ID-bases-logo
- databases for immunodeficiency-causing variations

   RFXANKbase
   Variation registry for  Ankyrin repeat containing regulatory factor X-associated protein deficiency


Database        RFXANKbase
Version         1.0
File            rfxankpub.txt
Date            16-Jun-2011
Curator         Mauno Vihinen
Address         Protein Structure and Bioinformatics 
Address         Lund University, BMC D10, SE-22184 Lund, Sweden
Phone           +46 72 526 0022
Fax             +46 46 222 9328
Email           Mauno Vihinen
URL             http://structure.bmc.lu.se/idbase/RFXANKbase/
IDR factfile    http://structure.bmc.lu.se/idbase/IDRefSeq/xml/idr/ff/FF15.html
Gene            RFXANK
Disease         Ankyrin repeat containing regulatory factor X-associated 
Disease         protein deficiency  
OMIM            603200
GDB             9956049
Sequence        IDRefSeq:D0074; IDRefSeq:C0074; UniProt:O14593 
Numbering       start of the entry
Funding         Tampere University Hospital Medical Research Fund
Funding         European Union
Comments        sequence entry reference in every entry
//
ID              E102X(1),E102X(1); standard; MUTATION;
Accession       R0001
Systematic name Allele 1 and 2: g.5932G>T, c.721G>T, p.E102X
Original code   EBA
Description     Allele 1 and 2: point mutation in the exon 5 leading to a 
Description     premature stop codon
Date            04-Feb-2003 (Rel. 1, Created)
Date            04-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 10725724
RefAuthors      Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J. 
RefAuthors      M., van den elsen, P. J.
RefTitle        Novel mutations within the RFX-B gene and partial rescue 
RefTitle        of MHC and related genes through exogenous class II 
RefTitle        transactivator in RFX-B-deficient cells.
RefLoc          J Immunol 164:3666-3674 (2000)
RefNumber       [3]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [4]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5932
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 721
Feature           /codon: gag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature           /change: E -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5932
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 721
Feature           /codon: gag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature           /change: E -> X
//
ID              E102X(2),E102X(2); standard; MUTATION;
Accession       R0026
Systematic name Allele 1 and 2: g.5932G>T, c.304G>T, r.304g>u, p.Glu102X
Original code   B22
Description     Allele 1 and 2: a point mutation in the exon 5 leading to a
Description     premature stop codon
Date            20-Oct-2003 (Rel. 1, Created)
Date            20-Oct-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5932
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 721
Feature           /codon: gag -> tag; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature           /change: E -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5932
Feature           /change: g -> t
Feature           /genomic_region: exon; 5
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 721
Feature           /codon: gag -> tag; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 102
Feature           /change: E -> X
Ethnic origin   Turkey
Relative        
//
ID              D121V(1),D121V(1); standard; MUTATION;
Accession       R0030
Systematic name Allele 1 and 2: g.6259A>T, c.362A>T, r.362a>u, p.Asp121Val
Original code   B26
Description     Allele 1 and 2: A point mutation in the exon 6 leading to
Description     an amino acid change
Date            04-Aug-2010 (Rel. 1, Created)
Date            04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED;  12618906
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Louise-Plence, P., 
RefAuthors      Prochnicka-Chalufour, A., Selz, F., Picard, C., Le Deist, 
RefAuthors      F., Eliaou, J. F., Fischer, A., Lisowska-Grospierre, B.
RefTitle        Novel mutations in the RFXANK gene: RFX complex containing 
RefTitle        in-vitro-generated RFXANK mutant binds the promoter 
RefTitle        without transactivating MHC II.
RefLoc          Immunogenetics:747-755 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 6259
Feature           /change: a -> t
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 779
Feature           /codon: gac -> gtc; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 121
Feature           /change: D -> V
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 6259
Feature           /change: a -> t
Feature           /genomic_region: exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 779
Feature           /codon: gac -> gtc; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 121
Feature           /change: D -> V
Symptoms        Recurrent infections; Severe diarrhea; Failure to
Symptoms        thrive;
Ethnic origin   Saudi Arabia
Parents         Consanguineous
//
ID              #L128X203(1),Intron 6(2); standard; MUTATION;
Accession       R0024
Systematic name Allele 1: g.6280delT, c.800delT, p.L128fsX203
Systematic name Allele 2: g.IVS6-1G>T
Original code   B25
Description     Allele 1: deletion in the exon 6 leading to a premature 
Description     stop codon
Description     Allele 2: point mutation in the intron 6 leading to 
Description     skipping of exon 7 
Description     amino acid change
Date            11-Feb-2003 (Rel. 1, Created)
Date            11-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6280
Feature           /change: -t
Feature           /genomic_region: exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: frameshift
Feature           /loc: IDRefSeq: C0074: 800
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 128
Feature           /change:    L 
Feature           /change: -> PSGPPPLERL RPFASCWSGV PTPTSWQKSE RAPCRWPAQA 
Feature           /change:    ATQTLWGCCW SVTWTSTSMI GMEGRHCCTL CAGTTX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 6820
Feature           /change: g -> t
Feature           /genomic_region: intron; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0074: 856..981
Feature           /change: -ggtgccgacc cccacatcct ggcaaaagag cgagagagcg 
Feature           /change:  ccctgtcgct ggccagcaca ggcggctaca cagacattgt 
Feature           /change:  ggggctgctg ctggagcgtg acgtggacat caacatctat 
Feature           /change:  gattgg
Feature           /note: skipping of exon 7
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: deletion; inframe
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 147..188
Feature           /change:   
Feature           /change: -GADPHILAKE RESALSLAST GGYTDIVGLL LERDVDINIY 
Feature           /change:   DW
Ethnic origin   Caucasoid; France/Spain
Parents         Non-consanguineous
//
ID              R157X(1),R157X(1); standard; MUTATION;
Accession       R0003
Systematic name Allele 1 and 2: g.6851C>T, c.886C>T, p.R157X
Original code   B23
Description     Allele 1 and 2: point mutation in the exon 7 leading to a 
Description     premature stop codon
Date            05-Feb-2003 (Rel. 1, Created)
Date            05-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [3]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 6851
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 886
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 157
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 6851
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 7
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074: 886
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 157
Feature           /change: R -> X
Ethnic origin   Caucasoid; Italy
//
ID              L195P(1),L195P(1); standard; MUTATION;
Accession       R0002
Systematic name Allele 1 and 2: g.7390T>C, c.1001T>C, p.L195P
Original code   FZA
Description     Allele 1 and 2: point mutation in the exon 8 leading to an 
Description     amino acid change
Date            04-Feb-2003 (Rel. 1, Created)
Date            04-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [2]
RefCrossRef     PUBMED; 10725724
RefAuthors      Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J. 
RefAuthors      M., van den elsen, P. J.
RefTitle        Novel mutations within the RFX-B gene and partial rescue 
RefTitle        of MHC and related genes through exogenous class II 
RefTitle        transactivator in RFX-B-deficient cells.
RefLoc          J Immunol 164:3666-3674 (2000)
RefNumber       [3]
RefCrossRef     PUBMED; 11463838
RefAuthors      Nekrep, N., Geyer, M., Jabrane-Ferrat, N., Peterlin, B. M.
RefTitle        Analysis of ankyrin repeats reveals how a single point 
RefTitle        mutation in RFXANK results in bare lymphocyte syndrome.
RefLoc          Mol Cell Biol 21:5566-5576 (2001)
RefNumber       [4]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [5]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 7390
Feature           /change: t -> c
Feature           /genomic_region: exon; 8
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: missense
Feature           /loc: IDRefSeq: C0074: 1001
Feature           /codon: ctg -> ccg; 2
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: aa substitution
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 195
Feature           /change: L -> P
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 7390
Feature           /change: t -> c
Feature           /genomic_region: exon; 8
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: missense
Feature           /loc: IDRefSeq: C0074: 1001
Feature           /codon: ctg -> ccg; 2
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: aa substitution
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 195
Feature           /change: L -> P
//
ID              R212X(1),R212X(1); standard; MUTATION;
Accession       R0029
Systematic name Allele 1 and 2: g.7870C>T, c.634C>T, r.634c>u, p.Arg212X
Original code   B21
Description     Allele 1 and 2: A point mutation in the exon 9 leading to a
Description     premature stop codon
Date            04-Aug-2010 (Rel. 1, Created)
Date            04-Aug-2010 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED;  12618906
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Louise-Plence, P., 
RefAuthors      Prochnicka-Chalufour, A., Selz, F., Picard, C., Le Deist, 
RefAuthors      F., Eliaou, J. F., Fischer, A., Lisowska-Grospierre, B.
RefTitle        Novel mutations in the RFXANK gene: RFX complex containing 
RefTitle        in-vitro-generated RFXANK mutant binds the promoter 
RefTitle        without transactivating MHC II.
RefLoc          Immunogenetics:747-755 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 7870
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 9
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 1051
Feature           /codon: cga -> tga; 1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 212
Feature           /change: R -> X
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 7870
Feature           /change: c -> t
Feature           /CpG; 1
Feature           /genomic_region: exon; 9
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: nonsense
Feature           /loc: IDRefSeq: C0074; GI:6093962; RFXANKC: 1051
Feature           /codon: cga -> tga; 1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 212
Feature           /change: R -> X
Symptoms        Recurrent infections; Severe diarrhea; Failure to
Symptoms        thrive;
Ethnic origin   Turkey
Parents         Consanguineous
//
ID              Intron 4(1),Intron 4(1); standard; MUTATION;
Accession       R0027
Systematic name Allele 1 and 2: g.IVS4+1G>C, c.G>C, r.g>c,
Original code   JER
Description     Allele 1 and 2: a point mutation in the intron 4 leading to
Description     aberrant splicing
Date            12-Feb-2004 (Rel. 1, Created)
Date            12-Feb-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 11313409
RefAuthors      Lennon-Dumenil, A. M., Barbouche, M. R., Vedrenne, J., 
RefAuthors      Prod'Homme, T., Bejaoui, M., Ghariani, S., Charron, D., 
RefAuthors      Fellous, M., Dellagi, K., Alcaxde-Loridan, C.
RefTitle        Uncoordinated HLA-D gene expression in a RFXANK-defective 
RefTitle        patient with MHC class II deficiency.
RefLoc          J Immunol 166:5681-5687 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5761
Feature           /change: g -> c
Feature           /genomic_region: intron; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0074: 605..688
Feature           /change: -caggcagctc cctgaagcac tccaccactc tcaccaaccg
Feature           /change:  gcagcgaggg aacgaggtgt cagctctgcc ggccacccta 
Feature           /change:  gact
Feature           /note: skipping of exon 4
Feature           /inexloc: +1
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: deletion; inframe
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 63..91
Feature           /change: AGSSLKHSTT LTNRQRGNEV SALPATLDS -> A
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5761
Feature           /change: g -> c
Feature           /genomic_region: intron; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: inframe deletion
Feature           /loc: IDRefSeq: C0074: 605..688
Feature           /change: -caggcagctc cctgaagcac tccaccactc tcaccaaccg
Feature           /change:  gcagcgaggg aacgaggtgt cagctctgcc ggccacccta 
Feature           /change:  gact
Feature           /note: skipping of exon 4
Feature           /inexloc: +1
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: deletion; inframe
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 63..91
Feature           /change: AGSSLKHSTT LTNRQRGNEV SALPATLDS -> A
Symptoms        Infections: 
Symptoms           Fungal: candida
Symptoms        Gastro-intestinal tract manifestations
Symptoms           Protracted diarrhea
Symptoms        Other clinical features: recurrent pulmonary infections
Sex             XY
Ethnic origin   North African
Parents         Consanguineous
Status quo      Deceased; cause of death: an overwhelming infection at age 
Status quo      of 7.5 months
//
ID              Intron 4(2),Intron 4(2); standard; MUTATION;
Accession       R0028
Systematic name Allele 1 and 2: g.IVS4+5G>A, c.G>A, r.g>a,
Original code   SM
Description     Allele 1 and 2: a point mutation in the intron 4 leading to
Description     aberrant splicing
Date            12-Feb-2004 (Rel. 1, Created)
Date            12-Feb-2004 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 14574520
RefAuthors      Prod'homme, T., Dekel, B., Barbieri, G., Lisowska-
RefAuthors      Grospierre, B., Katz, R., Charron, D., Alcaide-Loridan, 
RefAuthors      C., Pollack, S.
RefTitle        Splicing defect in RFXANK results in a moderate combined 
RefTitle        immunodeficiency and long-duration clinical course.
RefLoc          Immunogenetics 55:530-539 (2003)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5765
Feature           /change: g -> a
Feature           /genomic_region: intron; 4
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: unknown
Feature           /note: prevents the splicing of intron 4 generating a 
Feature           /note: premature stop codon thereby deleting all four 
Feature           /note: ankyrin domains
Feature           /inexloc: +5
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: unknown
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: point
Feature           /loc: IDRefSeq: D0074: 5765
Feature           /change: g -> a
Feature           /genomic_region: intron; 4
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /note: prevents the splicing of intron 4 generating a 
Feature           /note: premature stop codon thereby deleting all four 
Feature           /note: ankyrin domains
Feature           /inexloc: +5
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Symptoms        Infections: 
Symptoms           Bacterial: pneumonia; Salmonella, Campylobacter,
Symptoms        Sepsis
Symptoms        Gastro-intestinal tract manifestations
Symptoms           Protracted diarrhea
Symptoms        Other clinical features: a chronic obstructive lung disease
Symptoms        with barrel chest and digital clubbing, giardiasis, failure
Symptoms        to thrive, malabsorption syndrome with severe osteopenia
Symptoms        and iron deficiency anemia
Treatment       Total parenteral nutrition: Yes
Treatment       IVIG: intermittent
Treatment          Still on IVIG, dose: 16mg/Kg/ 3-4 weeks
Sex             XX
Ethnic origin   Jewish-Egyptian
Comment         -!-this is the first case of moderate immunodeficiency 
Comment         -!-resulting from a defect in RFXANK
//
ID              Intron 5(1),Intron 5(1); standard; MUTATION;
Accession       R0004
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   Na
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [2]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [3]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [4]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; North Africa
Parents         Consanguineous
//
ID              Intron 5(2),Intron 5(2); standard; MUTATION;
Accession       R0005
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   Ab; Bequit; B1
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [2]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [3]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; North Africa
//
ID              Intron 5(3),Intron 5(3); standard; MUTATION;
Accession       R0006
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B3
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Kabylia
Parents         Consanguineous
//
ID              Intron 5(4),Intron 5(4); standard; MUTATION;
Accession       R0007
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B4
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(5),Intron 5(5); standard; MUTATION;
Accession       R0008
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B5
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(6),Intron 5(6); standard; MUTATION;
Accession       R0009
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B6
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            07-Feb-2003 (Rel. 1, Created)
Date            07-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Tunisia
Parents         Consanguineous
//
ID              Intron 5(7),Intron 5(7); standard; MUTATION;
Accession       R0010
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B7
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Kabylia
Parents         Consanguineous
//
ID              Intron 5(8),Intron 5(8); standard; MUTATION;
Accession       R0011
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B9
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(9),Intron 5(9); standard; MUTATION;
Accession       R0012
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B10
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Morocco
Parents         Consanguineous
//
ID              Intron 5(10),?; standard; MUTATION;
Accession       R0013
Systematic name Allele 1: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B11
Description     Allele 1: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Description     Allele 2: Not identified
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: unknown
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Ethnic origin   Algeria/France
Parents         Non-consanguineous
//
ID              Intron 5(11),Intron 5(11); standard; MUTATION;
Accession       R0014
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B12
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(12),Intron 5(12); standard; MUTATION;
Accession       R0015
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B13
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(13),Intron 5(13); standard; MUTATION;
Accession       R0016
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B14
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
//
ID              Intron 5(14),Intron 5(14); standard; MUTATION;
Accession       R0017
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B15
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(15),Intron 5(15); standard; MUTATION;
Accession       R0018
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B16
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Tunisia
Parents         Consanguineous
//
ID              Intron 5(16),Intron 5(16); standard; MUTATION;
Accession       R0019
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B17
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Tunisia
Parents         Non-consanguineous
//
ID              Intron 5(17),?; standard; MUTATION;
Accession       R0020
Systematic name Allele 1: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B18
Description     Allele 1: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Description     Allele 2: Not identified
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: unknown
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: unknown
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: unknown
Ethnic origin   Negroid; Kabylia
//
ID              Intron 5(18),Intron 5(18); standard; MUTATION;
Accession       R0021
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B19
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(19),Intron 5(19); standard; MUTATION;
Accession       R0022
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   B20
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10803838
RefAuthors      Wiszniewski, W., Fondaneche, M. C., Lambert, N., 
RefAuthors      Masternak, K., Picard, C., Notarangelo, L., Schwartz, K., 
RefAuthors      Bal, J., Reith, W., Alcaide, C., de Saint Basile, G., 
RefAuthors      Fischer, A., Lisowska-Grospierre, B.
RefTitle        Founder effect for a 26-bp deletion in the RFXANK gene in 
RefTitle        north african major histocompatibility complex class II-
RefTitle        deficient patients belonging to complementation group B.
RefLoc          Immunogenetics 51:261-267 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [3]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [4]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [5]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [6]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; Algeria
Parents         Consanguineous
//
ID              Intron 5(20),Intron 5(20); standard; MUTATION;
Accession       R0025
Systematic name Allele 1 and 2: g.IVS5-25GGTATTGCCCGCCTCCTCCTGCCAGG>
Original code   Ramia; Ra
Description     Allele 1 and 2: deletion in the intron 5 and exon 6 
Description     leading to aberrant splicing 
Date            11-Feb-2003 (Rel. 1, Created)
Date            11-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 10725724
RefAuthors      Nagarajan, U. M., Peijnenburg, A., Gobin, S. J., Boss, J. 
RefAuthors      M., van den elsen, P. J.
RefTitle        Novel mutations within the RFX-B gene and partial rescue 
RefTitle        of MHC and related genes through exogenous class II 
RefTitle        transactivator in RFX-B-deficient cells.
RefLoc          J Immunol 164:3666-3674 (2000)
RefNumber       [2]
RefCrossRef     PUBMED; 10417269
RefAuthors      DeSandro, A., Nagarajan, U. M., Boss, J. M.
RefTitle        The bare lymphocyte syndrome: molecular clues to the 
RefTitle        transcriptional regulation of major histocompatibility 
RefTitle        complex class II genes.
RefLoc          Am J Hum Genet 65:279-286 (1999)
RefNumber       [3]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6210..6235
Feature           /change: -ggtattgccc gcctcctcct gccagg
Feature           /genomic_region: intron; 5 exon; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature           /inexloc: -25
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
//
ID              Intron 6(1),Intron 6(1); standard; MUTATION;
Accession       R0023
Systematic name Allele 1 and 2: g.6313_6370del
Original code   BLS1
Description     Allele 1 and 2: deletion in the exon 6 and intron 6 
Description     leading to aberrant splicing 
Date            10-Feb-2003 (Rel. 1, Created)
Date            10-Feb-2003 (Rel. 1, Last updated, Version 1)
RefNumber       [1]
RefCrossRef     PUBMED; 9806546
RefAuthors      Masternak, K., Barras, E., Zufferey, M., Conrad, B., 
RefAuthors      Corthals, G., Aebersold, R., Sanchez, J. C., Hochstrasser, 
RefAuthors      D. F., Mach, B., Reith, W.
RefTitle        A gene encoding a novel RFX-associated transactivator is 
RefTitle        mutated in the majority of MHC class II deficiency 
RefTitle        patients.
RefLoc          Nat Genet 20:273-277 (1998)
RefNumber       [2]
RefCrossRef     PUBMED; 10072068
RefAuthors      Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, 
RefAuthors      R., Bushey, A., Boss, J. M.
RefTitle        RFX-B is the gene responsible for the most common cause of 
RefTitle        the bare lymphocyte syndrome, an MHC class II 
RefTitle        immunodeficiency.
RefLoc          Immunity 10:153-162 (1999)
RefNumber       [3]
RefCrossRef     PUBMED; 11704716
RefAuthors      Villard, J., Masternak, K., Lisowska-Grospierre, B., 
RefAuthors      Fischer, A., Reith, W.
RefTitle        MHC class II deficiency: a disease of gene regulation.
RefLoc          Medicine (Baltimore) 80:405-418 (2001)
RefNumber       [4]
RefCrossRef     PUBMED; 11037300
RefAuthors      Vihinen, M., Arredondo-Vega, F. X., Casanova, J. L., 
RefAuthors      Etzioni, A., Giliani, S., Hammarstrom, L., Hershfield, M. 
RefAuthors      S., Heyworth, P. G., Hsu, A. P., Lahdesmaki, A., 
RefAuthors      Lappalainen, I., Notarangelo, L. D., Puck, J. M., Reith, 
RefAuthors      W., Roos, D., Schumacher, R. F., Schwarz, K., Vezzoni, P., 
RefAuthors      Villa, A., Valiaho, J., Smith, C. I.
RefTitle        Primary immunodeficiency mutation databases.
RefLoc          Adv Genet 43:103-188 (2001)
FeatureHeader   allele; 1
Feature         dna; 1
Feature           /rnalink: 2
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6313..6370
Feature           /change: -ccgttcgctt cctgctggag tgggtgcgtc ccagcccagc 
Feature           /change:  tgggcagctg gggggttc
Feature           /genomic_region: exon; 6 intron; 6
Feature         rna; 2
Feature           /dnalink: 1
Feature           /aalink: 3
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature         aa; 3
Feature           /rnalink: 2
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
FeatureHeader   allele; 2
Feature         dna; 4
Feature           /rnalink: 5
Feature           /name: deletion
Feature           /loc: IDRefSeq: D0074: 6313..6370
Feature           /change: -ccgttcgctt cctgctggag tgggtgcgtc ccagcccagc 
Feature           /change:  tgggcagctg gggggttc
Feature           /genomic_region: exon; 6 intron; 6
Feature         rna; 5
Feature           /dnalink: 4
Feature           /aalink: 6
Feature           /name: deletion; frameshift
Feature           /loc: IDRefSeq: C0074: 689..855
Feature           /change: -ccctgtccat ccaccagctc gcagcacagg gggagctgga 
Feature           /change:  ccagctgaag gagcatttgc ggaaaggtga caacctcgtc 
Feature           /change:  aacaagccag acgagcgcgg cttcaccccc ctcatctggg 
Feature           /change:  cctccgcctt tggagagatt gagaccgttc gcttcctgct 
Feature           /change:  ggagtgg
Feature           /note: skipping of exons 5 and 6
Feature         aa; 6
Feature           /rnalink: 5
Feature           /name: out of frame translation; premature termination
Feature           /loc: UniProt: O14593; RFXK_HUMAN: 91..146
Feature           /change:    SLSIHQLAAQ GELDQLKEHL RKGDNLVNKP DERGFTPLIW 
Feature           /change:    ASAFGEIETV RFLLEW 
Feature           /change: -> WCRPPHPGKR ARERPVAGQH RRLHRHCGAA AGAX
Ethnic origin   Negroid; North Africa
//