Database RFXANKbase
Version 1.0
File rfxankpub.txt
Date 16-Jun-2011
Curator Mauno Vihinen
Address Protein Structure and Bioinformatics
Address Lund University, BMC D10, SE-22184 Lund, Sweden
Phone +46 72 526 0022
Fax +46 46 222 9328
Email Mauno Vihinen
URL http://structure.bmc.lu.se/idbase/RFXANKbase/
IDR factfile http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF15.html
Gene RFXANK
Disease Ankyrin repeat containing regulatory factor X-associated
Disease protein deficiency
OMIM 603200
GDB 9956049
Sequence IDRefSeq:D0074; IDRefSeq:C0074; UniProt:O14593
Numbering start of the entry
Funding Tampere University Hospital Medical Research Fund
Funding European Union
Comments sequence entry reference in every entry
//
ID E102X(1),E102X(1); standard; MUTATION;
Accession R0001
Systematic name Allele 1 and 2: g.5932G>T, c.721G>T, p.E102X
Original code EBA
Description Allele 1 and 2: point mutation in the exon 5 leading to a
Description premature stop codon
Date 04-Feb-2003 (Rel. 1, Created)
Date 04-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [2]
RefCrossRef PUBMED; 10725724
RefAuthors Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J.
RefAuthors M., van den elsen, P. J.
RefTitle Novel mutations within the RFX-B gene and partial rescue
RefTitle of MHC and related genes through exogenous class II
RefTitle transactivator in RFX-B-deficient cells.
RefLoc J Immunol 164:3666-3674 (2000)
RefNumber [3]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [4]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5932
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 721
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5932
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 721
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature /change: E -> X
//
ID E102X(2),E102X(2); standard; MUTATION;
Accession R0026
Systematic name Allele 1 and 2: g.5932G>T, c.304G>T, r.304g>u, p.Glu102X
Original code B22
Description Allele 1 and 2: a point mutation in the exon 5 leading to a
Description premature stop codon
Date 20-Oct-2003 (Rel. 1, Created)
Date 20-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5932
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 721
Feature /codon: gag -> tag; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature /change: E -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5932
Feature /change: g -> t
Feature /genomic_region: exon; 5
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 721
Feature /codon: gag -> tag; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature /change: E -> X
Ethnic origin Turkey
Relative
//
ID D121V(1),D121V(1); standard; MUTATION;
Accession R0030
Systematic name Allele 1 and 2: g.6259A>T, c.362A>T, r.362a>u, p.Asp121Val
Original code B26
Description Allele 1 and 2: A point mutation in the exon 6 leading to
Description an amino acid change
Date 04-Aug-2010 (Rel. 1, Created)
Date 04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12618906
RefAuthors Wiszniewski, W., Fondaneche, M. C., Louise-Plence, P.,
RefAuthors Prochnicka-Chalufour, A., Selz, F., Picard, C., Le Deist,
RefAuthors F., Eliaou, J. F., Fischer, A., Lisowska-Grospierre, B.
RefTitle Novel mutations in the RFXANK gene: RFX complex containing
RefTitle in-vitro-generated RFXANK mutant binds the promoter
RefTitle without transactivating MHC II.
RefLoc Immunogenetics:747-755 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 6259
Feature /change: a -> t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 779
Feature /codon: gac -> gtc; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: O14593; RFXK_HUMAN: 121
Feature /change: D -> V
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 6259
Feature /change: a -> t
Feature /genomic_region: exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 779
Feature /codon: gac -> gtc; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: O14593; RFXK_HUMAN: 121
Feature /change: D -> V
Symptoms Recurrent infections; Severe diarrhea; Failure to
Symptoms thrive;
Ethnic origin Saudi Arabia
Parents Consanguineous
//
ID #L128X203(1),Intron 6(2); standard; MUTATION;
Accession R0024
Systematic name Allele 1: g.6280delT, c.800delT, p.L128fsX203
Systematic name Allele 2: g.IVS6-1G>T
Original code B25
Description Allele 1: deletion in the exon 6 leading to a premature
Description stop codon
Description Allele 2: point mutation in the intron 6 leading to
Description skipping of exon 7
Description amino acid change
Date 11-Feb-2003 (Rel. 1, Created)
Date 11-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6280
Feature /change: -t
Feature /genomic_region: exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: frameshift
Feature /loc: IDRefSeq: C0074: 800
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 128
Feature /change: L
Feature /change: -> PSGPPPLERL RPFASCWSGV PTPTSWQKSE RAPCRWPAQA
Feature /change: ATQTLWGCCW SVTWTSTSMI GMEGRHCCTL CAGTTX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 6820
Feature /change: g -> t
Feature /genomic_region: intron; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0074: 856..981
Feature /change: -ggtgccgacc cccacatcct ggcaaaagag cgagagagcg
Feature /change: ccctgtcgct ggccagcaca ggcggctaca cagacattgt
Feature /change: ggggctgctg ctggagcgtg acgtggacat caacatctat
Feature /change: gattgg
Feature /note: skipping of exon 7
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: O14593; RFXK_HUMAN: 147..188
Feature /change:
Feature /change: -GADPHILAKE RESALSLAST GGYTDIVGLL LERDVDINIY
Feature /change: DW
Ethnic origin Caucasoid; France/Spain
Parents Non-consanguineous
//
ID R157X(1),R157X(1); standard; MUTATION;
Accession R0003
Systematic name Allele 1 and 2: g.6851C>T, c.886C>T, p.R157X
Original code B23
Description Allele 1 and 2: point mutation in the exon 7 leading to a
Description premature stop codon
Date 05-Feb-2003 (Rel. 1, Created)
Date 05-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [3]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 6851
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 886
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 157
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 6851
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 7
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074: 886
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 157
Feature /change: R -> X
Ethnic origin Caucasoid; Italy
//
ID L195P(1),L195P(1); standard; MUTATION;
Accession R0002
Systematic name Allele 1 and 2: g.7390T>C, c.1001T>C, p.L195P
Original code FZA
Description Allele 1 and 2: point mutation in the exon 8 leading to an
Description amino acid change
Date 04-Feb-2003 (Rel. 1, Created)
Date 04-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [2]
RefCrossRef PUBMED; 10725724
RefAuthors Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J.
RefAuthors M., van den elsen, P. J.
RefTitle Novel mutations within the RFX-B gene and partial rescue
RefTitle of MHC and related genes through exogenous class II
RefTitle transactivator in RFX-B-deficient cells.
RefLoc J Immunol 164:3666-3674 (2000)
RefNumber [3]
RefCrossRef PUBMED; 11463838
RefAuthors Nekrep, N., Geyer, M., Jabrane-Ferrat, N., Peterlin, B. M.
RefTitle Analysis of ankyrin repeats reveals how a single point
RefTitle mutation in RFXANK results in bare lymphocyte syndrome.
RefLoc Mol Cell Biol 21:5566-5576 (2001)
RefNumber [4]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [5]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 7390
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: missense
Feature /loc: IDRefSeq: C0074: 1001
Feature /codon: ctg -> ccg; 2
Feature aa; 3
Feature /rnalink: 2
Feature /name: aa substitution
Feature /loc: UniProt: O14593; RFXK_HUMAN: 195
Feature /change: L -> P
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 7390
Feature /change: t -> c
Feature /genomic_region: exon; 8
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: missense
Feature /loc: IDRefSeq: C0074: 1001
Feature /codon: ctg -> ccg; 2
Feature aa; 6
Feature /rnalink: 5
Feature /name: aa substitution
Feature /loc: UniProt: O14593; RFXK_HUMAN: 195
Feature /change: L -> P
//
ID R212X(1),R212X(1); standard; MUTATION;
Accession R0029
Systematic name Allele 1 and 2: g.7870C>T, c.634C>T, r.634c>u, p.Arg212X
Original code B21
Description Allele 1 and 2: A point mutation in the exon 9 leading to a
Description premature stop codon
Date 04-Aug-2010 (Rel. 1, Created)
Date 04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 12618906
RefAuthors Wiszniewski, W., Fondaneche, M. C., Louise-Plence, P.,
RefAuthors Prochnicka-Chalufour, A., Selz, F., Picard, C., Le Deist,
RefAuthors F., Eliaou, J. F., Fischer, A., Lisowska-Grospierre, B.
RefTitle Novel mutations in the RFXANK gene: RFX complex containing
RefTitle in-vitro-generated RFXANK mutant binds the promoter
RefTitle without transactivating MHC II.
RefLoc Immunogenetics:747-755 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 7870
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 1051
Feature /codon: cga -> tga; 1
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 212
Feature /change: R -> X
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 7870
Feature /change: c -> t
Feature /CpG; 1
Feature /genomic_region: exon; 9
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: nonsense
Feature /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 1051
Feature /codon: cga -> tga; 1
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 212
Feature /change: R -> X
Symptoms Recurrent infections; Severe diarrhea; Failure to
Symptoms thrive;
Ethnic origin Turkey
Parents Consanguineous
//
ID Intron 4(1),Intron 4(1); standard; MUTATION;
Accession R0027
Systematic name Allele 1 and 2: g.IVS4+1G>C, c.G>C, r.g>c,
Original code JER
Description Allele 1 and 2: a point mutation in the intron 4 leading to
Description aberrant splicing
Date 12-Feb-2004 (Rel. 1, Created)
Date 12-Feb-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 11313409
RefAuthors Lennon-Dumenil, A. M., Barbouche, M. R., Vedrenne, J.,
RefAuthors Prod'Homme, T., Bejaoui, M., Ghariani, S., Charron, D.,
RefAuthors Fellous, M., Dellagi, K., Alcaxde-Loridan, C.
RefTitle Uncoordinated HLA-D gene expression in a RFXANK-defective
RefTitle patient with MHC class II deficiency.
RefLoc J Immunol 166:5681-5687 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5761
Feature /change: g -> c
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0074: 605..688
Feature /change: -caggcagctc cctgaagcac tccaccactc tcaccaaccg
Feature /change: gcagcgaggg aacgaggtgt cagctctgcc ggccacccta
Feature /change: gact
Feature /note: skipping of exon 4
Feature /inexloc: +1
Feature aa; 3
Feature /rnalink: 2
Feature /name: deletion; inframe
Feature /loc: UniProt: O14593; RFXK_HUMAN: 63..91
Feature /change: AGSSLKHSTT LTNRQRGNEV SALPATLDS -> A
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5761
Feature /change: g -> c
Feature /genomic_region: intron; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: inframe deletion
Feature /loc: IDRefSeq: C0074: 605..688
Feature /change: -caggcagctc cctgaagcac tccaccactc tcaccaaccg
Feature /change: gcagcgaggg aacgaggtgt cagctctgcc ggccacccta
Feature /change: gact
Feature /note: skipping of exon 4
Feature /inexloc: +1
Feature aa; 6
Feature /rnalink: 5
Feature /name: deletion; inframe
Feature /loc: UniProt: O14593; RFXK_HUMAN: 63..91
Feature /change: AGSSLKHSTT LTNRQRGNEV SALPATLDS -> A
Symptoms Infections:
Symptoms Fungal: candida
Symptoms Gastro-intestinal tract manifestations
Symptoms Protracted diarrhea
Symptoms Other clinical features: recurrent pulmonary infections
Sex XY
Ethnic origin North African
Parents Consanguineous
Status quo Deceased; cause of death: an overwhelming infection at age
Status quo of 7.5 months
//
ID Intron 4(2),Intron 4(2); standard; MUTATION;
Accession R0028
Systematic name Allele 1 and 2: g.IVS4+5G>A, c.G>A, r.g>a,
Original code SM
Description Allele 1 and 2: a point mutation in the intron 4 leading to
Description aberrant splicing
Date 12-Feb-2004 (Rel. 1, Created)
Date 12-Feb-2004 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 14574520
RefAuthors Prod'homme, T., Dekel, B., Barbieri, G., Lisowska-
RefAuthors Grospierre, B., Katz, R., Charron, D., Alcaide-Loridan,
RefAuthors C., Pollack, S.
RefTitle Splicing defect in RFXANK results in a moderate combined
RefTitle immunodeficiency and long-duration clinical course.
RefLoc Immunogenetics 55:530-539 (2003)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5765
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: unknown
Feature /note: prevents the splicing of intron 4 generating a
Feature /note: premature stop codon thereby deleting all four
Feature /note: ankyrin domains
Feature /inexloc: +5
Feature aa; 3
Feature /rnalink: 2
Feature /name: unknown
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: point
Feature /loc: IDRefSeq: D0074: 5765
Feature /change: g -> a
Feature /genomic_region: intron; 4
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /note: prevents the splicing of intron 4 generating a
Feature /note: premature stop codon thereby deleting all four
Feature /note: ankyrin domains
Feature /inexloc: +5
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Symptoms Infections:
Symptoms Bacterial: pneumonia; Salmonella, Campylobacter,
Symptoms Sepsis
Symptoms Gastro-intestinal tract manifestations
Symptoms Protracted diarrhea
Symptoms Other clinical features: a chronic obstructive lung disease
Symptoms with barrel chest and digital clubbing, giardiasis, failure
Symptoms to thrive, malabsorption syndrome with severe osteopenia
Symptoms and iron deficiency anemia
Treatment Total parenteral nutrition: Yes
Treatment IVIG: intermittent
Treatment Still on IVIG, dose: 16mg/Kg/ 3-4 weeks
Sex XX
Ethnic origin Jewish-Egyptian
Comment -!-this is the first case of moderate immunodeficiency
Comment -!-resulting from a defect in RFXANK
//
ID Intron 5(1),Intron 5(1); standard; MUTATION;
Accession R0004
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code Na
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [3]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [4]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; North Africa
Parents Consanguineous
//
ID Intron 5(2),Intron 5(2); standard; MUTATION;
Accession R0005
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code Ab; Bequit; B1
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [3]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; North Africa
//
ID Intron 5(3),Intron 5(3); standard; MUTATION;
Accession R0006
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B3
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Kabylia
Parents Consanguineous
//
ID Intron 5(4),Intron 5(4); standard; MUTATION;
Accession R0007
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B4
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(5),Intron 5(5); standard; MUTATION;
Accession R0008
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B5
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(6),Intron 5(6); standard; MUTATION;
Accession R0009
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B6
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 07-Feb-2003 (Rel. 1, Created)
Date 07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Tunisia
Parents Consanguineous
//
ID Intron 5(7),Intron 5(7); standard; MUTATION;
Accession R0010
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B7
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Kabylia
Parents Consanguineous
//
ID Intron 5(8),Intron 5(8); standard; MUTATION;
Accession R0011
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B9
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(9),Intron 5(9); standard; MUTATION;
Accession R0012
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B10
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Morocco
Parents Consanguineous
//
ID Intron 5(10),?; standard; MUTATION;
Accession R0013
Systematic name Allele 1: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B11
Description Allele 1: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Description Allele 2: Not identified
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Ethnic origin Algeria/France
Parents Non-consanguineous
//
ID Intron 5(11),Intron 5(11); standard; MUTATION;
Accession R0014
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B12
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(12),Intron 5(12); standard; MUTATION;
Accession R0015
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B13
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(13),Intron 5(13); standard; MUTATION;
Accession R0016
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B14
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
//
ID Intron 5(14),Intron 5(14); standard; MUTATION;
Accession R0017
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B15
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(15),Intron 5(15); standard; MUTATION;
Accession R0018
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B16
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Tunisia
Parents Consanguineous
//
ID Intron 5(16),Intron 5(16); standard; MUTATION;
Accession R0019
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B17
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Tunisia
Parents Non-consanguineous
//
ID Intron 5(17),?; standard; MUTATION;
Accession R0020
Systematic name Allele 1: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B18
Description Allele 1: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Description Allele 2: Not identified
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: unknown
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: unknown
Feature aa; 6
Feature /rnalink: 5
Feature /name: unknown
Ethnic origin Negroid; Kabylia
//
ID Intron 5(18),Intron 5(18); standard; MUTATION;
Accession R0021
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B19
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(19),Intron 5(19); standard; MUTATION;
Accession R0022
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code B20
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10803838
RefAuthors Wiszniewski, W., Fondaneche, M. C., Lambert, N.,
RefAuthors Masternak, K., Picard, C., Notarangelo, L., Schwartz, K.,
RefAuthors Bal, J., Reith, W., Alcaide, C., de Saint Basile, G.,
RefAuthors Fischer, A., Lisowska-Grospierre, B.
RefTitle Founder effect for a 26-bp deletion in the RFXANK gene in
RefTitle north african major histocompatibility complex class II-
RefTitle deficient patients belonging to complementation group B.
RefLoc Immunogenetics 51:261-267 (2000)
RefNumber [2]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [3]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [4]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [5]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [6]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; Algeria
Parents Consanguineous
//
ID Intron 5(20),Intron 5(20); standard; MUTATION;
Accession R0025
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code Ramia; Ra
Description Allele 1 and 2: deletion in the intron 5 and exon 6
Description leading to aberrant splicing
Date 11-Feb-2003 (Rel. 1, Created)
Date 11-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 10725724
RefAuthors Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J.
RefAuthors M., van den elsen, P. J.
RefTitle Novel mutations within the RFX-B gene and partial rescue
RefTitle of MHC and related genes through exogenous class II
RefTitle transactivator in RFX-B-deficient cells.
RefLoc J Immunol 164:3666-3674 (2000)
RefNumber [2]
RefCrossRef PUBMED; 10417269
RefAuthors DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle The bare lymphocyte syndrome: molecular clues to the
RefTitle transcriptional regulation of major histocompatibility
RefTitle complex class II genes.
RefLoc Am J Hum Genet 65:279-286 (1999)
RefNumber [3]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6210..6235
Feature /change: -ggtattgccc gcctcctcct gccagg
Feature /genomic_region: intron; 5 exon; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature /inexloc: -25
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
//
ID Intron 6(1),Intron 6(1); standard; MUTATION;
Accession R0023
Systematic name Allele 1 and 2: g.6313_6370del
Original code BLS1
Description Allele 1 and 2: deletion in the exon 6 and intron 6
Description leading to aberrant splicing
Date 10-Feb-2003 (Rel. 1, Created)
Date 10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber [1]
RefCrossRef PUBMED; 9806546
RefAuthors Masternak, K., Barras, E., Zufferey, M., Conrad, B.,
RefAuthors Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser,
RefAuthors D. F., Mach, B., Reith, W.
RefTitle A gene encoding a novel RFX-associated transactivator is
RefTitle mutated in the majority of MHC class II deficiency
RefTitle patients.
RefLoc Nat Genet 20:273-277 (1998)
RefNumber [2]
RefCrossRef PUBMED; 10072068
RefAuthors Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen,
RefAuthors R., Bushey, A., Boss, J. M.
RefTitle RFX-B is the gene responsible for the most common cause of
RefTitle the bare lymphocyte syndrome, an MHC class II
RefTitle immunodeficiency.
RefLoc Immunity 10:153-162 (1999)
RefNumber [3]
RefCrossRef PUBMED; 11704716
RefAuthors Villard, J., Masternak, K., Lisowska-Grospierre, B.,
RefAuthors Fischer, A., Reith, W.
RefTitle MHC class II deficiency: a disease of gene regulation.
RefLoc Medicine (Baltimore) 80:405-418 (2001)
RefNumber [4]
RefCrossRef PUBMED; 11037300
RefAuthors Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L.,
RefAuthors Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M.
RefAuthors S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A.,
RefAuthors Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith,
RefAuthors W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P.,
RefAuthors Villa, A., Valiaho, J., Smith, C. I.
RefTitle Primary immunodeficiency mutation databases.
RefLoc Adv Genet 43:103-188 (2001)
FeatureHeader allele; 1
Feature dna; 1
Feature /rnalink: 2
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6313..6370
Feature /change: -ccgttcgctt cctgctggag tgggtgcgtc ccagcccagc
Feature /change: tgggcagctg gggggttc
Feature /genomic_region: exon; 6 intron; 6
Feature rna; 2
Feature /dnalink: 1
Feature /aalink: 3
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature aa; 3
Feature /rnalink: 2
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader allele; 2
Feature dna; 4
Feature /rnalink: 5
Feature /name: deletion
Feature /loc: IDRefSeq: D0074: 6313..6370
Feature /change: -ccgttcgctt cctgctggag tgggtgcgtc ccagcccagc
Feature /change: tgggcagctg gggggttc
Feature /genomic_region: exon; 6 intron; 6
Feature rna; 5
Feature /dnalink: 4
Feature /aalink: 6
Feature /name: deletion; frameshift
Feature /loc: IDRefSeq: C0074: 689..855
Feature /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga
Feature /change: ccagctgaag gagcatttgc ggaaaggtga caacctcgtc
Feature /change: aacaagccag acgagcgcgg cttcaccccc ctcatctggg
Feature /change: cctccgcctt tggagagatt gagaccgttc gcttcctgct
Feature /change: ggagtgg
Feature /note: skipping of exons 5 and 6
Feature aa; 6
Feature /rnalink: 5
Feature /name: out of frame translation; premature termination
Feature /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature /change: SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW
Feature /change: ASAFGEIETV RFLLEW
Feature /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin Negroid; North Africa
//
|
