.,
RefAuthors Condino-Neto, A., Di Matteo, G., He, J., Hill, H. R.,
RefAuthors Holland, S. M., Kannengiesser, C., Koker, M. Y.,
RefAuthors Kondratenko, I., van Leeuwen, K., Malech, H. L., Marodi,
RefAuthors L., Nunoi, H., Stasia, M. J., Ventura, A. M., Witwer, C.
RefAuthors T., Wolach, B., Gallin, J. I.
RefTitle Hematologically important mutations: X-linked chronic
RefTitle granulomatous disease (third update).
RefLoc Blood Cells Mol Dis:h (2010)
Feature dna; 1
Feature /rnalink: 2
Feature /name: insertion
Feature /genomic_region: exons; 6_8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
Diagnosis Mild X-linked CGD
//
//
|
